1.
Comparative Pharmacokinetics Of Levofloxacin In Healthy Volunteers & Patients Suffering From Typhoid Fever
by Muhammed Usman | Prof.Dr.Muhammad Ashraf | Dr. Muhammad Imran Khokhar | Dr. Shehryar.
Material type: ; Format:
print
Publisher: 2008Dissertation note: This study was designed to compare the pharmacokinetic parameters of Levofloxacin in healthy volunteers and in human patients suffering from typhoid fever (target individuals). The study was conducted in six healthy male volunteers and six male patients suffering from typhoid fever in Services Institute of Medical Sciences (SIMS) Lahore. Only those patients were selected who were suffering from typhoid (confirmed after widal test) between the age of 25-40 years. Healthy volunteers were also between age of 25-40 years. The patients were considered as group A and healthy volunteers were considered as group B. Both groups were treated with Levofloxacin 5 00mg tab orally per individual. 5m1 Blood samples were collected at 0, 0.25, 0.5, 1, 2, 3, 6, 12, 24, 36 & 72 hr from vein through 5m1 B.D syring of 23guage needle after oral administration of Levofloxacin. Plasma was separated by centrifugation at 5000 RPM and stored at -20°C until assayed. Levofloxacin concentrations in plasma were measured by previously described HPLC method. Calculation of all the pharmacokinetic parameters was done by entering plasma concentration-time data in software APO pharmacological analysis MW/PHARM version 3.02 by assuming bio-availability of levofloxacin after oral administration as 1. Pharmacokinetic parameters of Levofloxacin in healthy volunteers and in typhoid patients were compared. Data was analyzed by appropriate statistical methods and it was observed that there is no significant difference in pharmacokinetic parameters of Levofloxacin in healthy volunteers and in typhoid patients after oral administration and there is no need for dose adjustment of Levofloxacin in typhoid patients.
Availability: Items available for loan: UVAS Library [Call number: 1027,T] (1).
2.
The Diagnostic Value Of Tta Codon Substitution In Los Angeles Galactosemia
by Sahr Malik | Dr. Muhammad Imran | Dr. Muhammad | Miss. Sehrish Firyal.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2012Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1590,T] (1).
3.
Pcr (Polymerase Chain Reaction) Test Development And Its Application For The Diagnosis Of Congenital Leptin Deficiency
by Nida Fakhar | Dr. Muhammad Imran | Miss Faiza | Miss. Sehrish Firyal.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1383,T] (1).
4.
Identification Of Pesticide Residues In Different Vegetable Collected From Market Of Lahore, Pakistan.
by Anam Munawar | Dr. Muhammad Imran | Dr. Abu Saeed Hashmi | Dr. Muhammad.
Material type: ; Format:
print
Publisher: 2013Dissertation note: Pesticides are the chemicals which are used to kill or repel the unwanted objects such as pests. Different types of pesticides are present which undergo a different mechanism and kill the pests. Four different types are being used in Pakistan such as organophosphate, organochlorine, pyrehtroid and carbamates. Use of organophosphate and organochlorine become less due the presence of residues. Use of pesticides is increased for a number of purposes such as to increase the rate of production, to decrease the damage of crops and to increase the saving time of different vegetables.
Vegetables are the main source of income of Pakistan, and vegetables are common in our use. Vegetables contain different nutritional elements of our diets. That's why vegetables play an important role in the nutritious diet of a person. The spray of different chemicals on vegetables not only decreases the nutritional elements but also increase the risk of different diseases.
As pesticides leave their residues in vegetables, different techniques can be used to detect the residues and their maximum residue limit, at which limit these pesticides are harmful for humans. Pesticides can also act on unintended individual such as human beings and cause different acute and chronic diseases.
Different vegetables were selected for analyses that are common in use and available in every season. Pesticides which were selected are that which are common in Pakistan and from different pesticide classes.
In present study vegetables of different areas of Lahore were collected and analyzed through HPTLC and GC/MS. HPTLC was used to analyze and calculate the concentration and GC/MS was used for the confirmation of results, and it was concluded that which vegetable contain the high concentration of pesticides. It was studied that which vegetable absorb large amount of pesticides. Potato, tomato, egg plant, okra and cucumber of different markets of Lahore contain high concentration of pesticides as compared to the other vegetables.
Availability: Items available for loan: UVAS Library [Call number: 1510,T] (1).
5.
Diagnostic Value Of 4Bp- 5' Gtca Deletion In Duarte Galactosemia
by Sadia Zia | Dr. Muhammad Imran | Ms. Faiza | Ms. Sehrish Firyal.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1602,T] (1).
6.
Leptin Mutations In Morbidly Obese And Severely Lean Individuals From Pakistan
by Muhammad Wasim | Dr. Sehrish Firyal | Dr. Muhammad | Dr. Muhammad Imran.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1623,T] (1).
7.
Identification Of Pesticides Residues In Defferent Samples Of Milk
by Neelam Shahzadi | Dr. Muhammad Imran | Dr. Abu Saeed Hashmi | Dr. Muhammad.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1646,T] (1).
8.
Identification Of Polymorphism In Bone Morphogentic Protein Receptor Type-1B (Bmpr-1B) In Teddy Goats
by Sonia Noreen Anjum | Dr. Muhammad Imran | Dr. Abu Saeed | Ms. Sehrish Firyal.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: Teddy goats provide a great scope for enhancing meat and milk production being the primary objective to compensate for increased demand in Pakistan. It is an established fact that an animal producing twins or triplet contributes more than 1.5 times toward meat than the animals producing single offspring per kidding. Hence, the identification of major fecundity genes, mutations of which are thought to elevate ovulation rate and litter size in goats as well as sheep breeds, has been the center of attention for all scientists. Four major fecundity genes expressed in goat ovary namely: GDF-9, BMP-15, ESR-? and BMPR-1B are the causative genes for high prolificacy.
Bone morphogenetic protein receptor type-1B (BMPR-1B) gene first identified ingranulosa cells of ovary. A-G transition at 746 bp at the FecB gene locus causing an amino acid substitution namely Q249R increases the antral follicular maturation leading to the release of a large number of ovules hence increasing litter size in range from 1.4-2.7 kids/birth.
In this study, blood samples from 52 Teddy goats were collected having twining record and processed for DNA extraction. DNA fragments containing FecB gene were PCR-amplified from extracted DNA samples. The PCR amplicons containing Q249R substitution were subjected to RFLP so that the presence or absence of these polymorphisms could be analyzed.
On analysis with DdeI restriction enzyme, three types of allelic fragments namely: wild type, homozygous mutant and heterozygous mutant of FecB gene mutation in Pakistani Teddy goats were to be observed. Whereas,the results obtained for this study strongly suggests that the Q249R mutation of FecB marker in BMPR-1B gene was not present in Teddy goats and these goats were found to be non-carriers for this mutation having wild type alleles. However, this work did not claimed the absence of any other mutation in BMPR-1B. There may be the involvement of other fecundity genescausing the increased prolificacy of these goats causing twining and triplets namely: Growth differentation factor-9 (GDF-9) and bone morphogenetic protein-15 (BMP-15).
Availability: Items available for loan: UVAS Library [Call number: 1670,T] (1).
9.
Comparasion Of Differnt Presumptive Tests For Detection Of Bloodstain After Washing Fabric With Different
by Samreen Mushtaq | Ms. Sehrish Firyal | Dr. Muhammad Imran | Ms. Faiza.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1674,T] (1).
10.
Detection And Quantification Of Dna From Saaliva From Cigarette Butts In Different Genders
by Qurra-tul-Aien | Prof. Dr. Tahir Yaqub | Dr. Abu Saeed | Dr. Muhammad Imran.
Material type: ; Format:
print
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1675,T] (1).
11.
Genetic Characterization Of Livestock Species Of Pakistan Through Dna Barcoding
by Madiha Booter | Dr.Ali Raza Awan | Dr. Abu saeed | Dr. Muhammad Imran.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: The interaction of livestock with ecosystem plays a vital role in sustainability of life. The demand of livestock products is rising day by day which is changing the relationship between livestock and natural resources. Livestock animals are playing a major role towards domestication and also contributing to fulfill human needs through meat and milk production for food industry, which generate big revenues. Pakistan is blessed with the world's best livestock species and there is a need to establish a well characterized system for the classification and identification of these important livestock species.
Mitochondrial DNA is of small size, constitutes a small fraction of the total of cell's genome and due to high rate of mutation, it is considered to be an ideal model to study evolutionary relationships. DNA barcoding is being used to characterize animals by using a standard region of mitochondrial DNA as a molecular marker. The study is designed to develop the DNA barcode for genetic characterization of livestock species of Pakistan which includes sheep, goat, cow, buffalo and camel.
Blood samples were collected from the selected livestock species. Primers were designed using primer designing free-ware software. The amplified PCR products weresequenced in both orientations by chain termination method. For data analysis,Chromas was used to read sequencing results. To study variation in all sequenced data, alignment tools were used from NCBI. Theblastnalignment tool available at NCBI is more reliable to give authentic results.The alignment results showed 100% homology with the reference sequences (No SNP or mutation was identified). The results can further be validated with the help of mass level sampling to rationalize the study at population level.Phylogenetic analysis indicated that COIDNA barcode region can be used to discriminate unknown samples of any of the species under consideration. The COIgene successfully cladded already reported sequences of the same species.
This study provided genetic data which help in species identification, to assess evolutionary pattern and genetic diversity. So, it will also be helpful to monitor legal or illegal trade of livestock species and to identify processed and unprocessed meat for quality assurance. Establishment of an elaborated DNA barcode system for livestock species will help to start taxonomic investigation and will lead towards to identify many new mammalian species of Pakistan.
Availability: Items available for loan: UVAS Library [Call number: 1752,T] (1).
12.
Recovery Of Latent Finger Prints From Materials Immersed Om Aqiatic Environment: The Under Water Crime Scene Investigation
by Tahir Ismail | Mr. Akhtar Ali | Dr. Muhammad | Dr. Muhammad Imran.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: Finger prints evidence is regarded as the best means of personal identification. It can also
distinguish between identical twins. The type of finger prints invisible to the naked eye is known
as latent finger prints. Recovery of latent finger prints from materials depends on a number of
factors such as type of material, environmental conditions and duration of exposure. Water
comprises about 71% of the earth. As the number of people visiting water ways (rivers, canals,
streams etc.) is increasing, the incident rate of crimes has been found to rise at these places.
Moreover, criminals find it convenient to dispose of weapons and evidences in the water ways.
Forensic science consists of a variety of techniques that are applied in order to answer the
questions of interest to legal system. Cyanoacrylate fuming and dusting powder methods are
used for the development of latent finger prints from materials immersed in aquatic environment.
By examining the characteristics of latent finger prints, on materials thrown in to water, the
forensic scientist may positively identify the perpetrator.
This research activity was conducted to evaluate the effect of type of material, immersion
medium and time length of immersion in aquatic environment, in a realistic setting, using
materials that closely resemble the common evidences. The materials comprised stainless steel
knives, aluminum foils, used brass cartridges, soft drink plastic bottles and glass slides. For every
material, sample size was kept 196. The samples were labeled with permanent identification
numbers. After deposition of finger prints by volunteers, the materials were placed in the tubs of
immersion media, one tub for each type of material. Maximum immersion time was 35 days. 21 samples of each material were taken out of water at day 5, 10, 15, 20, 25, 30 and 35. The
taken out 21 samples and 7 controls were processed for latent finger prints development, with
cyanoacrylate fuming and dusting powder methods.
Cyanoacrylate fuming was performed in a zip lock transparent polythene bag. A china
dish covered with aluminum foil and having NaOH treated cotton balls was introduced in the
fuming chamber. Samples, controls and a beaker of hot water were also placed. Cyanoacrylate
(ELFYTM) drops were put over the cotton balls and zip was closed immediately. The controls
were observed for optimum development of latent finger prints. After development, each finger
print was lifted using tape lifter, placed on a white finger print card and examined with the help
of a magnifying glass. The finger prints were assessed using a scoring system, based on the
visibility of finger prints, as adopted in various published studies.
Similar results were obtained for up to 5 days immersion in all the immersion media.
Differences arose from day 10. This time and onwards, finger prints could not be developed from
brass cartridges immersed in any media. Canal water was noted to favor the retention of latent
finger prints because suspended particles in canal water tend to adhere the latent finger prints.
Detergents in sewerage water were found to quickly wipe the latent finger prints residue.
Chlorine used as dis-infectant in swimming pools is acidic in nature. Under acidic conditions,
development of latent finger prints becomes difficult.
The data was analyzed for results by Pearson’s co-efficient of correlation using IBM SPSS
20.0 software. The study illustrated that there is correlation among type of material, immersion
medium and time length of immersion in aquatic environment. It will provide valuable
information for crime investigation agencies to establish a link between finger prints evidence
recovered from various materials immersed in aquatic environment and the suspected person.
Availability: Items available for loan: UVAS Library [Call number: 1763,T] (1).
13.
Isolation Of Local Strain Of Toxoplasma Gondii Through In-Vivo Cultivation In Mice
by Rahim Gul | Dr. Muhammad Imran Rashid | Dr. Aneela | Dr. Nisar Ahmad.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: Toxoplasma gondii is an obligate apicomplexan, intracellular, parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat faeces or through the consumption of meat containing Toxoplasma gondii cysts. Thus, food animals can be the source of transmission of Toxoplasmosis in human population especially among people who consume undercooked meat in the forms of barbecues, beef steaks, kebabs, burgers and shawarmas. Oocysts of T. gondii from cat faeces were identified by using direct microscopy and flotation technique. The positive oocysts were confirmed by micrometry having diameter of 9-13 ìm. The oocysts were then sporulated in aerated condition. After sporulation oocyst were inoculated in Swiss albino mice for in-vivo culturing. After 56-70 days brain tissue was collected from infected mice and subjected to DNA extraction and PCR amplification. Similarly DNA was also extracted from sporulated oocyst for copro-PCR. Out of 200 faecal samples only three were found positive for Toxoplasma gondii through direct microscopic examination and flotation technique. From positive faecal sample and brain tissue DNA was extracted by QIAGEN mini stool kit and QIAGEN DNA mini kit. After DNA extraction the samples were examined through PCR by using specific Toxoplasma gondii B1 gene primer having 529 bp size. Two hundred faecal samples were examined for T. gondii using direct microscopy, flotation technique, bioassay and polymerase chain reaction. Out of 200 samples 3 (1.5%) were found infected through direct microscopy and flotation technique. Toxoplasmosis was more prevalent in adult cats (1.65%) as compared to young ones. Prevalence was also found high in females (2.08%) as compared to males. Similarly healthy cats have higher prevalence rate (1.30%) as compared to diseased ones. A further confirmation was done through polymerase chain reaction and brain tissue cyst Bioassay give 1 positive amplification while Copro-PCR gives 2 positive amplifications. Therefore it can be concluded that the copro-PCR is can be used for the confirmation of Toxoplasma oocysts from cat faeces and tissue cysts from bioassay in mice. Therefore, we propose that the copro-PCR can be used as the new gold standard for determining potential cat infectivity and tissue cysts from bioassayed mice or contaminated meat samples of livestock.
Availability: Items available for loan: UVAS Library [Call number: 1778,T] (1).
14.
Development Of The Test For The Diagnosis Of Classical Galactosemia In General Papulation
by Mehmmona Iqbal | Dr Muhammad Imran | Ms Faiza | Ms Sehrish Firyal | IBBT.
Material type: ; Format:
print
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1856,T] (1).
15.
Molecular Chracterization Of Pakistani Gaucher Disease Type 2 Patients From Lahore
by Maliha Afreen | Dr Muhammad Imran | Ms Asma Waris | Ms Sayeda Kalsoom | IBBT.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1857,T] (1).
16.
Molecular Diversity Of Fumaryl Acetoacetate Hydrolase Gene In Mammalian Species
by Sadaqat ijaz | Dr. Muhammad yasir zahoor | DR. Muhammad Imran.
Material type: ; Format:
print
Publisher: 2014Dissertation note: The present study has been planned to study the pathogenicity of FAdv-4 by inoculation of different age groups of broiler birds through different parenteral routes and oronasal routes. The liver homogenate suspension prepared from infected liver samples and cell culture propagated infectious agents were used to infect the susceptible broiler birds via parenteral routes and through oronasal routes. For this purpose two experiments were designed as Experiment I and II. In Experiment I the 25-day-old broiler birds were inoculated with different dilutions of liver homogenate and cell culture propagated HPS virus through intramuscular (i/m) and oral routes. Similarly in Experiment II the one-day-old, 1-week-old, 2-week-old, 3-week-old and 4-week-old broiler chickens were inoculated with the original dilution (100) of same liver homogenate and cell culture propagated HPS virus through S/C and oral route. The birds were kept under observation for recording morbidity and mortality. In Experiment I the liver homogenate caused 64% mortality in broiler birds of the Group A through intramuscular route, while 33.33% mortality in broiler birds of Group B through oral route. The cell culture propagated HPS virus caused 60% and 13.33% mortality in broiler birds of Group C and D through intramuscular and oral routes, respectively. In Experiment II none of the day-old-chick died from Group A inoculated with liver homogenate and cell culture propagated HPS virus through s/c and oral route. The liver homogenate and cell culture propagated HPS virus caused high mortality in different age groups of broiler birds through s/c route than oral route. The blood samples were collected from the broiler birds before and after infection and various hematological parameters such as Hemoglobin and packed cell volumes were studied. The values of hemoglobin and packed cell volume showed highly significant (P<0.05) reduction indicating anaemia. The values of hemoglobin and packed cell volume of the broiler birds inoculated with infectious liver homogenate showed highly significant reduction than the birds inoculated with cell culture propagated HPS virus. The results indicated that the liver homogenate is more pathogenic than cell culture propagated HPS virus. There changes may be due to adoptability of the original FAdVs after continued passages in the culture of chicken embryo liver cells.
Availability: Items available for loan: UVAS Library [Call number: 0946,T] (1).
17.
Genetic Characterization Of Pakistani Flayer Pigeons Using Mitochondrtial Nd2. And 16S Rrna Genes As Genetic
by Ahmad Ali | Dr. Sehish firyal | DR. Muhammad imran.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1970,T] (1).
18.
Molecular Analysis Of Mitochondrial Hypervariable Region In Three Consecutive Generations Of Buffalo
by Zara zaheer | Dr. Muhammad Yasir zahoor | Dr. MUhammad Imran | MR. Tariq.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2003,T] (1).
19.
In-Silico Functional Prediction Analysis Of Prion Protein Polymorphisms In Sheep Scrapie
by Mubashar ahmad | Dr. Muhammad imran | Dr. Muhammad | Dr. Wasim shehzad.
Material type: ; Format:
print
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2012,T] (1).
20.
In Silico Functional Prediction Of Prion Protein Polymorphisms In Chronic Qasting Disease
by Iqra khizar | DR. Muhammad imran | Dr. Muhammad | Dr. Muhammad yasir zahoor.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2024,T] (1).
21.
A Studyof Pesticidues In Different Fruits Collected From Differentfruit Markets Of Lahore Punjab
by Muhammad shafi | Dr. Muhammad imran | Ms. Huma mujahid | Ms. Saeeda.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2037,T] (1).
22.
Phylogenetic Analysis Of Haemoproteus In Chicken And Sparrows
by Anha fatima | Dr. Muhammad imran rashid | Dr. Azhar maqbool | Dr. Wasim.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2038,T] (1).
23.
Analysis Of Cyclin-Dependent Kinase Inhibitor P16 Polymorphism In Canin Tumors
by Hafiz muhammad farooq yaqub | Dr. Muhammad wasim | Dr. muhammad imran | Ms. Faiza.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2047,T] (1).
24.
Development Of Molecular Tools For The Diagnosis Of Plasmodium Vivax Using Cytochrome C Oxidase Gene
by Ayaz Shaukat | Prof. Dr. Azhar Maqbool | Dr. Muhammad | Dr. Muhammad Imran Rashid.
Material type: ; Format:
print
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2153,T] (1).
25.
Effect Of Phytase Supplementation On Growth Performance And Biochemical Parameters In Broiler Chickens
by Hafiz Kalimullah Khan | Dr. Muhammad Quaid Zaman | Dr. Hafsa Zaneb | Dr. Muhammad Imran Khan.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2165,T] (1).
26.
Incidence Of Canine Trypanosomiasis And Standardization Of PCR For Its Diagnosis
by Sajid Bashir Khan Qaisrani (2006-VA-60) | Dr. Muhammad Haroon Akbar | Dr. Muhammad Imran Rashid | Dr.Wasim Shahzad | Faculty of Veterinary Sciences.
Material type: ; Literary form:
not fiction
Publisher: 2014Dissertation note: Thesis Submitted With Blank CD. Availability: Items available for loan: UVAS Library [Call number: 2198,T] (1).
27.
DNA Based Characterization Of Arginase Gene From Geobacillus Sp. SBS-4s
by Raabia Bibi (2012-VA-537) | Dr. Muhammad Tayyab | Dr. Abu Saeed Hashmi | Dr. Muhammad Imran.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Geobacillus is a group gram-positive, rod-shaped, aerobic, endospore-forming and obligate thermophilic bacteria, isolated from the diverse habitats, hot springs, thermal environments, terrestrial soils, deep sea sediments (Zeigler, 2014), petroleum and soil of desserts (Claus and Berkeley 1986). It grows at a wide range of temperature from 45 to 75°C and pH ranging from 6.2 to 7.8 (Nazina et al. 2001). These bacteria survives at higher temperature where most of other living species fail to survive (Claus and Berkeley 1986). Geobacillus have achieved a significant population with a worldwide distribution, probably in large part due to adaptive features of their spores (Zeigler, 2014). These can be found singly or in short chains and motile by means of peritrichous flagella and is capable of secreting a wide variety of extracellular and intracellular enzymes i.e amylase, lipase, carboxypeptidase, cellulase, xylanase, protease and galactosidase (Fogarth et al. 1974; Obeidat et al. 2012).
Geobacillus sp. SBS-4S was isolated from hot spring located in Gilgit, Northern areas of Pakistan. It was found to be an aerobic, gram-positive and rod-shaped bacteria having ability to hydrolyze a variety of sugars, carboxylic acids and hydrocarbons at elevated temperatures from 45 to 75°C. SBS-4S was found to be involved in the production of various intra and extra cellular enzymes (Tayyab et al. 2011).
Arginase is the enzyme responsible for the degradation of arginine resulting in the production of urea and ornithine (Kaur et al. 2009). It is accomplished by the cleaving of the guanidinium group from arginine which yields urea (Turras et al. 2008). Arginase present in many mammals (Homo sapiens), Bacilli (cyanobacteria), protozoa (Entamoeba histolytica), yeast (Saccharomyces cerevisiae), fungi (Neurospora crassa) and plants (Lathyrus sativus) etc (Kaur et al. 2009). The crystal structure of arginases have been determined by X ray crystallographic studies. This is a manganese dependent enzyme. The enzyme shows its activity through the metal ion. Metal ion is actively responsible for the incorporation of water molecules essential for the activity of the enzyme. A second proposed mechanism, based on electron paramagnetic resonance (EPR) studies postulates direct coordination of the substrate to manganese and disruption of the aqua bridge. Arginases are homo-oligomers, with a typical subunit mass of 32 to 36 kDa (Bewley et al. 1999).
There are two types of arginases, arginase-I and arginase-II, located in the cytoplasm and mitochondria, respectively. The principal ureagenic enzyme activity arginase-I is most abundant in normal mammalian liver and acts in coordination with the other enzymes of the urea cycle to sequester and eliminate excess nitrogen from the body. The second form arginase-II can be found in many organs, with the highest levels found in kidney and prostate where as lower levels in macrophages and lactating mammary glands (Iyer et al. 2002).
Important role of arginase in controlling the cellular levels of arginine and ornithine, which are required for various critical metabolic processes, including protein synthesis and the production of creatine, polyamines, proline and nitric oxide (NO). Type II arginase is found in a variety of different tissues and have a key role in the regulation of urea cycle arginine metabolism by regulating levels of arginine in the cell (Bewley et al. 1999). The enzyme arginase plays key role in the pathogenesis of pulmonary disorders such as asthma through dysregulation of L-arginine metabolism and modulation of nitric oxide (NO) homeostasis and it also play role in the development of chronic airway remodeling through formation of ornithine with downstream production of polyamines and L-proline, which are involved in processes of cellular proliferation and collagen deposition (Benson et al. 2011). Arginase involved in tissue repair processes by the synthesis of L-ornithine, which is the precursor of polyamines and proline that are involved in cell proliferation and collagen synthesis (Maarsingh et al. 2009).
Genetically engineered arginase as fusion protein with prolonged half-life and increased efficacy are used to treat different tumor lines that inhibit cell proliferation and impaired cellular migration in vitro and in vivo (Li et al. 2013). This is a arginine-degrading and ornithine producing enzyme and is used to treat arginine-dependent cancers (Yu et al. 2013). Chemically modified arginase-II has been employed for the treatment of taper liver tumor and L5178Y murine leukemia (Kaur et al. 2009). The enzyme was cloned and expressed in E. coli and subsequently conjugated to polyethylene glycol to increase the circulating half-life and decrease the immunogenicity of the recombinant mycoplasma enzyme. The human hepatocellular carcinoma, melanoma cell lines and tissue samples do not express argininosuccinate synthetase (ASS), making them auxotrophic for arginine and thus reasonable candidates for arginine deprivation (Yang et al. 2010).
Arginase is induced in murine myeloid cells mainly by T-helper 2 cells cytokines and inflammatory agents and participates in a variety of inflammatory diseases by down-regulation of nitric oxide synthesis, induction of fibrosis and tissue regeneration. In humans, arginase I is constitutively expressed in polymorphonuclear neutrophils and is liberated during inflammation. Myeloid cell arginase-mediated L-arginine depletion profoundly suppresses T cell immune responses and this is a fundamental mechanism of inflammation-associated immunosuppression. Pharmacological interference with L-arginine metabolism is a novel promising strategy in the treatment of cancer, autoimmunity or unwanted immune deviation (Munder, 2009).
Arginase has very important role in nitrogen fixation and fruit ripening (Yu et al. 2013). Putrescine (1,4-butanediamine) is the product obtained from arginine with the highest market value and it is used as an intermediate in a large number of industries, including the pharmaceutical industry, agrochemical industry and textile industry (Turras et al. 2008).
Arginine is a semi-essential amino acid and is the precursor for the formation of nitric oxide (NO) by nitric oxide synthases (Getz and Reardon, 2006). One of the major functions of arginine within the body is as an intermediate in the urea cycle. In the cytosol of hepatocytes, arginase-I removes the guanidine group from arginine to produce urea and ornithine. Urea is then transported from the hepatocyte into the bloodstream and ornithine is used to regenerate arginine within the hepatocyte. Arginine deficiency causes several disorder like, hyper cholesterolemia, hypertension, diabetes mellitus, kidney failure, hyper homo-cysteinemia, smoking, and aging (Alvares et al. 2012). Arginine is used to modulate the cellular immune response during infection. The generation of nitric oxide from arginine is responsible for efficient immune response (Das et al. 2010).
Arginine is synthesised in humans and other mammals from citrulline in two steps through the urea cycle enzymes, argininosuccinate synthetase (ASS) and argininosuccinate lyase (ASL). ASS catalyses the conversion of citrulline and aspartic acid to argininosuccinate, which is then converted to arginine and fumaric acid by ASL (Yang et al. 2010).
Ararinase play important role in conversion of arginine to 1,4–butanediamine (a building block for nylon-4,6), through two main transformations: the hydrolysis of arginine to ornithine and urea; and the decarboxylation of ornithine to 1,4–butanediamine and carbon dioxide. Both steps can be catalyzed chemically or enzymatically (Turras et al. 2008).
The present study deals with the characterization of arginase gene.
Availability: Items available for loan: UVAS Library [Call number: 2244-T] (1).
28.
Isolation Of Surface Antigen 1 Gene Of Toxoplasma Gondii And Its Cloning In The Expression Plasmid
by Farooq Riaz (2008-VA-231) | Dr. Muhammad Imran Rashid | Prof. Dr. Kamran Ashraf | Dr. Jawad Nazir.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Toxoplasma gondii is an obligate intracellular protozoan parasite which comes under the classification of phylum Apicomplexa, subclass Coccidiasina (Cornelissen et al. 1984). Toxoplasmosis is one of the more common parasitic zoonoses world-wide caused by Toxoplasma gondii which is a facultatively heteroxenous, polyxenous protozoon that has developed several potential routes of transmission within and between different host species (Tenter et al. 2000). It is the most important source of toxoplasmosis in humans and animals, with cat as definite host and warm-blooded animals as intermediate host (Frenkel et al. 1970). It was first described by Nicolle, Manceaux and Splendore in 1908 from rodents Ctenodactylus gondii (Black and Boothroyd 2000).
Toxoplasmosis is a worldwide parasitic disease and it is estimated that about one-third total population of the world is seropositive for Toxoplasma gondii (Tenter et al. 2000). Prevalence of infection varies between countries, geographical areas and ethnic groups living within a specific region. In Humans, infection rates range from 50% to 83% in Brazil (Tenter et al. 2000; Dubey et al. 2012). Seropositivity of Toxoplasma gondii in China is about 8% with continuously increase while in USA its 10-15%, 50-70% in France and 20% in UK (Dubey and Jones 2008; Zhou et al. 2008; Jones et al. 2009). Prevalence of toxoplasmosis is higher in males (79%) as compared to females (63.4%) and the age dependent sero-prevalence reaches >92% in age group of 40 to 50 (Coêlho et al. 2003).
Transmission occurs through the ingestion of contaminated vegetable /water with oocysts, as well as the ingestion of contaminated raw/undercooked meat with tissue cysts (Gajadhar et al. 2006). Transmission may also occurs by ingestion of sporulated oocysts, or bradyzoites within cysts present in the tissues of numerous food animals (Esteban-Redondo et al. 1999). In humans, transmission of Toxoplasma gondii happens mainly by eating raw or undercooked contaminated meat, raw cow’s milk and birds eggs, swallowing oocysts dis-charged in feces of infected cats, inoculation of trophozoites through the skin, or by inhalation (Wallace 1971; Wallace 1973; Bannister 1982).
In humans, mostly infections (congenitally or post-natally acquired) are asymptomatic. Congenital infection occurs only when a woman becomes infected during pregnancy. Congenital infections acquired during the first trimester are more severe than those acquired in the second and third trimester (Desmonts and Couvreur 1974). The main clinical signs associated with toxoplasmosis are anorexia, weight loss, lethargy, dyspnea, ocular signs, pyrexia, vomiting and diarrhea, jaundice, myositis, encephalitis and abortion. Humans become infected when they ingest the toxoplasma at infective stages (oocysts and tissue cysts) found in some cat feces and in raw meats.
In addition to being hazardous to livestock animals, the T. gondii infection is also important due to its zoonotic implications (Jittapalapong et al. 2005). Congenital abnormalities in humans, such as microcephaly, hydrocephaly, chorioretinitis, convulsion, cerebral calcification, epilepsy, blindness, deafness, and mental retardation may occur if the mother acquires infection during pregnancy (Jones et al. 2003). In addition to congenital anomalies, T. gondii also causes severe neuropathologic infections in immuno-compromised hosts, such as AIDS and cancer patients receiving chemotherapy (Del Valle and Piña-Oviedo 2005).
Seroprevalence studies of T. gondii among domestic animals in South-Western Pakistan has indicated considerable prevalence (25% in cattle, 2.5% sheep) (Zaki 1995) and suggesting potential transmission to the human community. Small scale study in urban area of Rahim Yar Khan (Punjab), Pakistan has revealed that the overall prevalence of toxoplasmosis in food animals is 19% (Ramzan et al. 2009). Another study has already been published that untreated patients with leprosy in Pakistan have shown significant seroprevalence (29.6%) of antibodies against T. gondii (Hussain et al. 1992).
Vaccine against toxoplasmosis is not available yet with one exception (“Toxovax” for sheep). Vaccine against T. gondii in animals used for human consumption may block the possible transmission to humans (Bhopale 2003). SAG1, among one of the major antigenic components of Toxoplasma gondii is a major surface antigen identified on the surface membrane of this parasite using a monoclonal antibody (Handman et al. 1980). SAG1 is an important surface antigen, expressed by tachyzoite form of T. gondii and is a putative candidate for vaccine and diagnostic against toxoplasmosis (Sharma et al. 1983; Godard et al. 1990). Immunization with SAG1 adjuvanted with saponin Quil A or incorporated in lysosomes provided total protection after challenge (Bülow and Boothroyd 1991; Khan et al. 1991). SAG1 is single copy gene with no introns (Burg et al. 1988), regulates both humoral as well as cellular Th1 immune responses (Liu et al. 2008) and is powerful candidate for vaccine against toxoplasmosis. SAG1 is a potent candidate of diagnostics for detection of serum antibodies against toxoplasmosis in Man and animals (Abu-Zeid 2002).
Availability: Items available for loan: UVAS Library [Call number: 2258-T] (1).
29.
Combine Effect Of Ionomycin And Strontium Chloride To Induce The Parthenogenetic Activation Of Mouse Oocytes
by Muhammad Ashraf (2013-VA-13) | Dr. Amjad Riaz | Dr. Mushtaq Ahmad | Dr. Muhammad Imran Rashid.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Parthenogenesis is a phenomenon in which the development of oocyte oocur without fusion of male gamete. During fertilization spermatozoa trigger intracellular Ca+2 oscllation in M-II stage oocyte which initiates the embryonic development. The rises of intracellular calcium (Ca2+) ions is the basic step for the parthenogenesis. During parthenogenetic activation calcium channel open from endoplasmic reticulnum or depletion of calcium store and facilitate the calcium (Ca2+) from extracellular environment. Parthenogenetic technique is applied in cloning and production of embryonic stem cell lines for used to treat different diseases. Many scientists used different chemicals agents for artificial activation such as strontium, Ionomycin and Ethanol. Strontium chloride has been used widely for parthenogenetic activation of mouse oocyte, but its result to blastocyst development is poor. The objective of present study is to improve parthenogenetic activation and embryo development by combination of Ionomycin with strontium. Hypothesis of my study was Addition of Ionomycin in Strontium based activation protocol improves embryonic development.
The present study was conducted in embryology lab of department theriogenology, university of veterinary and animal sciences, Lahore.Six to eigth week old female mice (n=100) were super ovulated with intra-peritoneal injections of eCG (5iu) followed by hCG injection (5iu) at 48 hrs interval. 14 hrs post hCG, the cumulus oocyte complexes were collected from oviduct of the mice. In experiment 1, the oocytes were activated by using Ionomycin with concentration of 5, 10 and 15 µmol/l for 5 and 10 followed by this activation with strontium chloride (10mmol/l). In experiment: 2, The oocytes were activated by activation medium having strontium (10 mM/l) and Ionomycin (5, 10 or 15 µmol/l) in combination. CZB medium were used for oocyte cultured in CO2 incubator of 5% CO2 at 37°C. Number of activated oocytes were analyzed by cleavage rate to blastocyst stage. In-vitro developmental potential of the activated oocytes were assessed by blastocyst. In experiment: 3, Zygotes were collected 18 h post-hCG and treated with the optimum concentration to check the toxicity effects on embryo development.
In experiment 1, There were insignificant results observed on the bases of cleavage rate in each groups and time of activation as compared to control group. The tendency of morula and blastocysts formation rate was higher (p<0.05) in the 15µM for 10 min activation time as compared to other treatment groups and control group. In experiment 2, The tendency of cleavage rate was significantly higher in the 10 µM and 15µM groups as compared to other treatment group. The blastocyst formation rate was no statistically difference in all treatment and control group. While the toxicity experiment, there was no toxic effect of Ionomycin with Strontium Chloride.
In conclusion, there was higher cleavage rate, 4 cells, morula and blastocyst formation rate in 15µM concentration of Ionomycin for 10 min with Strontium Chloride, there was no toxic effect of Ionomycin with Strontium Chloride on embryos and Ionomycin improved the activation rate and embryo development in combination with strontium chloride.
Availability: Items available for loan: UVAS Library [Call number: 2319-T] (1).
30.
Analysis Of Genetic Polymorphism In Exon 6 & 11 Of Glucosidase Beta Acid (Gba) Gene In Gaucher Diseased Patients From Punjab, Pakistan
by Aysha Arshad (2009-VA-571) | Dr. Muhammad Yasir Zahoor | Dr. Muhammad Imran | Dr. Imran Altaf.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2015Dissertation note: Gaucher disease (GD) is amajor predominant heterogenic, inherited and metabolic lysosomal storage disorder. It is prompted by an alteration in glucosidase acid beta (GBA) gene. GBA gene encodes a 497 amino acid glucocerebrosidase enzyme. It is a lysosomal hydrolase, present in all mammalian cells membrane that carries the catalysis of complex ubiquitous sphingolipids called glucocerebrosides (GlcCer) into smaller and simpler molecules of sugar and ceramide. The human glucocereborside (GBA) gene is present in highly gene dense area on q arm of 21 chromosome and its fragment length is 7.8kb comprising of 11 exons. A pseudogene is also present in vicinity of GBA gene which shares 96% homology of sequence with functional gene. Genetic recombination and gene conversion among these two GBA genes are responsible for 10-20% GD mutations. >300 mutations of GBA have been described till 2014. GD has three different clinical forms depend on its heterogeneity. These are characterized by the age of onset and with or without the participation of CNS.
In this study, 10 blood samples were collected of GD patients from repository at Molecular and Genomic Laboratory located at IBBT department, UVAS Lahore and from Children Hospital Lahore. DNA extraction was done by using organic method from blood samples. Amplification of GBA gene exons 1, 6 and 11 was performed using PCR. PCR products were sequenced using Sanger di-deoxy sequencing method. Different bioinformatics tools were applied for the sequence analysis of exon 1, 6 and 11. We found two variants of GBA gene. A deletion of CT nucleotide repeat in intron 1 was found. We also found a substitutional change of nucleotide T>A in intron 8. Availability: Items available for loan: UVAS Library [Call number: 2334-T] (1).
31.
Variation Analysis Of Hepatitis C Virus Gene Encoding E2 Glycoprotein
by Saimoon Theeen (2009-VA-565) | Dr. Muhammad Imran | Dr. Sehrish Firyal | Dr. Muhammad Tayyab.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Hepatitis C virus (HCV) major cause of liver infections was discovered in 1989. It is positive stranded RNA virus and belongs to Flaviviridae family. Its genome shows high rate of variations due to which, its rate of infection is high. As in Pakistan 3% to 6% population and 170 million people worldwide are affected by it. Due to variations in its genome it is classified into 6 major genotypes and these genotypes are further classified into many subtypes. Size of HCV is about 9500 bps which only encodes single polyprotein. This 3000 to 3300 amino acids polyprotein is processed by cellular and viral proteases to generate 10 polypeptides consisting of 4 structural (Core, E1, E2 and P7) and 6 non-structural proteins (NS2, NS3, NS4A, NS4B, NS5A, NS5B). Whereas E2 is considered the most immunogenic gene from all the genes. It involves in the interaction with the host cell and easily escape from the immune system of host due to the presence of hypervariable regions in E2 gene.
To isolate the E2 gene RNA extraction was done using the kit method and then it was converted to the cDNA which is then followed by the PCR amplification. The amplification products were then purify and sent for the sequencing to CAMB. Then the bioinformatics tools were applied on the results. In which the protein structural analysis and epitope mapping was done. Then the conserved epitopes were predicted using the IEDB conservancy analysis tool. The conserved B-cell epitopes (TElAILPCSFTPMPAL and RGERCDIEDRSEQH) and T-cell epitope (TPMPALSTG) are now considered valuable to produce the antibodies against E2 protein.
For diagnosing HCV genotype 3a, these conserved epitopes may be highly useful and may also help in developing a successful vaccine that can target 3a genotypes. Availability: Items available for loan: UVAS Library [Call number: 2333-T] (1).
32.
Mutational Analysis Of Hepatitis C Virus Ns4b Gene Encoding Protein
by Faiza Nisar Bukhari (2013-VA-12) | Dr. Muhammad Imran | Dr. M.Yasir Zahoor | Dr. Abu Saeed Hashmi.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Hepatitis C virus (HCV) infection has an estimated global prevalence of 2%–3% with approximately 270 million infected people worldwide of which 10 million belongs to Pakistan. HCV is a positive-sense single-stranded RNA virus from the family of Flaviviridea. Its genome encodes 10 proteins including a 261 amino acids protein NS4B. NS4B is a non-structural protein that performs hyperphosphorylation of NS5A, transactivates interleukin 8 promotor, suppresses HCV translation and modulates the ER stress response. Mutation in NS4B encoding gene may be targeted to develop an effective vaccine against HCV before virus invasion in host immune system.
Serum was collected from 20 patients who are infected with HCV. RNA was isolated from these samples to reverse-transcribe it into cDNA. This cDNA were PCR-amplified and amplicons were detected by UV light after their separation through agrose gel electrophoresis followed by seguencing of NS4B encoding gene.
Variations in HCV NS4B gene was analyzed by using Mega 6 software and sequence 2 blast analysis NCBI tool. Protein modeling was performed with phyre 2, DIANNA tool and I-Tasser online server and quality of model and antigenicity was checked by Vaxajen V 2.0 and Epijen softwares. Conservative analysis and epitope mapping were performed by using Immune Epitope Database (IEDB).
A systematic approach was employed for the prediction of potential epitopes in NS4B protein. Vaxijen V 2.0 was used to determine overall antigenicity of NS4B using cut off value of 0.4. Values above this threshold level show probable antigens in the protein. The topology of NS4B was determined by TMHMM server with the help of membrane topology data. Regions outside membrane and transmembrane were eradicated for epitopes prediction. T cell epitopes propred was used with proteosome cleavage site filter of 4% threshold. From the following data analysis 12 to 15 possible T-cell epitopes can be predicted; only these T cell epitopes were included in conservation analysis.
The present study provides information about mutational changes in HCV protein NS4B and thus preliminary data for the development of vaccine against HCV. This can also lead to future prospects for diagnosis, treatment and prognosis of HCV.
Hepatitis C virus (HCV) infection has an estimated global prevalence of 2%–3% with approximately 270 million infected people worldwide of which 10 million belongs to Pakistan. HCV is a positive-sense single-stranded RNA virus from the family of Flaviviridea. Its genome encodes 10 proteins including a 261 amino acids protein NS4B. NS4B is a non-structural protein that performs hyperphosphorylation of NS5A, transactivates interleukin 8 promotor, suppresses HCV translation and modulates the ER stress response. Mutation in NS4B encoding gene may be targeted to develop an effective vaccine against HCV before virus invasion in host immune system.
Serum was collected from 20 patients who are infected with HCV. RNA was isolated from these samples to reverse-transcribe it into cDNA. This cDNA were PCR-amplified and amplicons were detected by UV light after their separation through agrose gel electrophoresis followed by seguencing of NS4B encoding gene.
Variations in HCV NS4B gene was analyzed by using Mega 6 software and sequence 2 blast analysis NCBI tool. Protein modeling was performed with phyre 2, DIANNA tool and I-Tasser online server and quality of model and antigenicity was checked by Vaxajen V 2.0 and Epijen softwares. Conservative analysis and epitope mapping were performed by using Immune Epitope Database (IEDB).
A systematic approach was employed for the prediction of potential epitopes in NS4B protein. Vaxijen V 2.0 was used to determine overall antigenicity of NS4B using cut off value of 0.4. Values above this threshold level show probable antigens in the protein. The topology of NS4B was determined by TMHMM server with the help of membrane topology data. Regions outside membrane and transmembrane were eradicated for epitopes prediction. T cell epitopes propred was used with proteosome cleavage site filter of 4% threshold. From the following data analysis 12 to 15 possible T-cell epitopes can be predicted; only these T cell epitopes were included in conservation analysis.
The present study provides information about mutational changes in HCV protein NS4B and thus preliminary data for the development of vaccine against HCV. This can also lead to future prospects for diagnosis, treatment and prognosis of HCV.
Availability: Items available for loan: UVAS Library [Call number: 2339-T] (1).
33.
Study Of Wound Healing Effects Relating To Topical Application Of Human Saliva On Rabbits
by Sanila Amin (2013-VA-281) | Prof. Dr. Tahir Yaqub | Dr. Muhammad Imran | Dr. Habib ur Rehman.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Histatin proteins present in human saliva have been observed to show natural antibacterial and antifungal properties, as well as play a role in wound healing. These naturally occurring proteins can serve as effective agents when combating microbial infections of vulnerable wounds that have become drug resistant, without inducing negative side effects in the host. Focusing on these proteins can create a new outlook with regards to wound-healing medicine for both humans and animals.
Subjects of this study were 30 fully grown adult male rabbits weighing 2.0 to 3.4 kg and ranging from 8 to 16 months in age. They were acclimatized for two weeks in stainless steel cages and fed commercial diets, vegetables, crushed wheat and corn all over the whole experiment. Out of all 30 rabbits 24 rabbits were experimental on which saliva was applied, three were negative control to check natural wound healing, and three were positive control on which wound healing medicine was applied.
The 24 experimental rabbits were further divided into four groups with each group consisting of 6 rabbits to check the effect of age on wound healing. The age groups of human samples were divided as 15-25, 25-35, 35-45 and 45-55 (Verma et al. 2013). Saliva of human individuals belonging from these four age groups was applied on the wounds of experimental group. Furthermore, all age groups contained saliva from both gender i.e. each age group consisted of 3 male and 3 female saliva samples.
Furthermore, DNA was extracted from blood samples of the same individuals from whom saliva samples were procured. HTN1 gene which is responsible for the production of salivary histatin protein was amplified using specific primers and PCR optimization.
CHAPTER 6
SUMMARY
33
The results of this study demonstrated the wound healing properties of histatin proteins present in saliva and thus, providing a basis of using the natural ability of human saliva to act as a major component in the future of medicine for wound healing and preventing wound infections in both human and animals. Availability: Items available for loan: UVAS Library [Call number: 2344-T] (1).
34.
Mutational Analysis Of Hcv Gene Encoding E1 Glycoprotein
by Muhammad Saad Junjua (2013-VA-893) | Dr. Muhammad Imran | Dr. Wasim Shehzad | Dr. Abu Saeed Hashmi.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Hepatitis C virus (HCV) is a positive single stranded RNA virus that belongs to Flaviviridae family and causes liver related issues like hepatocellular carcinoma, cirrhosis and chronic liver disease. HCV is affecting people worldwide; more than 170 million peoples have been affected so far and the number is increasing day by day. Its prevalence in Pakistan is about 3% to 6%. There is lot of variation in its genome and it is classified into 6 major genotypes and these genotypes are further classified into many subtypes. Size of HCV is about 9500 bps which only encodes single polyprotein. This 3000 to 3300 amino acids polyprotein is processed by cellular and viral proteases to generate 10 polypeptides consisting of 4 structural (Core, E1, E2 and P7) and 6 non-structural proteins (NS2, NS3, NS4A, NS4B, NS5A, NS5B). The most immunogenic gene from all the genes is E1. It involves in the interaction with the host cell and easily escapes from the immune system of host due to the presence of hypervariable regions in E1 gene.
To isolate the E1 gene, RNA extraction was done using the kit method. RNA was converted to cDNA which was then amplified in two rounds of PCR using nested primers from HCV core region. After confirming the presence of HCV RNA in serum samples, PCR amplification of HCV E1 gene was carried out using gene specific nested primers. Amplified E1 gene products were Sanger sequenced and aligned with standard sequence to find out genetic variations. E1 gene sequences were converted to protein sequences for which secondary protein structures were made and analyzed. No noticeable change was seen in these secondary protein structures. The protein sequences were also analyzed for the presence of B-cell and T-cell epitopes; two T-cell epitopes (QAFTFRPRR, FLVGQAFTF) were found which may inform the development of a proper vaccine against HCV. Availability: Items available for loan: UVAS Library [Call number: 2399-T] (1).
35.
Molecular Diagnosis Of Anaplasmosis In Buffaloes
by Muhammad Salman (2008-VA-135) | Prof. Dr. Khalid Saeed | Dr. Muhammad Imran Rashid | Dr. Wasim Shehzad.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Bovine Anaplasmosis is a tick-borne haemo-rickettsail disease, caused by Anaplasma species transmitted mechanically by flies, biologically by ticks and blood contaminant fomites. It is an economically important tick-borne disease of buffalo in tropical and sub-tropical areas of the world. In current study, we developed and optimized PCR first for detecting Anaplasma at genus level in buffaloes. One hundred (100) blood samples were collected from buffaloes around the Lahore region. The stained thin blood films were examined microscopically and 37% blood samples were found positive for intra-erythrocytic bodies which were then selected for DNA extraction. The DNA was extracted using commercially available kit for eventual use in optimization of PCR for diagnosis of bovine Anaplasmosis. The primers were designed targeting 16S rRNA gene of Anaplasma. For the detection, the PCR product was run in 2% agarose gel stained with ethidium bromide and thirty seven samples showed the amplification band at 179bp. The selected samples were sent for ABI sequencing to Singapore for the accurate detection of the Anaplasma species. The sequencing results were blasted with database of Genbank and we observed homology with Anaplasma phagocytophilum. We found 37% prevalence of Anaplasmosis in buffaloes through PCR. However more studies are required to confirm the species of Anaplasma infecting buffaloes (Bobalus bobalis) by designing species specific primers. Furthermore, additional studies are needed to establish the epidemiology of Anaplasmosis by using molecular tools in different geographical areas of the country for their better control.
Availability: Items available for loan: UVAS Library [Call number: 2389-T] (1).
36.
Indigenous Elisa Kit For Toxoplasma Gondii: Optimization Of Antibody Detection Elisa Of Sag 1 Protein As An Antigen In Mouse Model
by Madiha Sana (2013-VA-957) | Dr. Muhammad Imran Rashid | Dr. Haroon Akbar | Dr. Wasim Shehzad.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Toxoplasma is an apicomplexan intracellular parasite which is the cause of toxoplasmosis
in man and animals. It occurs by the ingestion of oocyst from feces of cats or by eating raw meat
in which cysts are present. It is the one of the major cause of encephalitis and abortion in
immuno-compromised animals and humans. As it is difficult to screen out infected live animals
from field, it is important to vaccine animals as well as humans for toxoplasma to prevent its
transmission from animals to humans and from humans to their off springs. Cloning of surface
antigen genes plays an important role in development of vaccine and for serology of T. gondii.
Enzyme linked immuno-sorbant assay proves to be a significant tool to estimate the humoral
response elicited against expressed recombinant protein in mice.
The recombinant protein of SAG1 was collected from Molecular Parasitology
Laboratory, University of Veterinary and Animal Sciences, Lahore. In the previous studies,
SAG1 sequence was cloned in the expression plasmid and successfully expressed in prokaryotic
expression system. In the current study, rSAG1 was quantified by using BCA protein assay
through BioWORLD protein quantification kit. In another experiment, the Swiss mice were
immunized with 15 μg rSAG1 protein 3 times with 2 weeks intervals. Two groups of mice were
formed with five mice in each group. Sera were collected after 2 weeks of each inoculation. For
performing ELISA, four different experiments were performed with different concentrations i.e.
5μg/ml, 250μg/ml and 500μg/ml with two different dilutions; 1/50 and 1/20. The O.D. values of
concentrations 5μg/ml and 250 μg/ml with two dilution series of 1/20 and1/50 were not observed
significant while the antigen coating concentration of 500 μg/ml with 1/50 dilution showed 1:160
titre and with 1/20 dilution showed 1: 1280 titre after the 3rd shot. The O.D values with 500
CHAPTER 6
SUMMARY
SUMMARY
36
μg/ml concentration with 1/20 dilution after the 3rd shot were observed significant in the
inoculated group as compared to the O.D values of un-inoculated negative group. It is suggested
to carry out ELISA with purified rSAG-1 protein and to optimize ELISA to test toxoplasma
infected mice. Availability: Items available for loan: UVAS Library [Call number: 2433-T] (1).
37.
Genetic Polymorphism Of Prss12 Gene Responsible For Cognitive Dysfunction And Its Homology Analysis With Canine
by Hafsa Amjad (2014-VA-776) | Dr. Muhammad Yasir Zahoor | Dr. Muhammad Imran | Mr. Shahid Abass.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Neurotrypsin a multi domain serine protease predominantly expressed in brain is considered to be involved in cognition by the establishment and maintenance of synapses in mammals. Mutations in PRSS12 gene have been reported for cognitive disability in Algerian family.
In present study, DNA of 10 enrolled non-relative cognitive dysfunctioned patients was extracted through organic method. The normal individual samples of siblings and parents of relevant families was also included in this study as control. This amplification exon 7 of PRSS12 was done after designing primer by using Primer3 software. Exons was sequenced by using BigDye Terminator Cycle Sequencing Ready Kit(Perkin Elmer/ABI) and read in automated sequener, ABI Prism model 3730 (Perkin Elmer). No significant mutation was identified in affected individuals.
Computational comparative sequence analysis tools were used for the nucleotide and amino acid sequences to predict the homology in PRSS12 gene among mammals of well-developed cognition. PROSITE domain database search was performed to determine domain organization and Phyre software was used to develop secondary structural features and 3D protein models and ReptroX for multiple sequence alignment of tertiary structures. Using the generated alignments highly conserved regions in primary and secondary structures of neurotrypsin in mammals were identified. Phylogenetic analysis indicated highest similarity of human PRSS12 with non-human primates (chimpanzee, orangutan and monkey) followed by Catecians, Felis, and Canine evolving from the same ancestor. The predicted domain architecture shows the neurotrypsin consisting of kringle domain, four scavenger receptor cysteine-rich
CHAPTER 6
SUMMARY
Summary
68
domains and a serine protease domain named trypsin. Whereas mouse consists of only three scavenger receptor cysteine-rich domain. Prediction and comparison of domains in mammals indicated that primates and catecians protein domains have high similarity with humans. Computational analysis by using animal models can aid in evolutionary studies and. understanding the role of neurotrypsin in cognition. Availability: Items available for loan: UVAS Library [Call number: 2498-T] (1).
38.
Occurrence And Economic Losses From Theileriosis On Commercial Dairy Farm Of Holstein Friesian
by Muhammad Rashid (2014-VA-503) | Dr. Muhammad Imran Rashid | Prof. Dr. Khalid Saeed | Dr. Liaquat Ahmad.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Background: Theileriosis is a tick-borne disease and it is transmitted by the bite of ticks.
Previous work on disease problems in the study area suggested that Ticks and Tick-Borne
Diseases (TTBDs) are the major constraints to cattle production. They cause economic losses to
farmers in terms of cattle mortality, loss of body weight, loss of milk production and costs of
control of TTBDs by use of acaricides. Theileria is one of the major threat to cattle as it causes
anemia, weight loss, decrease production, mortality, treatment cost and cost for the control of
theileria. The proper data for losses atributed to theileriosis is still not available in Pakistan. For
this purpose a study was carried out in a commercial exotic dairy farm to evaluate losses
associated with theileriosis
Methodology: The study was done during the period of theileriosis to calculate its economic
effect on animal health and production. A total of 150 animals were selected randomly using
random number sample formula. The animal tag numbers were compared with random number
table, comparing animals were slecteded for study. Thin blood smear was performed for
diagnosis haemoparasite, further PCR was performed on those animals that were found +ve for
intraerythrocytic bodies. Faecal examination, California mastitis test, teat abnormality and
parturition history were recorded for the screening of these factors that decrease milk production.
After final grouping, milk production was recorded to identify the effect of theileriosis on
production. As theileriosis cause anemia due to destruction of RBC’s. body condition scoring
was also performed. Physical examination (lymph node and body temperature) of animals were
also performed to evaluate the clinical and subclinical theileriosis.
Results: For the evaluation of theileriosis, microscopy was performed on all the animals’ blood
samples. Haemoparasites were found in 28.67%. These were further processed by PCR for the
CHAPTER 6
SUMMARY
Summary
55
detection of theileriosis. Theileria was found in 27.90%. Screening of clinical and subclinical
mastitis by Califirnia Mastitis Test and microscopy for gastrointestinal parasite were performed.
On faecal examination, there found nematode, cestode and balantidium in 51.72%, 60.92% and
42.53%% respectively. After deworming with Valbazine and curafluke, nematode, cestode
(monzia), balantidium and coccidiosis were found in 0%, 39.13, 43.48% and 4.35% respectively.
Before grouping clinical and subclinical mastitis were found in 5.38% and 24.62% respectively.
After grouping clinical and subclinical mastitis were evaluated by California mastitis test with
two weeks interval. At 7th week clinical and subclinical mastitis were 3.85% and 7.69% due to
improved management. The decrease in milk production for clinical and subclinical theileriosis
was 87 lit./animal and 42.77 lit./animal. Costs for control, treatment and mortality were 0.12%,
0.20% and 13.09% respectively from overall farm expenditure. The prevalence of haemoparasite
was 28.67%, while the prevalence of theileriosis was 8%. The new cases of theileriosis were
recorded and incidence of theileriosis was found to be 2.25%. Overall losses due to theileriosis
was 13.70%.
Outcomes: We can conclude from our finding that theileriosis has drastic affect on the
profitability of the farms. Then losses can be attributed to decreased milk production and
mortality. Medications and control measure for theileriosis have added effect on the losses at
exotic animal breed dairy farms.
Perspectives: Cost analysis studies need to be done on different dairy farms of cattle of different
breeds at different ecological/climatic zones of Pakistan so that investors would know the risks
of establishing dairy farms. Availability: Items available for loan: UVAS Library [Call number: 2515-T] (1).
39.
Exploring Anthelmintic Resistance In Ovine Haemonchosis Through Faecal Egg Dna At Livestock Research And Development Station, Paharpur, D .I. Khan
by Ghulam Hassan (2007-VA-144) | Dr. Haroon Akbar | Dr. Muhammad Imran Rashid | Dr. Muhammad Ijaz.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Gastrointestinal nematodes are recognized as a major constraint of small ruminant production system at small and large-scale farming in developing countries, leading to significant economic losses. The most important of these is Haemonchus contortus. Anthelmintic resistance now poses problems to sheep farmers throughout the world. This study has been designed to check anthelmintic resistance against haemonchosis of sheep by an in vivo method. The current study was carried out at Parasitology laboratory (Toxovacc lab), Department of Parasitology, University of Veterinary and Animal Sciences, Lahore. 100 faecal samples were collected from sheep at Livestock Research and Development Station, Paharpur, D.I. Khan. Animals were drenched with anthelmintic (Albashell containing Albendazole 2.5%, administered @10 mg/kg of body weight) orally after 1st sampling, at 0 day. The faecal samples were examined microscopically, micrometery was exploited and EPG analysis was performed by using McMaster technique. After 14 days, the second sampling was done. The fecal samples were brought and stored at 4°C in Parasitology laboratory (Toxovacc lab). Pre-trial & Post trial EPG were compared and positive samples were taken (tag#1057 Damani sheep male, tag#13 Balkhi sheep male, tag#1096 Damani female, tag#06 Balkhi female, tag#20 Balkhi) for egg isolation (Module, 2004) for egg DNA extraction through classical method of Phenol-Chloroform-Iso-Amyl Alcohol extraction. DNA samples were subjected to polymerase chain reactions (PCR) targeting β tubulin gene for detection of benzimidazole resistance at genetic level. Fecal egg count reduction percentage of 74.57% at day 14 post treatment clearly shows the presence of benzimidazole drug resistance in parasites infecting Balkhi and Damani sheep at Livestock Research and Development Station, Paharpur, D.I. Khan.
Summary
64
In conclusion, PCR-Sequencing technique finds its value in the detection of benzimedazole resistance at molecular level in eggs of Haemonchus contortus of sheep and this technique also helps the understanding of the development of drug resistance in the parasite. Availability: Items available for loan: UVAS Library [Call number: 2513-T] (1).
40.
Effect Of Stabilizers On Biological Titre Of Freeze Dried Ppr Virus Vaccine
by Muhammad Zubair Latif (2009-VA-382) | Prof. Dr. Khushi Muhammad | Dr. Muhammad Anees | Dr. Imran Altaf | Dr. Muhammad Imran.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: PPR is an acute and highly contagious viral disease of small ruminants caused by Morbillivirus. It causes high morbidity and mortality in small ruminants and heavy economic loses to farmers. Live attenuated vaccines are commonly used to control the disease. During freeze drying and after dilution of freeze dried vaccine, there is lose of virus titre so vaccine efficacy is reduced. Stabilizers are therefore added to protect from freeze drying stress and heat shock during storage and transportation. Each stabilizer has different protective effect. The present project was therefore designed to evaluate different stabilizers to act as the best one for maximum stability of the virus titre.
Fifty vials of PPR vaccine with each of six stabilizers (Weybridge medium-WBM, Lactalbumin hydrolysate sucrose-LS, lactalbumin hydrolysate sorbitol-LSbG, Tris sucrose-TS, Tris Trehalose-TT and Goat skimmed milk-GSM) was formulated, freeze dried and three vials from each formulation was selected and evaluated by biological titration just after freeze drying and dilution in PBS (7 pH). Each of the vaccine diluted with the PBS and stored at 40C, 250C, 370C for 36 hours. Biological titration of each of the vaccines stored at different temperature and time was determined on Vero cell lines. The virus infectivity was calculated as mean TCID50 by MTT assay.
It is concluded from the study that stabilizers having carbohydrates (sucrose, sorbitol, trehalose), salts (sodium) and hydrolyzed proteins (lactalbumin hydrolysates) are effective to make compact mass (freeze drying) of PPR virus vaccine. WBM, LS, and LSbG maintain infectivity of the PPR virus vaccine (if reconstitution with PBS and stored at 4°C) for 12 hours. However, TT is able to protect infectivity titre of the PPR virus vaccine during freeze drying and even during its storage after hydration with PBS at 4°C for 24 hours. Availability: Items available for loan: UVAS Library [Call number: 2546-T] (1).
41.
Sequence Analysis Of Violent Behavior Gene Among Criminals
by Jawairia Akram (2010-VA-492) | Dr. Asif Nadeem | Dr. Muhammad Imran | Dr. Saadat Ali.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Violence is defined as uncontrolled emotions problem and is a reason of violent behavior among criminals. Violence is mostly physical towards other people. MAOA and MAOB are isozymes of monoamine oxidase. MAOA is associated with aggression and violence in criminals as it affects brain structure and function which ultimately causes violence and aggression MAOA gene present on mitochondrial outer membrane encodes monoamine oxidase that degrade neurotransmitters like dopamine, serotonin, epinephrine and nor epinephrine. An SNP (MAOA-LPR) in long promoter region of MAOA alters transcriptional activity of monoamine oxidase A and have two allelic forms MAOA-L and MAOA-H. MAOA-L is low activity allele and MAOA-H is high activity allele. Different research study suggested that MAOA-L is strongly associated with criminal activity in males. Aim of the study was to analyze the sequence of extreme violent behavior gene (MAOA) among criminals. Samples (n= 20) were collected from convicted offenders. Control samples (n=20) were collected from UVAS students. Organic method of DNA extraction was used. BPAQ (Buss and perry aggression questionnaire) was also filled by all the subjects included in the study. Primers for PCR amplification were designed using Primer3 software. PCR products were sequenced bi-directionally on ABI 3130XL Genetic analyzer. Results of sequencing were analyzed using CHROMAS software. Sequence alignment tool like BLAST (Basic local alignment search tool) was used for SNPs identification. 3 intronic and 1 exonic SNPs were observed and confirmed by BLAST. Exonic SNP gave significant p values computed by Chi square calculator. However, intronic SNPs were not significant according to chi square test. SNPs identified were not found to be associated with self-reported aggression. SNP observed in exon 14 is reported to be involved in psychiatric and depressive disorders. Availability: Items available for loan: UVAS Library [Call number: 2566-T] (1).
42.
Genetic Analysis Of Slc24a5 Polymorphism In Pakistani Population, In Association With Human Skin Pigmentation As An Externally Visible Characteristic Parameter
by Asma Hameed (2008-VA-332) | Dr. Saadat Ali | Dr. Muhammad Yasir Zahoor | Dr. Muhammad Imran.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Human skin pigmentation is a phenotypic trait that varies within a population or among different populations. In addition to the genetic factors, some of the diseases (may be genetic or epigenetic), exposure to UV or usage of cosmetics may also be involved in the pigmentation outlook. It is possible to predict human identity on the basis of DNA polymorphisms in the genes coding human phenotypic characteristics.
In case of human skin pigmentation various genes are responsible to code variability among which SLC24A5 is an important contributor. This area of research is important in the field of forensic science in cases where reference samples are not available for comparison with the DNA profiles obtained from the crime scene evidence. SNPs in the coding region of exon3 (84bp) of SLC24A5 related to skin pigmentation (as reported in literature) are associated to a predictable variation in skin color in Pakistani Population.
Blood samples (62) were collected from the participants having three types of skin coloration fair= 20, medium=22 and dark=20 from general population belonging to Punjab. Organic method (Phenol chloroform extraction method) of DNA extraction was used. After extraction DNA was quantified on nanodrop spectrophotometer. Primers for the exonic region 3 of SLC24A5 gene were designed using primer 3 software. PCR amplification of the selected region was done through touch down PCR. DNA after obtaining PCR products was purified and the samples were sequenced bi directionally on ABI 3130XL Genetic analyzer.
The results of sequencing were analyzed using CHROMAS Lite 2.1 software. Sequence was converted into Fasta Format required for alignment study. Alignment tools like Blast were required for SNPs identification and comparison of all the sample sequences with the reference sequence. Mean color scores and mean ages of all the skin color groups were calculated separately in both male and female participants. Two types of genotypes were observed i.e, AA and AG. 24 out of the total sample size showed heterozygous peaks and confirmed the polymorphism also in Pakistani population at position 299 of the sequence. Difference between allelic and genotype frequency of studied gene were evaluated and by t test and association analysis to check out the significance of the studied data with the skin coloration was done and it was concluded that AA genotype is significantly associated with fair skin color in male and female population. Furthermore, AG genotype was significantly associated with dark skin coloration in female population. This type of study reveals that after the genetic analysis of the DNA obtained from the crime scene, prediction of skin color/hue of crime related individuals of fair skin color as well as dark skin color belonging to Pakistani Population can be made in those cases where reference samples are not available. So this can be used as a genotypic marker for screening out and forensic identification of individuals in various crime cases where reference samples are not available for comparison purposes and matching suspects. Availability: Items available for loan: UVAS Library [Call number: 2608-T] (1).
43.
Development Of Novel mtDNA Metabarcodes For Species Differentiation Of Class Mammalia
by Rabia Latif (2014-VA-952) | Dr. Muhammad Imran | Dr. Saadat Ali | Dr. Akhtar Ali.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The Folmer COI mtDNA universal primers that are considered standard for DNA barcoding of life contain so many mismatches against the target sequences of vertebrate origin that they often end in failure to amplify many of vertebrate DNA extractions. This discrepancy favors for the selection and designing of new metabarcode primers that can be used to identify all individuals of vertebrates or at least all individuals represented in a class of Vrtebrata such as Class Mammalia. The current study embarks on such an endeavor. In this study development of new mtDNA metabarcode (16SrRNA) that can be used as universal primers to amplify almost all species of Class Mammals for different forensic and molecular biodiversity analyses.
Mitochondrion, the energy coins for the cell, performs the function of the oxidative phosphorylation and the formation of ATP also called energy coins for the cell. Mammalian mitochondrial genome (mtDNA) is a double stranded, circular, covalently closed molecule of approximately size of 16.4 kb. The mtDNA is inherited from the mother as a haploid and heteroplasmy has been found hardly.This fact makes it potentially relevant in the identification of maternal relationships, absence of recombination and the fast rate of evolution Blood/tissue samples were collected from Class Mammals (one specimen from every order reported to be present in Pakistan). DNA was extracted from the collected specimens through standard organic method, qualified and quantified and then PCR-amplified using novel universal primers selected from aligned mtDNA sequences originating from all mammalian mitochondrial DNA genomes submitted to different online sequence databases such as NCBI nucleotide database. The sensitivity of PCR also be assessed using a range of DNA concentrations. The amplified products were sequenced on ABI Genetic Analyzed following Sanger’s dideoxy method of
Summary
67
sequencing. The correctness of obtained mtDNA sequences were examined visually in Chromas Lite 2.1 software and then alignment of these sequences were performed against highly similar DNA sequences in NCBI nucleotide databases using BLAST in order to identify the origin of unknown mtDNA sequences. Both sequencing experiments and phylogenetic studies confirmed the specificity of the universal primer set developed and present a novel metabarcode found in this region of genome (16SrRNA) for species level identification of large number of mammalian species. So, in future, this barcode can be used for species identification in various fields of study such as meat adulteration, illegal trade, food mislabeling and molecular estimation of biodiversity. Availability: Items available for loan: UVAS Library [Call number: 2618-T] (1).
44.
Development Of Novel Mtdna Metabarcodes For The Species Differentiation Of Class Aves
by Syeda Rida Mehak Sherazi (2010-VA-477) | Dr. Muhammad Imran | Dr. M. Yasir Zahoor | Mr. Shahid Abbas.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The Folmer COI mtDNA universal primers that are considered standard for DNA barcoding of life contain so many mismatches against the target sequences of vertebrate origin that they often end in failure to amplify many of vertebrate DNA extractions. This discrepancy favors for the selection and designing of new metabarcode primers that can be used to identify all individuals of vertebrates or at least all individuals represented in a class of Vertebrata such as Class Aves. The current study embarks on such an endeavor. In this study development of new mtDNA metabarcode (16SrRNA) that can be used as universal primers to amplify almost all species of Class Aves for different forensic and molecular biodiversity analyses.
Blood/feather/tissue samples were collected from Class Aves (one specimen from every order reported to be present in Pakistan). DNA was extracted from the collected specimens through standard organic method, qualified and quantified and then PCR-amplified using novel universal primers selected from aligned mtDNA sequences originating from all Aves mitochondrial DNA genomes submitted to different online sequence databases such as NCBI nucleotide database. The sensitivity of PCR also be assessed using a range of DNA concentrations. The amplified products were sequenced on ABI Genetic Analyzer following Sanger’s dideoxy method of sequencing. The correctness of obtained mtDNA sequences were examined visually in Chromas Lite 2.1 software and then alignment of these sequences were performed against highly similar DNA sequences in NCBI nucleotide databases using BLAST in order to identify origin of unknown mtDNA sequences. With the help of sequencing and phylogenetic studies specificity of the universal primer set confirmed and presented as a novel metabarcode (16SrRNA) for species level identification of large number of Avian species
In summary, we present universal method for species classification of Aves using a targeted parallel sequencing approach. Both sequencing and phylogenetic studies experiments confirm
Summary
82
specificity of universal primer set. Although promising results were obtained with current settings, rapid improvement of bench top instruments will further develop method with less hands-on, fewer sequencing errors and lower detection limit. So, in future, this barcode can be used for species identification in various fields of study such as meat adulteration, illegal trade, food mislabeling and molecular estimation of biodiversity. Availability: Items available for loan: UVAS Library [Call number: 2617-T] (1).
45.
Monitoring Of Humoral Immune Response Of Monovalent And Combined Ppr And Fmd Serotype “O” Virus Vaccine In Small Ruminants
by Mudassar Hameed (2009-VA-386) | Dr. Jawad Nazir | DR. M. ZUBAIR SHABBIR | DR. MUHAMMAD IMRAN.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: PPR is an acute and highly contagious viral disease of small ruminants caused by morbilivirus. It causes high morbidity and mortality in small ruminants and heavy economical loses to farmers. Live attenuated vaccines are commonly used to control PPR. FMD is another highly contagious viral disease of cloven hoofed animals caused by picorna virus. Its severity is relatively high in large ruminants but carrier status of small ruminants is usually observed. In large ruminants killed FMD virus vaccines are routinely used but in small ruminants it is not practiced in Pakistan. There was need to formulate a combined vaccine containing both PPR and FMD viruses which will help to control both of the diseases in small ruminants.
.
A total of 100 goats were divided into 10 groups comprising 10 animals in each group. Each of the vaccine such as PPRV, FMDV and PPRV+FMDV was be prepared without adjuvant, gel and oil based. A total of nine types of vaccines were inoculated in the respective groups while one group remained un-inoculated negative control. Each group was subdivided into two subgroups (n=5). One subgroup was received single dose and the other inoculated with two doses of the vaccine. Serum samples from each goat were collected at 0, 1, 2, 3, 4, 5, and 6 months post vaccination (PV) and kept frozen at -20 ºC. Immune response of the vaccinated animals was monitored by measuring antibodies against PPR and FMD viruses through cELISA and VNT.
Results of the present study showed that mean percentage inhibition (MPI) value against PPR virus of non-adjuvant, gel and oil based combined (PPR+FMD) vaccines at six month post-vaccination was 83.46 ± 2.25, 80.27 ± 2.13 and 82.16 ± 1.70 respectively, whereas mean
x
neutralization antibody titer (MNA) was 4.39± 0.37, 4.06± 0.26 and 4.49 ±0.46 respectively. MPI value against FMD virus of combined (PPR+FMD) non-adjuvant, gel and oil based vaccines at six month post-vaccination was 90.17 ± 1.15, 67.22 ± 3.14 and 72.22 ± 2.04 respectively, whereas mean neutralization antibody titer (MNA) was 2.33 ± 0.27, 1.47 ± 0.10 and 1.83 ± 0.16 respectively. These MPI and MNA values showed that immune response against PPRV of combined vaccines was equivalent but non-adjuvant combined vaccine have evoked higher titer followed by oil and gel based vaccines against FMDV.
MPI values of non-adjuvant, gel and oil based monovalent PPRV vaccines at six month post-vaccination was 81.46 ± 2.22, 80.12 ± 2.13 and 81.28 ± 0.70 respectively, whereas mean neutralization antibody titer (MNA) was 4.59 ± 0.17, 4.25± 0.06 and 4.51 ±0.12 respectively.
MPI values of non-adjuvant, gel and oil based monovalent FMDV vaccines at six month post-vaccination was 00.00 ± 0.00, 82.23 ± 4.18 and 90.22 ± 0.43 respectively, whereas mean neutralization antibody titer (MNA) was 0.00 ± 0.00, 1.63 ± 0.10 and 2.99 ±0.16 respectively.
These MPI and MNA values showed that monovalent PPR vaccines induced equivalent immune response in all three formulations but monovalent FMD vaccines MPI and MNA values showed that oil based vaccine has provoked significantly higher titer followed by gel based vaccine. Whereas non-adjuvant FMD vaccine titer was diminished at one month post vaccination. Booster vaccine shots provoked higher antibody titer than single shots in all various formulations of vaccines.
The data thus obtained was analyzed through One Way ANOVA followed by Randomized Complete Block Design (RCBD). Availability: Items available for loan: UVAS Library [Call number: 2635-T] (1).
46.
Development Of Novel MtDNA Metabarcodes For Species Differentiation Of Class Reptilia
by Imran Tariq (2014-VA-505) | Dr. Muhammad Imran | Dr. Wasim Shehzad | Dr. Saadat Ali.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The FoImer COI: mtDNA. universal primers that are considered standard for DNA barcoding of life contain so many =matches against the target sequences of vertebrate men tat they often end in failure to amplify many of vertebrate DNA eurections. This disaepancy fawn foe the seaman and designing of new metabarcode panes that can be used m ideally all inditdrals of vertebrees or at least all individuals represented in a class of Vertebrate such as Cass Reprilia. The current study was embadang on such an endeavor
The proposed study was develop new m5DNA membarc ode that may be used as universal Kilns; to amplify almost all species of Class Repalia for different formic and molectdr biodivesity analyses.
Blood and tissue samples were collected from Class Repdha (at :east 24 species from every ceder reported to be present in Pakistan) DNA was extracted from the collected specimen through stacdasd organic method. qualified and =meted and then PCR-amplified using novel universal primers selected from aligned =DNA sequences origtadng from all repdlian mitochondria DNA pnomes submitted to diens online sequence databases such as NCB: micleotide database. Tne sensitiviry. of PCR was assessed using a range of DNA come:madam. The amplified products were sequenced on A131 Genetic Analyzed following Sarge's dideacy method of sequencing.
The correctness of obtained croDNA sequences were examined visually in Chromes Lite 2.1 software and then alipmmt of these sequences were per: waxed agitinc highly similar DNA sequences in NCBI nu6eonde databases using BLAST in order to identify the coigin of la-noun =DNA sequences
sequencing everimeas and phyla...net< studies was confirm the specificity of the universal primer set developed and present a novel metabarcode for species level identification of large number of reptelian species. So, In future this barcode can be used for species identification in various fields of study such as illegal trade and molecular estimation of boidiversity.
Availability: Items available for loan: UVAS Library [Call number: 2628-T] (1).
47.
Prevalence And Chemotherapy Of Bovine Anaplasmosis In District Mirpur Azad Jammu And Kashmir
by Ayyaz Shakar (2014-VA-1119) | Dr. Muhammad Hassan Saleem | Dr. Imtiaz Ahmad | Dr. Muhammad Ijaz | Dr. Muhammad Imran Rashid.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Anaplasmosis of livestock is mostly confined to tropical and subtropical countries like Pakistan, where climatic conditions are suitable for growth and development of many vectors as ticks. Piroplasms belongs to this complex and affects both large and small ruminants with high morbidity and mortality rates resulting in heavy economic losses and thus poses a serious risk to livestock production. A total of 200 blood samples of bovine, cattle (n=100) and buffalo (n=100) showing the signs of fever, progressive anemia, a marked decline in body weight, depression and debility from district Mirpur AJK were included in the study. The diagnosis was made through thin blood smear examination. The overall prevalence was found 15.00% in both species of animals. The prevalence in cattle and buffaloes revealed 22% and 08% respectively. The results showed significant difference (P<0.05) in prevalence between cattle and buffaloes. The gender wise prevalence of the disease revealed 12.12% in male and 26.87% in female cattle whereas; these values were 6.45% in male and 8.70% in female buffaloes. Chi-square analysis showed significant difference (P<0.05) between male and female animals in the area. The data on breed wise prevalence of anaplasmosis showed highest prevalence in exotic breeds (28.00%) followed by cross breed cattle (24.44%) and native breed (16.67%) of AJK. The prevalence was 5.71% in Kunddi breed of buffalo and 9.23% in Nili Ravi buffaloes. Chi-square analysis showed significant difference (P<0.05) between breeds of animals. Three different age groups of cattle and buffaloes were analyzed for the prevalence percentage of anaplasmosis in the area. The data showed highest prevalence (35.48%) in 1-3 year age group of animals followed by 18.92% in 3-5 year and 12.50% in age group 5-7 year in case of cattle and 14.29%, 6.67% and 5.88% in buffaloes respectively. the analysis of the data revealed a significant difference (P<0.05) among different age groups. The values of hemoglobin percent, packed cell volume and total
Summery
40
erythrocyte count were found increased significantly (P<0.05) in cattle and buffaloes infected with anaplasmosis whereas; total leukocyte count was decreased significantly. The parameters were tested through student’s T-test. The analysis showed significant difference of values of all parameters in normal and infected animals. The chemotherapeutic trials were conducted with two drugs against bovine anaplasmosis in clinically diagnosed cases. Twelve positive cases of each cattle and buffaloes were divided into two main groups A and B comprising of 06 animals in each group. Each group was further divided into two sub groups comprising of 03 animals in each sub groups. The group A was treated with Oxytetracycline @ 20 mg/kg B.W. I/M the efficacy of the drug was evaluated on the basis of disappearance of Anaplasma in the blood smear. The efficacy percentage of Oxytetracycline was 33.3, 33.3, 66.7, and 100 at 2nd, 4th, 6th and 8th day respectively post treatment in cattle whereas; 0.00, 33.3, 33.3 and 66.7 respectively in buffaloes. The group B was treated with Calotropis procera (Aak) at the dose rate of 0.3 mg/kg body weight orally. The efficacy percentage of Calotropis procera (Aak) was 0.00, 33.3, 66.7, and 66.7 at 2nd, 4th, 6th and 8th day respectively post treatment in cattle whereas; 0.00, 0.00, 0.00 and 33.3 respectively in buffaloes. The efficacy of Oxytetracycline against bovine anaplasmosis on day 08 was found 83.33% whereas; of Calotropis procera was 66.66%. It was concluded that Oxytetracycline is the most effective drug against bovine anaplasmosis. Availability: Items available for loan: UVAS Library [Call number: 2665-T] (1).
48.
Case Control Study Of Brucellosis And Its Associated Risk Factors At Commercial Dairy Farms
by Amna Riaz (2008-VA-257) | Prof. Dr. Mansur Ud Din Ahmad | Dr. Mamoona Chaudhry | Dr. Muhammad Imran Rashid.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Brucellosis, is a febrile, zoonotic disease caused by bacteria of genus Brucella. It is a second most important zoonotic disease after rabies. (WHO, OIE, FAO). Brucella is gram negative, aerobic, non-spore forming and non-motile coccobacilli. (Gull and Khan, 2007).The main signs are abortion after fifth month of pregnancy, still births, birth of weak calves, infertility, placentitis in females and in male’s epididymitis and orchitis. Due to its zoonotic nature farm labors, butchers, veterinarians and slaughter house workers are at high risk. Signs in human brucellosis are highly variable i.e., flu, rising and falling of temperature and causes many other complications in the body. (Baba et al.2001; Grillo et al. 2006; Shimol et al. 2012). Standard tests for brucellosis are Rose Bengal Precipitation Test (RBPT), Serum Agglutination Test (SAT) and Complement Fixation Test (CFT) (Memish et al, 2002). Its control is very difficult due to its variable incubation period, long survival time in both extracellular and intracellular environments, asymptomatic stages and resistant to the treatment, co-mingling, increasing population size and nomadism (Rahman et al. 2006).
The case study was conducted on the commercial dairy farms situated in the catchment area of University Diagnostic Laboratory, UVAS Lahore which were located Lahore, Kasur and Sheikhupura districts in Punjab. The data about positive and negative farms was obtained from university diagnostic lab, UVAS, Lahore. A predesigned questionnaire was filled from that farm workers in face to face interview. The sample size was calculated by the formula given by Schlesselman, 1982. The parameters for calculation of the sample size were power of study kept at 80% with 95% confidence interval. Total 90 samples were included (cases= 45, controls=45). Data was analyzed using chi-square. All statistical tests were performed at the significance level of 0.05.
In this study, absence of the calving pens at the farm, feeding and water practices, presence of streams and lakes near the farm and breeding practices show the strong association with this disease,by controlling the above factors and improving management at the farm can low the occurrence and spread of the disease in animals.
Availability: Items available for loan: UVAS Library [Call number: 2664-T] (1).
49.
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice
by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr.
SUMMARY
132
Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited
SUMMARY
133
elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).
50.
Affect Of Temperature, Cell Density And Multiplicity Of Infection On Biological Titer Of FMDV Type “O”
by Qazi Ithram Ul Haq (2009-VA-104) | Dr. Imran Altaf | Prof. Dr. Aftab Ahmad Anjum | Dr. Muhammad Imran.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: FMD is a transmissible viral disease of animals. It is causing very highly economical loses in Pakistan and all over the world. Through vaccination FMD is being controlled in Pakistan. Inactivated virus is used in vaccines. FMD virus grows on BHK-21 cell lines. FMDV show good adoptability on these cell lines. For good and high titer FMDV needs few physical factors to grow on BHK-21 cell lines. These factors include Temperature, Cell density and Multiplicity of infection (MOI)was considered in this research. The FMDV strain “O” was grown on BHK-21 cell line. The cells monolayer was propagated for conduction of effect of these factors on the virus. The mentioned factors were studied to get optimum level of virus titer in in vitro cell lines. The effect of 35°C, 37°C and 39°C was evaluated on the virus growth. Maximum virus propagation was noted at optimum temperature 37°C. The viral concentration at 37°C was significantly (P<0.05) higher than at 35°C and 39°C. The effect of cell density was studied on the virus concentration. Flask of three different densities 25cm2, 175cm2 and 275cm2were utilized in the current study. The virus concentration in all three different densities was not significantly different (P>0.05) from each other. Another factor Multiplicity of infection (MOI)was investigated in the study. Five different volumes 10ul, 20ul, 30ul, 40ul and 50ul of the FMDV strain “O” were used to investigate the effect of factor on the virus concentration. The results revealed highest viral harvest concretion at 50ul volume with MOI of 7.1, %age of cells infected with single virus and 6.3 × 1079. The MOI at 50ul was significantly higher (P<0.05) than the other four concentration of the virus. It was concluded from the study that the optimum temperature for the maximum FMDV concentration harvest is 37°C. The density of cell has no significant effect on the growth of virus that is flask of any density may be used to grow the FMDV. Multiplicity of infection (MOI) of 14.2 give maximum
SUMMARY
34
TCID50 Optimizing the conditions for the cell culture and virus cultivation helps in maximum virus harvest achievement. From the present study it may be suggested that the physical factors may be optimized for the remaining strains of FMD and other vaccine viruses to attain maximum virus grow. Availability: Items available for loan: UVAS Library [Call number: 2681-T] (1).
