51.
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice
by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr.
SUMMARY
132
Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited
SUMMARY
133
elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).
52.
Comparative Efficacy Of Ozone And Gentamicin Sulphate On Uterine Infections In Crossbred Dairy Cows
by Muhammad Usman Raza (2014-VA-914) | Prof. Dr. Aneela Zameer Durrani | Mr. Ghazzanffar Ali Chishti | Dr. Muti ur Rehman.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Efficient fertility of lactating dairy cows has always been the doorstep to economically profitable dairy farming. It is mostly agreed that uterine diseases in the cow after parturition have a negative effect on overall reproductive performance. Ozone which is assumed as a very potent oxidant, is one among these alternative techniques. The advantage of using ozone rather than antibiotics is in lowering the incidence of bacterial resistance in consumers of foodstuffs of animal origin, and other advantage is that ozone has no withdrawal period for milk, meat and other products. Ozone breaks through the microorganism (bacteria and germs) cell membrane, and also destroys viruses by diffusing through the protein coat in the nucleic acid core, resulting in damage of the viral nucleic acid.
The study was conducted on 50 animals which were randomly divided in two groups. Both groups were having 25, 25 animals. Group A received Ozone while group B received gentamicin sulphate intra uterine. Uterine lavage was taken twice, once before applying treatment and second after 8 hours of applying treatment. Samples were cultured for bacteriology to detect E.coli, F. necrophorum, A. pyogenes and St. pyogenes. Number of positive cases in Group A was 12, 9, 10 and 7 for E. coli, F. necrophorum, A. pyogenes and St. pyogenes respectively. Number of positive cases in Group B was 10, 8, 11 and 8 for E. coli, F. necrophorum, A. pyogenes and St. pyogenes respectively. After applying certain biochemical tests for each bacteria, bacteria was confirmed.
Difference of the colony forming units of before and after applying treatments for each bacterium in both groups was calculated. This difference was compared with difference of the colony forming units for same bacteria of other group by using Independent 2 samples T-test with the help of Statistical Packages for Social Sciences (SPSS Inc.) for the windows Version 13.3 (Chicago IL, USA).
Results were interpreted on the basis of level of significance. Differences among the groups were considered significant at P < 0.05. E. coli, F.necrophorum and St. pyogenes were highly significant as the P value for group differences was less than 0.05. Group differences among S.pyogenes showed no significance as the P>0.05.
The results showed that ozone is better in efficacy as compared to gentamicin sulphate on uterine infections in cows.
Availability: Items available for loan: UVAS Library [Call number: 2685-T] (1).
53.
Development And Evaluation Of Vaccines Prepared From Staphylococcus Aureus Isolates Of Camel Mastitis
by Amjad Islam Aqib (2013-VA-947) | Dr. Muhammad Ijaz | Dr. Riaz Hussain | Prof. Dr. Aneela Zameer Durrani | Prof. Dr. Aftab Ahmad Anjum.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Development And Evaluation Of Vaccines Prepared From Staphylococcus Aureus Isolates Of Camel Mastitis Availability: Items available for loan: UVAS Library [Call number: 2750-T] (1).
54.
Comparative Efficacy of Different Techniques in Tracheal End to End Anastomosis
by Muhammad Saad Uzair (2009-VA-181) | Dr. Naveed Hussain | Prof. Dr. Muhammad Arif Khan | Prof. Dr. Aneela Zameer Durrani.
Material type: Book; Literary form:
not fiction
Publisher: 2017Dissertation note: CD Corrupt. Availability: Items available for loan: UVAS Library [Call number: 2808-T] (1).
55.
Epidemiology Of Major Bacterial And Parasitic Causes Of Foal Diarrhea
by Ikramul Haq (2010-VA-60) | Prof. Dr. Aneela Zameer Durrani | Prof. Dr. Muhammad Sarwar Khan | Dr. Muhammad Hassan Mushtaq.
Material type: Book; Literary form:
not fiction
Publisher: 2017Dissertation note: Present study was carried out in District Lahore and District Sargodha, Punjab province of Pakistan, from January, 2016 to December, 2016. The study was conducted to study the prevalence of Diarrhea in foals and to identify the major viral, bacterial and parasitic causes of diarrhea in foals in these districts. The foals that passed lose feces a least 4 to 5 times a day were considered diarrheic. The results showed that the prevalence of diarrhea was 72.8% in the foals. District wise prevalence showed that the prevalence of diarrhea in foals were 73.7% in district Sargodha and were 72% in District Lahore. According to the results the prevalence of diarrhea in male foals was 74% and in female foal were 72%. The diarrhea was more prevalent in donkeys at is 76.6% as compaired to horses which was 74.5%.
The viral (rotavirus), bacterial (Salmonella, Clostridium perfirengens and E. coli) and parasitic causes of diarrhea were identified by appropriate technique. The viral causes were diagnosed using ELISA technique. The bacteria were isolated by culturing and were confirmed by polymerase Chain Reaction (PCR). The parasitic causes studied using microscopic examination. To identify the cause of diarrhea 400 samples (200 from each district) were collected and processed for viral, bacterial and parasitic detection.
The results showed that 91.1% of the samples were positive for one or more infectious agents. District wise results showed that the prevalence of more or more than infectious agents were higher in district Lahore (95.5%) as compared to district Sargodha which was 87.5%. The isolation of one or more than one infectious agents were higher in males it is 92.7% while were low in females which was 90.5%. The results showed that the prevalence of one or more than one infectious agents were higher in horses (92.4%) in comparision with donkey which was 87.8%.
Experiment No. I: Investigation of Parasitic causes of Foal Diarrhea
Fecal samples were preserved in 10% formalin and transported to the laboratory for diagnosis of parasites. The fecal samples from foals suffering from diarrhea were processed by using following parasitological examination.
4. Direct microscopic examination
The sample negative with direct microscopic examination was examined using simple floatation examination.
5. Simple floatation examination
The sample negative with Simple floatation examination was examined by using sedimentation floatation technique.
6. Sedimentation floatation Technique
The sample negative by using Sedimentation technique was recorded as negative for parasites.
The results show that 340 (85%) out of 400 samples were positive for one or more than one endo-parasites. The prevalence of endo-parasites was higher in district Sargodha it is 87.5% as compared to district Lahore, which was 82.5% (Table No.7). Gastrodiscus Spp were the higher prevalent endo-parasite and 308 (77%) (Table No. 10) of the samples were positive for Gastrodiscus Spp while the lowest prevalent endo-parasite was Anoplocephala spp with (3) 0.75% prevalence (Table No. 12). other helmenth such as Dictyocaulus Spp. (22.5%), Oxyuris Spp. (15.75%), Strongyloides Spp. (15.75%), Ascaris equorum (4.75), Tridontophorus Spp. (2%), Trichomena spp. (1.5%) Strongylus spp. (1.5%), and Paranoplocephala Spp. (5%)
Experiment No. II: Molecular Diagnosis of Bacteria Causes of Foal Diarrhea
The samples were culture for Salmonella, E.coli and Clostridium perfirengins on respective selective media and DNA was extracted from the culture. DNA was amplified by PCR and the bacteria were confirm using PCR. To diagnose Lasonia the DNA was extracted directly from fecal sample and were processed for lawsonia. The result show that 55% of the samples were positive for one or more than one type of bacteria. Maximum prevalence were observe of E. coli 48.75% and none of the sample were positive for lawsonia. The other isolated bacteria were Salmonella 18.24% and Clostridium perfiengens 18%.
Experiment No. III: Investigation of Viral causes of Foal Diarrhea
Foal suffering from diarrhea were screened and analyzed for presence of rotavirus by using commercially available ELISA kit
The result of detection of rotavirus shows that rotavirus was detected in (70) 17.5% of the sample processed for the diagnosis of rotavirus.
Availability: Items available for loan: UVAS Library [Call number: 2800-T] (1).
56.
Pathological Studies On Contagiouscaprine Pleuropneumonia In Small Ruminants Of District Dera Ismail Khan, Khyber Pakhtunkhwa
by Hamid Niaz (2008-VA-163) | Dr. Muti Ur Rehman | Dr. Gulbeena Saleem | Prof. Dr. Aneela Zameer Durrani.
Material type: Book; Literary form:
not fiction
Publisher: 2017Dissertation note: These experiments presented the pathological studies on Contagious caprine pleuropneumonia in Distract Dera Ismail Khan at Govt. slaughter house through gross pathology, hematology, competitive ELISA, histopathology and molecular identification (PCR). For this purpose the blood and tissue samples were collected from contagious caprine pleuropneumonia suspect at govt slaughter house Dera Ismail Khan. On the basis of clinical examination, the animals were showing the elevated temperature, nasal discharge, painful cough, dyspnea and weakness.
On postmortem examination the lungs showed congestion and marbled appearance (Figure no 4.1). There was straw color pleural fluid in the chest cavity (Figure no 4.2). Total of 50 samples 25 blood and tissue samples of sheep and 25 blood and tissue samples of goat were collected for the different parameters of the study. The hematology was performed at SEENA Lab in Distract Dera Ismail Khan. The hematology data was further compared and analyzed by using statistical analysis (independent t-Test). RBCs values of positive and negative cases of CCPP in goats were 9.50±0.27 and 3.15±0.39respectively. There is significant difference (p<0.05) between positive and negative cases of CCPP in goats regarding RBCs values. WBCs values of positive and negative cases of CCPP in goats were 8.31±0.38 and 17.19±1.22respectively. There is significant difference (p<0.05) between positive and negative cases of CCPP in goats regarding WBCs values. PCV values of positive and negative cases of CCPP in goats were 4.03±.63 and 17.11±1.5respectively. There is significant difference (p<0.05) between positive and negative cases of CCPP in goats regarding PCV values. The MCH values of positive and negative cases of CCPP in goats were 110±30.6and 7.65±1.01 respectively.So there was
Availability: Items available for loan: UVAS Library [Call number: 2843-T] (1).
57.
Epidemiology, Molecular Detection, Zoonotic Potential, Heamatology And Chemotherapy Of Cryptosporidiosis In Small Ruminants In Southern Khyber Pakhtunkhwa, Pakistan
by Naimat Ullah Khan (2011-VA-516) | Dr. Muhammad Hassan Saleem | Prof. Dr. Aneela Zameer Durrani | Dr. Nisar Ahmad.
Material type: Book; Literary form:
not fiction
Publisher: 2017Dissertation note: Cryptosporidiosis is one of the most important parasitic enteric protozoan infection affecting all vertebrates. The current study was designed to determine the percent prevalence of cryptosporidiosis in small ruminants and humans along with associated risk factors.
An overall highest percent prevalence of cryptosporidiosis recorded in all four categories of small ruminants were 27.22%, 20.56%, 18.33% and 12.22% in lambs, kids, Sheep and goats respectively.
In the current study, 21.55%, 18.33% and15% prevalence of the Cryptosporidium infection was recorded in sheep in District Kohat, Bannu and Lakki Marwat respectively. In the present study, the highest month wise percent prevalence in sheep, was observed in the month of August (36.66%) followed by April (26.66%), June (26.66%), May, July and September (23.33%), February (10.66%), March (10%), November (10%) while the lowest percent prevalence was observed in the month of December and January (6.66%). In sheep, season wise percent prevalence was also studied where highest prevalence was recorded in summer and autumn season (23.33%), followed by spring (20%) while the lowest percent prevalence was found in the winter season (10%). In sheep, age wise percent prevalence was also studied where highest percent prevalence was found at the age of 1 year (22.38%) followed by 1-2 years (18.03%) while the lowest at the age of 2-3 years (13.46%). In sheep, sex wise percent prevalence was also documented where highest percent prevalence was recorded in female (18.80%) followed by male (17.02%) where lowest percent prevalence was recorded.
In goats, the percent prevalence of the Cryptosporidium infection was also studied in three selected areas where recorded 6.66%, 11.66% and 18.3% prevalence in District Bannu, Lakki Marwat and Kohat respectively. Similarly, in goats, overall highest month wise percent
Summary
154
prevalence was recorded in the month of August (30%), followed by July (23.33%), June (20%), May (16.66%), March and September (13.33%), April and November (10%), January, February and October (3.33%) while the lowest percent prevalence was recorded in December (0%). In the current study, the season wise prevalence was also studied in goats where highest percent prevalence was recorded in the summer season (20.83%), followed by spring (13.33%), autumn (11.66%) while the lowest prevalence was observed in winter season (3.33%). The highest age wise percent prevalence was recorded at the age of 1 year (18.58%) followed by 1-2 years (10.20%) while the lowest at the age of 2-3 years or above (5.95%). According to the sex wise percent prevalence, the highest percent prevalence was recorded in male (12.30%) while the lowest in females (12.17%).
The overall highest percent prevalence of the Cryptosporidium infection was also recorded in lambs in three areas where 33.33%, 25% and 23.33% prevalence was recorded in Kohat, Lakki Marwat and Bannu respectively. The highest month wise percent prevalence was recorded in the month of August (46.6%), followed by other months of the year such as July (40%), April, May and June (30%), September and October (26.66%), November and January (20%) while the lowest in the month of February and December (16.66%) in lambs. The Season wise percent prevalence was recorded in lambs where highest percent prevalence was recorded in summer season (36.66 %), followed by spring and autumn (26.66%) while the lowest in winter season (18.33%). According to the age wise percent prevalence in lambs, the highest prevalence was recorded at the age of 1-15 days (38.09%) followed by 16-30 days (29.41%) while the lowest at the age of 31-60 days or above (15.15%). In lambs, the highest sex wise percent prevalence was recorded in females (31.18%) while the lowest percent prevalence was observed in males (22.98%).
Summary
155
In kids, overall highest percent prevalence was 20.55% recorded in three selected districts where the highest prevalence was recorded in District Kohat (23.33%), followed by District Bannu (20%) while the lowest in District Lakki Marwat (18.33%). In kids the month wise percent prevalence was also studied where the highest percent prevalence was recorded in May and August (33.33%), followed by June, July and September (26.66%), March, April and October (20%), November and December (13.33%) while the lowest percent prevalence was recorded in the month of the January (6.66%). The Season wise percent prevalence was also recorded in kids, where the highest percent prevalence was observed in the summer season (30%), followed by autumn (23.33%), spring (20%) while the lowest prevalence was recorded in winter season (10%). The highest age wise percent prevalence in kids was also recorded at the age of ≤1-15 days (33.92%), followed by 16-30 days (15.38%) while the lowest at the age of ≥31-60 days or above (13.55%). Sex wise percent prevalence was also determined in goat kids where, the highest percent prevalence was recorded in female (20.98%) followed by male kids (19.19%).
To conduct molecular study, 360 fecal samples of sheep were analyzed for presence of the Cryptosporidium oocysts through simple microscopic method first then confirmed by PCR. DNA was extracted with the help of DNA extraction kit (Made in USA, GFC vivantis). The targeted gene of parasite was 18s rRNA which result in amplification of a segment of genomic DNA at 435 bp. The following primers sequence was used for Forward primer: (5-AAGCTCGTAGTTGGATTTCTG- and reverse primers (5-TAAGGTGCTGAAGGAGTAAGG-3. An overall molecular percent prevalence of the Cryptosporidium infection was 24.99% in sheep in three selected zones of southern KPK. The highest molecular percent prevalence was 31.66%, 25% and 18.33% in District Kohat, Bannu and Lakki Marwat respectively.
Summary
156
The highest season wise molecular percent prevalence was also recorded where the highest percent prevalence was recorded in the summer (33.33%), followed by autumn (30%), spring (26.66%) while the lowest in the winter season (13.33%). Molecular percent prevalence was higher in females (27.08%) than male (25.53%). On the basis of environmental factors, overall the highest percent prevalence was recorded in the month of August where highest ambient temperature, relative humidity and heavy rain fall was recorded.
To find out Zoonotic aspect of the Cryptosporidium infection, the overall highest percent prevalence was recorded in children (16.66%), followed by adults (5.55%).
The highest percent prevalence was recorded in diarrhoeic children where direct contact with small ruminants was observed while the lowest prevalence was recorded in those children where no direct or indirect contact was observed.
To conduct the therapeutic trials, a total of 50 goats were selected of the same weight and age that were naturally infected by Cryptosporidium under field conditions. All the goats were placed under same feeding and management conditions and randomly divided into five groups such as A, B, C, D and E. All animals in groups A, B, C and D were treated with Azithromycin (10mg/kg b.wt), Metronidazole (50mg/Kg b.wt), Allium sativum (50mg/Kg b.wt) and Paromomycin (100mg/kg b.wt) respectively while Group-E was placed as a positive control group. The highest percent efficacy in reduction of OPG was shown by different drugs such as Paromomycine (91.77%) followed by Metronidazole (78.20%), Allium sativum (77.00%) while the lowest percent efficacy was shown by Azithromycin (59.29%). On the basis of hematological study, lower lymphocytes count was (48.39%) recorded in non-infected animals while higher (54.33%) count was recorded in infected animals. Similarly higher eosinophil count was (6.73%) recorded in infected group while lower (50 %) counts were recorded in non-
Summary
157
infected group. Hb level was higher in infected group than healthy animals. PCV level was higher (42.94%) in infected animals while low (34.62%) in healthy animals. Biochemical analysis of the serum showed, higher quantity of total protein, albumin, ALP, Sodium, Potassium, Chloride, Zinc, Copper, Urea and Creatinine was recorded in infected goats while lower quantity was observed in healthy goats. Availability: Items available for loan: UVAS Library [Call number: 2880-T] (1).
58.
Comparative Efficacy Of Mycotoxin Binders And Effects Of Aflatoxin B1 On Health Status Of Lactating Beetal Goats
by Haq Aman Ullah (2005-VA-180) | Prof. Dr. Aneela Zameer Durrani | Dr. Muhammad Ijaz | Dr. Aqeel Javeed.
Material type: Book; Literary form:
not fiction
Publisher: 2017Dissertation note: Aflatoxins are the secondary metabolites produced by moulds particularly by certain strains of Aspergillus flavus and Aspergillus parasiticus. The most toxic is the aflatoxin B1 (AFB1) and is considered as Hepatocarcinogenic. In present study aflatoxin B1 contamination status of different concentrate feeds (cotton seed cake, wanda, wheat bran and homemade concentrate mixture) of dairy goats was investigated in district Lahore of Pakistan. Twenty goat farms were randomly selected and 40 feed samples (two from each farm) were collected. The samples were analysed for the estimation of AFB1 using reverse phase High Performance Liquid Chromatography (HPLC) in Quality Operations Laboratory, UVAS, Lahore. AFB1 was detected in 33 feed samples out of 40 thus with a percent contamination rate of 83%. The quantity of aflatoxin B1 ranged from 0-225.736 ppb (μg/kg). The maximum level of AFB1 was detected in cotton seed cake (mean level 137.059 ± 22.293 ppb) and minimum level was detected in wheat bran (mean level 5.676 ± 1.047 ppb). Amongst the positive concentrate feed samples, 28 samples (85% of the positive) were having the concentration of AFB1 higher than the permissible level recommended by European Communities which is 5 ppb for concentrates. Thus the milk from goats consuming AFB1 contaminated concentrate feed can be a potential hazard for public health. This part of the study fulfills the first objective of the research project, which is to determine the aflatoxin B1 contamination status of concentrate feeds of dairy goats in District Lahore.
Beetal is the best dairy goats’ breed of Pakistan. In second part of the study, lactating beetal goats were used. In this experiment, effects of dietary AFB1 on health status of lactating beetal goats and its transfer from feed into milk as metabolite aflatoxin M1 (AFM1) were investigated. Thirty two lactating beetal goats of 3-4yr old, 6-8 wks. lactation period and weighing 40.91 ± 0.285 Kg, were selected from Small Ruminant Farm, Pattoki, University of veterinary and Animal
97
Sciences Lahore, and were randomly divided into four groups A, B, C and D, each having 8 animals. Group A was kept as negative control, while groups B, C and D were fed with aflatoxin B1 through naturally contaminated cotton seed cake. The cotton seed cake was having high level of AFB1 which was 150 μg/kg. After 7 days of adaptation period, each animal of groups B, C and D was individually fed with 30μg, 40μg and 50μg of aflatoxin B1 per day respectively through naturally contaminated cotton seed cake for a 10 days period., thus each animal of groups B, C, and D was fed with 200 g, 266.66 g, and 333.33 g of cotton seed cake per day respectively, to provide the required amount of AFB1 to each experimental animal. Milk samples were collected 24hr before the first AFB1 feeding and on 3rd, 7th and 10th day post aflatoxin B1 feeding. The samples were tested for AFM1 through HPLC, somatic cell count (SCC) and total viable count (TVC). Blood samples were analyzed for aspartate aminotransferase (AST), alanine aminotransferase (ALT) and alkaline phosphatase (ALP) levels before and after aflatoxin B1 administration. AFM1 was detected in all milk samples of the Groups B, C and D, with concentration beyond permissible level which is 0.05ppb (European communities).The amount of AFM1 excreted in milk was positively correlated with the amount of aflatoxin B1 ingested. The AFB1 was excreted in the milk as AFM1 at 1.35-1.59%. The mean SCC of groups A, B, C and D was 1.44×106 ± 1.75×105, 4.13×106 ± 4.09×105, 3.63×106 ± 4.60×105, 1.38×106 ± 1.56×105 cells/ml respectively. TVC obtained was 2.4×104 ± 1.9×103, 4.3×104 ± 1.6×103, 4.8×104 ± 3.3×103, 3.6×104 ± 3.3×103 cfu/ml of milk for group A, B, C and D respectively. The mean ALP levels were 62 ± 7, 223 ± 22, 147 ± 14, 175 ± 16 U/L for group A, B, C and D respectively. Mean levels of AST of group A, B, C and D were 79 ± 2.214, 110 ± 5.386, 104 ± 2.015, 126 ± 9.456 respectively. Mean levels of ALT of group A, B, C and D were 14 ± 0.326, 20 ± 1.118, 21 ± 1.106, 28 ± 1.250 U/L respectively. The ingestion of AFB1 even at low dose of 30μg in goats resulted in excretion
98
of AFM1 in milk beyond the permissible level. SCC, TVC, AST and ALT levels increased with ingestion of dietary AFB1. This part of the study fulfills the 2nd objective of the research project which is to investigate the effects of dietary aflatoxin B1 on health status of lactating beetal goats and its transfer from feed into milk as AFB1.
In the third part of the study, the efficacy of two different mycotoxin binders Toxfin® and Elitox® was determined, in terms of reduction in milk AFM1 excretion, improvement in milk quality and liver health. Groups A and B were kept negative and positive controls respectively. Experimental animals, cotton seed cake and number of groups remained the same as used in part 2 of the experiment. After initial 10 days of the experiment, each animal of groups B, C and D was daily fed with 266.66 g of cotton seed cake to provide 40 μg of AFB1 per day to each animal, for next 7 days. In the meantime, group C was fed with mycotoxin binder Toxfin® (Kemin industries, Inc. USA), at a dose rate of 3 g per Kg of cotton seed cake, while group D was fed with mycotoxin binder Elitox® (Impextraco Belgium ) at a dose rate of 1 g per Kg of cotton seed cake. Toxfin® and Elitox® both significantly decreased the excretion of AFM1 in goats’ milk, detected through high performance liquid chromatography (HPLC). Toxfin® and Elitox® reduced the excretion of AFM1 in milk by 56 % and 48 % respectively, thus the detoxifying ability of Toxfin® in feed was significantly higher than Elitox®. The SCC and TVC remained statistically unchanged after the administration of mycotoxin binders. The enzyme activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were not significantly affected by the mycotoxin binders. The alkaline phosphatase (ALP) level significantly increased in animals receiving either Toxfin® or Elitox®. The mycotoxin binders used in this study were not able to significantly improve milk quality and liver’s health in AFB1 treated goats, during the experimental period. This part of the study fulfills the 3rd objective of the research project, which was to determine the comparative efficacy of two different mycotoxin binders in lactating goats fed with mold contaminated diet. Availability: Items available for loan: UVAS Library [Call number: 2860-T] (1).