51.
Exploring Anthelmintic Resistance In Ovine Haemonchosis Through Faecal Egg Dna At Livestock Research And Development Station, Paharpur, D .I. Khan
by Ghulam Hassan (2007-VA-144) | Dr. Haroon Akbar | Dr. Muhammad Imran Rashid | Dr. Muhammad Ijaz.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Gastrointestinal nematodes are recognized as a major constraint of small ruminant production system at small and large-scale farming in developing countries, leading to significant economic losses. The most important of these is Haemonchus contortus. Anthelmintic resistance now poses problems to sheep farmers throughout the world. This study has been designed to check anthelmintic resistance against haemonchosis of sheep by an in vivo method. The current study was carried out at Parasitology laboratory (Toxovacc lab), Department of Parasitology, University of Veterinary and Animal Sciences, Lahore. 100 faecal samples were collected from sheep at Livestock Research and Development Station, Paharpur, D.I. Khan. Animals were drenched with anthelmintic (Albashell containing Albendazole 2.5%, administered @10 mg/kg of body weight) orally after 1st sampling, at 0 day. The faecal samples were examined microscopically, micrometery was exploited and EPG analysis was performed by using McMaster technique. After 14 days, the second sampling was done. The fecal samples were brought and stored at 4°C in Parasitology laboratory (Toxovacc lab). Pre-trial & Post trial EPG were compared and positive samples were taken (tag#1057 Damani sheep male, tag#13 Balkhi sheep male, tag#1096 Damani female, tag#06 Balkhi female, tag#20 Balkhi) for egg isolation (Module, 2004) for egg DNA extraction through classical method of Phenol-Chloroform-Iso-Amyl Alcohol extraction. DNA samples were subjected to polymerase chain reactions (PCR) targeting β tubulin gene for detection of benzimidazole resistance at genetic level. Fecal egg count reduction percentage of 74.57% at day 14 post treatment clearly shows the presence of benzimidazole drug resistance in parasites infecting Balkhi and Damani sheep at Livestock Research and Development Station, Paharpur, D.I. Khan.
Summary
64
In conclusion, PCR-Sequencing technique finds its value in the detection of benzimedazole resistance at molecular level in eggs of Haemonchus contortus of sheep and this technique also helps the understanding of the development of drug resistance in the parasite. Availability: Items available for loan: UVAS Library [Call number: 2513-T] (1).
52.
Effect Of Stabilizers On Biological Titre Of Freeze Dried Ppr Virus Vaccine
by Muhammad Zubair Latif (2009-VA-382) | Prof. Dr. Khushi Muhammad | Dr. Muhammad Anees | Dr. Imran Altaf | Dr. Muhammad Imran.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: PPR is an acute and highly contagious viral disease of small ruminants caused by Morbillivirus. It causes high morbidity and mortality in small ruminants and heavy economic loses to farmers. Live attenuated vaccines are commonly used to control the disease. During freeze drying and after dilution of freeze dried vaccine, there is lose of virus titre so vaccine efficacy is reduced. Stabilizers are therefore added to protect from freeze drying stress and heat shock during storage and transportation. Each stabilizer has different protective effect. The present project was therefore designed to evaluate different stabilizers to act as the best one for maximum stability of the virus titre.
Fifty vials of PPR vaccine with each of six stabilizers (Weybridge medium-WBM, Lactalbumin hydrolysate sucrose-LS, lactalbumin hydrolysate sorbitol-LSbG, Tris sucrose-TS, Tris Trehalose-TT and Goat skimmed milk-GSM) was formulated, freeze dried and three vials from each formulation was selected and evaluated by biological titration just after freeze drying and dilution in PBS (7 pH). Each of the vaccine diluted with the PBS and stored at 40C, 250C, 370C for 36 hours. Biological titration of each of the vaccines stored at different temperature and time was determined on Vero cell lines. The virus infectivity was calculated as mean TCID50 by MTT assay.
It is concluded from the study that stabilizers having carbohydrates (sucrose, sorbitol, trehalose), salts (sodium) and hydrolyzed proteins (lactalbumin hydrolysates) are effective to make compact mass (freeze drying) of PPR virus vaccine. WBM, LS, and LSbG maintain infectivity of the PPR virus vaccine (if reconstitution with PBS and stored at 4°C) for 12 hours. However, TT is able to protect infectivity titre of the PPR virus vaccine during freeze drying and even during its storage after hydration with PBS at 4°C for 24 hours. Availability: Items available for loan: UVAS Library [Call number: 2546-T] (1).
53.
Effect Of Bovine Somatotropin On Productive Performance In Nili Ravi Buffaloes During Mid Lactation
by Muhammad Imran (2006-VA-16) | Dr. Muhammad Qamar Shahid | Dr. Muhammad Saad Ullah | Dr. Amjad Riaz.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Agriculture being the backbone of economy contributes 21% of GDP in which major share 55.5 % is of Livestock sectorin the agriculture value added and 11.9 percent of National GDP.Total milk production in Pakistan is 52 million tons per year. Buffalo is playing a leading role in the national economy by producing more milk.Out of total milk produced in the country, buffalo contributes about 68%(Anonymous,2012). Nili Ravi is the best performing animal producing more milk than other buffalo breeds in the world (2500 liters per lactation) but daily average milk production per animal is 7-8 liters. Increasing population in the World as well as Pakistan has resulted in higher demand of milk and milk by products. Animalresearchers are trying to devise different ways through which they can fulfill the increasing demand of milk and meat. Milk and meat production enhancement through different biotechnologies are thought to be important for the developing countries. Synthetic Bovine Somatotropin Hormone (bST) is one of biotechnological product which can help to increasethe production of animals.
The current study was conducted atLivestock Experiment Station Bhunikey, Pattoki to determine the effect ofbSTon DMI, body weight, milk production, milk composition, body condition score and production efficiencyin lactatingNili-Ravi buffaloes.Fifty Nili-Ravi lactating buffaloes were selected from the herd at LES Bhunikey, Pattoki. The buffaloes were randomly divided into two groups (A and B) with 25 in each group.All the buffaloes offered silage ad libitum, water access round the clock and supplemented with concentrate @ 1 kg for 2 liter of milk production. Group A was administered with 500mg bST at 14 days interval for 5 months and group B was as control.
Dry matter intake was recorded on weekly basis and milk production measured twice a day (morning and evening). Body weight of buffaloes measured on monthly basis. Milk samples were collected after every 2 weeks for fat, lactose, proteins, solid-not-fats and total solids contents using milk analyzer in the Farm and Health Laboratory, Buffalo Research Institute, Pattoki. Body condition score of buffaloes on 5-point scale recorded before bST administration during adjustment period then during bST treatment in middle of experiment and finally when withdraw of bST administration.
Data obtained was statistically analyzed through analysis of variance (ANOVA) using proc GLM procedure of SAS. Treatment was considered as fixed effect and start milk was used as covariate to avoid any bias.
Milk production, DMI and mastitis incidence significantly increased in lactating Nili-Ravi buffaloes with bST administration. Body condition score decreased significantly but body weight change was non significant in bST treated buffaloes.
bST treatment increased milk production in lactating Nili Ravi buffaloes.However, the mastitis incidence and antibiotic treatment increased in bST treated animals. Antibiotic residues in milk are major cause of antibiotic resistance in humans which is a huge challenge to humanity in 21st century. So bST treatment is not a viable approach for enhancing milk production.
Availability: Items available for loan: UVAS Library [Call number: 2571-T] (1).
54.
Sequence Analysis Of Violent Behavior Gene Among Criminals
by Jawairia Akram (2010-VA-492) | Dr. Asif Nadeem | Dr. Muhammad Imran | Dr. Saadat Ali.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Violence is defined as uncontrolled emotions problem and is a reason of violent behavior among criminals. Violence is mostly physical towards other people. MAOA and MAOB are isozymes of monoamine oxidase. MAOA is associated with aggression and violence in criminals as it affects brain structure and function which ultimately causes violence and aggression MAOA gene present on mitochondrial outer membrane encodes monoamine oxidase that degrade neurotransmitters like dopamine, serotonin, epinephrine and nor epinephrine. An SNP (MAOA-LPR) in long promoter region of MAOA alters transcriptional activity of monoamine oxidase A and have two allelic forms MAOA-L and MAOA-H. MAOA-L is low activity allele and MAOA-H is high activity allele. Different research study suggested that MAOA-L is strongly associated with criminal activity in males. Aim of the study was to analyze the sequence of extreme violent behavior gene (MAOA) among criminals. Samples (n= 20) were collected from convicted offenders. Control samples (n=20) were collected from UVAS students. Organic method of DNA extraction was used. BPAQ (Buss and perry aggression questionnaire) was also filled by all the subjects included in the study. Primers for PCR amplification were designed using Primer3 software. PCR products were sequenced bi-directionally on ABI 3130XL Genetic analyzer. Results of sequencing were analyzed using CHROMAS software. Sequence alignment tool like BLAST (Basic local alignment search tool) was used for SNPs identification. 3 intronic and 1 exonic SNPs were observed and confirmed by BLAST. Exonic SNP gave significant p values computed by Chi square calculator. However, intronic SNPs were not significant according to chi square test. SNPs identified were not found to be associated with self-reported aggression. SNP observed in exon 14 is reported to be involved in psychiatric and depressive disorders. Availability: Items available for loan: UVAS Library [Call number: 2566-T] (1).
55.
Genetic Analysis Of Slc24a5 Polymorphism In Pakistani Population, In Association With Human Skin Pigmentation As An Externally Visible Characteristic Parameter
by Asma Hameed (2008-VA-332) | Dr. Saadat Ali | Dr. Muhammad Yasir Zahoor | Dr. Muhammad Imran.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Human skin pigmentation is a phenotypic trait that varies within a population or among different populations. In addition to the genetic factors, some of the diseases (may be genetic or epigenetic), exposure to UV or usage of cosmetics may also be involved in the pigmentation outlook. It is possible to predict human identity on the basis of DNA polymorphisms in the genes coding human phenotypic characteristics.
In case of human skin pigmentation various genes are responsible to code variability among which SLC24A5 is an important contributor. This area of research is important in the field of forensic science in cases where reference samples are not available for comparison with the DNA profiles obtained from the crime scene evidence. SNPs in the coding region of exon3 (84bp) of SLC24A5 related to skin pigmentation (as reported in literature) are associated to a predictable variation in skin color in Pakistani Population.
Blood samples (62) were collected from the participants having three types of skin coloration fair= 20, medium=22 and dark=20 from general population belonging to Punjab. Organic method (Phenol chloroform extraction method) of DNA extraction was used. After extraction DNA was quantified on nanodrop spectrophotometer. Primers for the exonic region 3 of SLC24A5 gene were designed using primer 3 software. PCR amplification of the selected region was done through touch down PCR. DNA after obtaining PCR products was purified and the samples were sequenced bi directionally on ABI 3130XL Genetic analyzer.
The results of sequencing were analyzed using CHROMAS Lite 2.1 software. Sequence was converted into Fasta Format required for alignment study. Alignment tools like Blast were required for SNPs identification and comparison of all the sample sequences with the reference sequence. Mean color scores and mean ages of all the skin color groups were calculated separately in both male and female participants. Two types of genotypes were observed i.e, AA and AG. 24 out of the total sample size showed heterozygous peaks and confirmed the polymorphism also in Pakistani population at position 299 of the sequence. Difference between allelic and genotype frequency of studied gene were evaluated and by t test and association analysis to check out the significance of the studied data with the skin coloration was done and it was concluded that AA genotype is significantly associated with fair skin color in male and female population. Furthermore, AG genotype was significantly associated with dark skin coloration in female population. This type of study reveals that after the genetic analysis of the DNA obtained from the crime scene, prediction of skin color/hue of crime related individuals of fair skin color as well as dark skin color belonging to Pakistani Population can be made in those cases where reference samples are not available. So this can be used as a genotypic marker for screening out and forensic identification of individuals in various crime cases where reference samples are not available for comparison purposes and matching suspects. Availability: Items available for loan: UVAS Library [Call number: 2608-T] (1).
56.
Development Of Novel mtDNA Metabarcodes For Species Differentiation Of Class Mammalia
by Rabia Latif (2014-VA-952) | Dr. Muhammad Imran | Dr. Saadat Ali | Dr. Akhtar Ali.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The Folmer COI mtDNA universal primers that are considered standard for DNA barcoding of life contain so many mismatches against the target sequences of vertebrate origin that they often end in failure to amplify many of vertebrate DNA extractions. This discrepancy favors for the selection and designing of new metabarcode primers that can be used to identify all individuals of vertebrates or at least all individuals represented in a class of Vrtebrata such as Class Mammalia. The current study embarks on such an endeavor. In this study development of new mtDNA metabarcode (16SrRNA) that can be used as universal primers to amplify almost all species of Class Mammals for different forensic and molecular biodiversity analyses.
Mitochondrion, the energy coins for the cell, performs the function of the oxidative phosphorylation and the formation of ATP also called energy coins for the cell. Mammalian mitochondrial genome (mtDNA) is a double stranded, circular, covalently closed molecule of approximately size of 16.4 kb. The mtDNA is inherited from the mother as a haploid and heteroplasmy has been found hardly.This fact makes it potentially relevant in the identification of maternal relationships, absence of recombination and the fast rate of evolution Blood/tissue samples were collected from Class Mammals (one specimen from every order reported to be present in Pakistan). DNA was extracted from the collected specimens through standard organic method, qualified and quantified and then PCR-amplified using novel universal primers selected from aligned mtDNA sequences originating from all mammalian mitochondrial DNA genomes submitted to different online sequence databases such as NCBI nucleotide database. The sensitivity of PCR also be assessed using a range of DNA concentrations. The amplified products were sequenced on ABI Genetic Analyzed following Sanger’s dideoxy method of
Summary
67
sequencing. The correctness of obtained mtDNA sequences were examined visually in Chromas Lite 2.1 software and then alignment of these sequences were performed against highly similar DNA sequences in NCBI nucleotide databases using BLAST in order to identify the origin of unknown mtDNA sequences. Both sequencing experiments and phylogenetic studies confirmed the specificity of the universal primer set developed and present a novel metabarcode found in this region of genome (16SrRNA) for species level identification of large number of mammalian species. So, in future, this barcode can be used for species identification in various fields of study such as meat adulteration, illegal trade, food mislabeling and molecular estimation of biodiversity. Availability: Items available for loan: UVAS Library [Call number: 2618-T] (1).
57.
Development Of Novel Mtdna Metabarcodes For The Species Differentiation Of Class Aves
by Syeda Rida Mehak Sherazi (2010-VA-477) | Dr. Muhammad Imran | Dr. M. Yasir Zahoor | Mr. Shahid Abbas.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The Folmer COI mtDNA universal primers that are considered standard for DNA barcoding of life contain so many mismatches against the target sequences of vertebrate origin that they often end in failure to amplify many of vertebrate DNA extractions. This discrepancy favors for the selection and designing of new metabarcode primers that can be used to identify all individuals of vertebrates or at least all individuals represented in a class of Vertebrata such as Class Aves. The current study embarks on such an endeavor. In this study development of new mtDNA metabarcode (16SrRNA) that can be used as universal primers to amplify almost all species of Class Aves for different forensic and molecular biodiversity analyses.
Blood/feather/tissue samples were collected from Class Aves (one specimen from every order reported to be present in Pakistan). DNA was extracted from the collected specimens through standard organic method, qualified and quantified and then PCR-amplified using novel universal primers selected from aligned mtDNA sequences originating from all Aves mitochondrial DNA genomes submitted to different online sequence databases such as NCBI nucleotide database. The sensitivity of PCR also be assessed using a range of DNA concentrations. The amplified products were sequenced on ABI Genetic Analyzer following Sanger’s dideoxy method of sequencing. The correctness of obtained mtDNA sequences were examined visually in Chromas Lite 2.1 software and then alignment of these sequences were performed against highly similar DNA sequences in NCBI nucleotide databases using BLAST in order to identify origin of unknown mtDNA sequences. With the help of sequencing and phylogenetic studies specificity of the universal primer set confirmed and presented as a novel metabarcode (16SrRNA) for species level identification of large number of Avian species
In summary, we present universal method for species classification of Aves using a targeted parallel sequencing approach. Both sequencing and phylogenetic studies experiments confirm
Summary
82
specificity of universal primer set. Although promising results were obtained with current settings, rapid improvement of bench top instruments will further develop method with less hands-on, fewer sequencing errors and lower detection limit. So, in future, this barcode can be used for species identification in various fields of study such as meat adulteration, illegal trade, food mislabeling and molecular estimation of biodiversity. Availability: Items available for loan: UVAS Library [Call number: 2617-T] (1).
58.
Monitoring Of Humoral Immune Response Of Monovalent And Combined Ppr And Fmd Serotype “O” Virus Vaccine In Small Ruminants
by Mudassar Hameed (2009-VA-386) | Dr. Jawad Nazir | DR. M. ZUBAIR SHABBIR | DR. MUHAMMAD IMRAN.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: PPR is an acute and highly contagious viral disease of small ruminants caused by morbilivirus. It causes high morbidity and mortality in small ruminants and heavy economical loses to farmers. Live attenuated vaccines are commonly used to control PPR. FMD is another highly contagious viral disease of cloven hoofed animals caused by picorna virus. Its severity is relatively high in large ruminants but carrier status of small ruminants is usually observed. In large ruminants killed FMD virus vaccines are routinely used but in small ruminants it is not practiced in Pakistan. There was need to formulate a combined vaccine containing both PPR and FMD viruses which will help to control both of the diseases in small ruminants.
.
A total of 100 goats were divided into 10 groups comprising 10 animals in each group. Each of the vaccine such as PPRV, FMDV and PPRV+FMDV was be prepared without adjuvant, gel and oil based. A total of nine types of vaccines were inoculated in the respective groups while one group remained un-inoculated negative control. Each group was subdivided into two subgroups (n=5). One subgroup was received single dose and the other inoculated with two doses of the vaccine. Serum samples from each goat were collected at 0, 1, 2, 3, 4, 5, and 6 months post vaccination (PV) and kept frozen at -20 ºC. Immune response of the vaccinated animals was monitored by measuring antibodies against PPR and FMD viruses through cELISA and VNT.
Results of the present study showed that mean percentage inhibition (MPI) value against PPR virus of non-adjuvant, gel and oil based combined (PPR+FMD) vaccines at six month post-vaccination was 83.46 ± 2.25, 80.27 ± 2.13 and 82.16 ± 1.70 respectively, whereas mean
x
neutralization antibody titer (MNA) was 4.39± 0.37, 4.06± 0.26 and 4.49 ±0.46 respectively. MPI value against FMD virus of combined (PPR+FMD) non-adjuvant, gel and oil based vaccines at six month post-vaccination was 90.17 ± 1.15, 67.22 ± 3.14 and 72.22 ± 2.04 respectively, whereas mean neutralization antibody titer (MNA) was 2.33 ± 0.27, 1.47 ± 0.10 and 1.83 ± 0.16 respectively. These MPI and MNA values showed that immune response against PPRV of combined vaccines was equivalent but non-adjuvant combined vaccine have evoked higher titer followed by oil and gel based vaccines against FMDV.
MPI values of non-adjuvant, gel and oil based monovalent PPRV vaccines at six month post-vaccination was 81.46 ± 2.22, 80.12 ± 2.13 and 81.28 ± 0.70 respectively, whereas mean neutralization antibody titer (MNA) was 4.59 ± 0.17, 4.25± 0.06 and 4.51 ±0.12 respectively.
MPI values of non-adjuvant, gel and oil based monovalent FMDV vaccines at six month post-vaccination was 00.00 ± 0.00, 82.23 ± 4.18 and 90.22 ± 0.43 respectively, whereas mean neutralization antibody titer (MNA) was 0.00 ± 0.00, 1.63 ± 0.10 and 2.99 ±0.16 respectively.
These MPI and MNA values showed that monovalent PPR vaccines induced equivalent immune response in all three formulations but monovalent FMD vaccines MPI and MNA values showed that oil based vaccine has provoked significantly higher titer followed by gel based vaccine. Whereas non-adjuvant FMD vaccine titer was diminished at one month post vaccination. Booster vaccine shots provoked higher antibody titer than single shots in all various formulations of vaccines.
The data thus obtained was analyzed through One Way ANOVA followed by Randomized Complete Block Design (RCBD). Availability: Items available for loan: UVAS Library [Call number: 2635-T] (1).
59.
Development Of Novel MtDNA Metabarcodes For Species Differentiation Of Class Reptilia
by Imran Tariq (2014-VA-505) | Dr. Muhammad Imran | Dr. Wasim Shehzad | Dr. Saadat Ali.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The FoImer COI: mtDNA. universal primers that are considered standard for DNA barcoding of life contain so many =matches against the target sequences of vertebrate men tat they often end in failure to amplify many of vertebrate DNA eurections. This disaepancy fawn foe the seaman and designing of new metabarcode panes that can be used m ideally all inditdrals of vertebrees or at least all individuals represented in a class of Vertebrate such as Cass Reprilia. The current study was embadang on such an endeavor
The proposed study was develop new m5DNA membarc ode that may be used as universal Kilns; to amplify almost all species of Class Repalia for different formic and molectdr biodivesity analyses.
Blood and tissue samples were collected from Class Repdha (at :east 24 species from every ceder reported to be present in Pakistan) DNA was extracted from the collected specimen through stacdasd organic method. qualified and =meted and then PCR-amplified using novel universal primers selected from aligned =DNA sequences origtadng from all repdlian mitochondria DNA pnomes submitted to diens online sequence databases such as NCB: micleotide database. Tne sensitiviry. of PCR was assessed using a range of DNA come:madam. The amplified products were sequenced on A131 Genetic Analyzed following Sarge's dideacy method of sequencing.
The correctness of obtained croDNA sequences were examined visually in Chromes Lite 2.1 software and then alipmmt of these sequences were per: waxed agitinc highly similar DNA sequences in NCBI nu6eonde databases using BLAST in order to identify the coigin of la-noun =DNA sequences
sequencing everimeas and phyla...net< studies was confirm the specificity of the universal primer set developed and present a novel metabarcode for species level identification of large number of reptelian species. So, In future this barcode can be used for species identification in various fields of study such as illegal trade and molecular estimation of boidiversity.
Availability: Items available for loan: UVAS Library [Call number: 2628-T] (1).
60.
Prevalence And Chemotherapy Of Bovine Anaplasmosis In District Mirpur Azad Jammu And Kashmir
by Ayyaz Shakar (2014-VA-1119) | Dr. Muhammad Hassan Saleem | Dr. Imtiaz Ahmad | Dr. Muhammad Ijaz | Dr. Muhammad Imran Rashid.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Anaplasmosis of livestock is mostly confined to tropical and subtropical countries like Pakistan, where climatic conditions are suitable for growth and development of many vectors as ticks. Piroplasms belongs to this complex and affects both large and small ruminants with high morbidity and mortality rates resulting in heavy economic losses and thus poses a serious risk to livestock production. A total of 200 blood samples of bovine, cattle (n=100) and buffalo (n=100) showing the signs of fever, progressive anemia, a marked decline in body weight, depression and debility from district Mirpur AJK were included in the study. The diagnosis was made through thin blood smear examination. The overall prevalence was found 15.00% in both species of animals. The prevalence in cattle and buffaloes revealed 22% and 08% respectively. The results showed significant difference (P<0.05) in prevalence between cattle and buffaloes. The gender wise prevalence of the disease revealed 12.12% in male and 26.87% in female cattle whereas; these values were 6.45% in male and 8.70% in female buffaloes. Chi-square analysis showed significant difference (P<0.05) between male and female animals in the area. The data on breed wise prevalence of anaplasmosis showed highest prevalence in exotic breeds (28.00%) followed by cross breed cattle (24.44%) and native breed (16.67%) of AJK. The prevalence was 5.71% in Kunddi breed of buffalo and 9.23% in Nili Ravi buffaloes. Chi-square analysis showed significant difference (P<0.05) between breeds of animals. Three different age groups of cattle and buffaloes were analyzed for the prevalence percentage of anaplasmosis in the area. The data showed highest prevalence (35.48%) in 1-3 year age group of animals followed by 18.92% in 3-5 year and 12.50% in age group 5-7 year in case of cattle and 14.29%, 6.67% and 5.88% in buffaloes respectively. the analysis of the data revealed a significant difference (P<0.05) among different age groups. The values of hemoglobin percent, packed cell volume and total
Summery
40
erythrocyte count were found increased significantly (P<0.05) in cattle and buffaloes infected with anaplasmosis whereas; total leukocyte count was decreased significantly. The parameters were tested through student’s T-test. The analysis showed significant difference of values of all parameters in normal and infected animals. The chemotherapeutic trials were conducted with two drugs against bovine anaplasmosis in clinically diagnosed cases. Twelve positive cases of each cattle and buffaloes were divided into two main groups A and B comprising of 06 animals in each group. Each group was further divided into two sub groups comprising of 03 animals in each sub groups. The group A was treated with Oxytetracycline @ 20 mg/kg B.W. I/M the efficacy of the drug was evaluated on the basis of disappearance of Anaplasma in the blood smear. The efficacy percentage of Oxytetracycline was 33.3, 33.3, 66.7, and 100 at 2nd, 4th, 6th and 8th day respectively post treatment in cattle whereas; 0.00, 33.3, 33.3 and 66.7 respectively in buffaloes. The group B was treated with Calotropis procera (Aak) at the dose rate of 0.3 mg/kg body weight orally. The efficacy percentage of Calotropis procera (Aak) was 0.00, 33.3, 66.7, and 66.7 at 2nd, 4th, 6th and 8th day respectively post treatment in cattle whereas; 0.00, 0.00, 0.00 and 33.3 respectively in buffaloes. The efficacy of Oxytetracycline against bovine anaplasmosis on day 08 was found 83.33% whereas; of Calotropis procera was 66.66%. It was concluded that Oxytetracycline is the most effective drug against bovine anaplasmosis. Availability: Items available for loan: UVAS Library [Call number: 2665-T] (1).
61.
Case Control Study Of Brucellosis And Its Associated Risk Factors At Commercial Dairy Farms
by Amna Riaz (2008-VA-257) | Prof. Dr. Mansur Ud Din Ahmad | Dr. Mamoona Chaudhry | Dr. Muhammad Imran Rashid.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Brucellosis, is a febrile, zoonotic disease caused by bacteria of genus Brucella. It is a second most important zoonotic disease after rabies. (WHO, OIE, FAO). Brucella is gram negative, aerobic, non-spore forming and non-motile coccobacilli. (Gull and Khan, 2007).The main signs are abortion after fifth month of pregnancy, still births, birth of weak calves, infertility, placentitis in females and in male’s epididymitis and orchitis. Due to its zoonotic nature farm labors, butchers, veterinarians and slaughter house workers are at high risk. Signs in human brucellosis are highly variable i.e., flu, rising and falling of temperature and causes many other complications in the body. (Baba et al.2001; Grillo et al. 2006; Shimol et al. 2012). Standard tests for brucellosis are Rose Bengal Precipitation Test (RBPT), Serum Agglutination Test (SAT) and Complement Fixation Test (CFT) (Memish et al, 2002). Its control is very difficult due to its variable incubation period, long survival time in both extracellular and intracellular environments, asymptomatic stages and resistant to the treatment, co-mingling, increasing population size and nomadism (Rahman et al. 2006).
The case study was conducted on the commercial dairy farms situated in the catchment area of University Diagnostic Laboratory, UVAS Lahore which were located Lahore, Kasur and Sheikhupura districts in Punjab. The data about positive and negative farms was obtained from university diagnostic lab, UVAS, Lahore. A predesigned questionnaire was filled from that farm workers in face to face interview. The sample size was calculated by the formula given by Schlesselman, 1982. The parameters for calculation of the sample size were power of study kept at 80% with 95% confidence interval. Total 90 samples were included (cases= 45, controls=45). Data was analyzed using chi-square. All statistical tests were performed at the significance level of 0.05.
In this study, absence of the calving pens at the farm, feeding and water practices, presence of streams and lakes near the farm and breeding practices show the strong association with this disease,by controlling the above factors and improving management at the farm can low the occurrence and spread of the disease in animals.
Availability: Items available for loan: UVAS Library [Call number: 2664-T] (1).
62.
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice
by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr.
SUMMARY
132
Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited
SUMMARY
133
elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).
63.
Affect Of Temperature, Cell Density And Multiplicity Of Infection On Biological Titer Of FMDV Type “O”
by Qazi Ithram Ul Haq (2009-VA-104) | Dr. Imran Altaf | Prof. Dr. Aftab Ahmad Anjum | Dr. Muhammad Imran.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: FMD is a transmissible viral disease of animals. It is causing very highly economical loses in Pakistan and all over the world. Through vaccination FMD is being controlled in Pakistan. Inactivated virus is used in vaccines. FMD virus grows on BHK-21 cell lines. FMDV show good adoptability on these cell lines. For good and high titer FMDV needs few physical factors to grow on BHK-21 cell lines. These factors include Temperature, Cell density and Multiplicity of infection (MOI)was considered in this research. The FMDV strain “O” was grown on BHK-21 cell line. The cells monolayer was propagated for conduction of effect of these factors on the virus. The mentioned factors were studied to get optimum level of virus titer in in vitro cell lines. The effect of 35°C, 37°C and 39°C was evaluated on the virus growth. Maximum virus propagation was noted at optimum temperature 37°C. The viral concentration at 37°C was significantly (P<0.05) higher than at 35°C and 39°C. The effect of cell density was studied on the virus concentration. Flask of three different densities 25cm2, 175cm2 and 275cm2were utilized in the current study. The virus concentration in all three different densities was not significantly different (P>0.05) from each other. Another factor Multiplicity of infection (MOI)was investigated in the study. Five different volumes 10ul, 20ul, 30ul, 40ul and 50ul of the FMDV strain “O” were used to investigate the effect of factor on the virus concentration. The results revealed highest viral harvest concretion at 50ul volume with MOI of 7.1, %age of cells infected with single virus and 6.3 × 1079. The MOI at 50ul was significantly higher (P<0.05) than the other four concentration of the virus. It was concluded from the study that the optimum temperature for the maximum FMDV concentration harvest is 37°C. The density of cell has no significant effect on the growth of virus that is flask of any density may be used to grow the FMDV. Multiplicity of infection (MOI) of 14.2 give maximum
SUMMARY
34
TCID50 Optimizing the conditions for the cell culture and virus cultivation helps in maximum virus harvest achievement. From the present study it may be suggested that the physical factors may be optimized for the remaining strains of FMD and other vaccine viruses to attain maximum virus grow. Availability: Items available for loan: UVAS Library [Call number: 2681-T] (1).
64.
Anthelmintic Activity Of Withania Coagulans Against Gastrointestinal Nematode Of Sheep In District Killa Saifullah, Baluchistan
by Yousaf Gul (2009-VA-145) | Dr. Muhammad Lateef | Dr. Saadullah Jan | Dr. Muhammad Imran Rashid | Dr. Wasim Shehzad.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Evaluation of anthelmintic activity of Withania coagulans was studied against GIT nematodes of sheep in district Killa Saifullah Baluchistan. Sheep of the district were screen out for the presence of GIT nematodes. Animal positive for GIT nematodes and having 150+ Egg per Gram (EPG) of feces was included in the drug trial. Animals were treated with extract(s) of locally available herbal plant (withania coagulans) and levamisole. Two types of plant formulations that is crude powder and crude methanole extract were prepared each with various dosages. The effect of both medicinal plant and levamisole was observed on different groups of animals and the results were analyzed with appropriate statistical tool. Eighty animals were randomly divided in to eight groups (10 animals in each group) i.e. A, B1, B2, B3, C1, C2, C3 and D. Animals in group A served as control untreated group. Animals in groups B1, B2 and B3 were treated with crude powder of Withania coagulans at the dose rate of 1, 2 and 3 g/kg body weight respectively. And Animals in groups C1, C2 and C3 were treated with crude methanol extract of Withania coagulans at 33.3, 66.6 and 100mg/kg equivalent dose rate of 1, 2 and 3 g/kg body weight respectively. Animals in group D were given Levamisole at the standard dose rate of 7.5 mg/ kg body weight. Data was analyzed by using SPSS version 20.0; comparative analysis was done by applying ANOVA. P value <0.05 was taken as significant. The analyzed data and the results revealed that Levamisole is still a better anthelmintic against ovine nematodes in district Killa Saifullah Balochistan. Efficacy of levamisole tested for 15 days in-vivo sheep was up to 92%. This efficacy was much higher than the various forms and dosages of medicinal plant. The efficacy of Levamisole was significantly higher (P<0.05) than all forms and dosages of medicinal plant. Group C3 treated with crude methanol extract of Withania coagulans at the dose rate of 10mg/kg equivalent to 3mg/kg showed highest efficacy of the plant that is up to 48%. The efficacy showed by the form of the medicinal plant used in group C3 against ovine GIT nematodes was significantly higher (P<0.05) than all other forms of the plant. Animals in group B1, B2, B3, C1 and C2 showed anthelmintic efficacy of 19.47%, 23.58%, 31.66%, 31.76% and 33.33% from day 0 to day 15th post-treatment. Gastrointenstinal nematodes of sheep have produced anthelmintic resistance against Levamisole at the dose rate of 7.5mg/kg. In previous studies Levamisole had showed efficacy of 99.99%, 99% and 98%. It is therefore recommended that further investigation on huge scale should be passed out concerning a great number of animals, quantities higher than those used in the present study, documentation of active principles, and calibration of dose and toxicity studies for drug development from the herbal plant.
Availability: Items available for loan: UVAS Library [Call number: 2688-T] (1).
65.
Effect Of Microencapsulated Butyric Acid Supplementation On Growth Performance, Ileal Digestibility Of Protein, Gut Health And Immunity In Broilers
by Muhammad Imran (2009-VA-417) | Dr. Saeed Ahmed | Dr. Yasir Allah Ditta | Dr. shahid Mehmood.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: In Pakistan poultry industry is well established and organized sector of agriculture, with more than 200 billion rupees investment among the largest industries and claimed largest industry in Pakistan . The need of the recent poultry industry are high levels of production and efficient feed conversion ,which to a certain extent could be attained by the consumption of specific feed additives like (OA). One of the effective feed additive in poultry ration is Butyric acid escepecialy encapsulated butyric acid because coated have extended release at target site .Microencapsulated butyric is tool to improve Growth performance and gut health in broilers . TheBA is a readily available energy source for intestinal epithelial cells and stimulates their differentiation and multiplication consequently it improves broilers performance.The biological trial was conducted at Research and development Farm Sharif Feed Mills (Pvt) Ltd, Okara for the duration of 35 days. In total, 336 1-day-old broiler chicks were procured from a commercial hatchery and randomly assigned to 12 floor pens on a concrete floor with rice husk as a bedding material. Four dietary treatments containing microencapsulated butyric acid (0.00, 0.25, 0.35 & 0.45g/kg × three replicate pens each having 28 chicks). There was one feeding trough and six water nipples in each pen. On 7th day of the experiment, feeding troughs were replaced with a round bottom feeder. All standard management practices were followed through the trial. Birds were vaccinated according to prescribed schedule. Weekly body weight and feed intake was recorded to calculate the weekly body weight gain and feed conversion ratio. At the end of experiment, two birds were randomly picked from each pen and slaughtered for the collection of serum in evacuated tube, duodenal samples and ileal digesta. These duodenal samples preserved in 10% formalin for tissue processing and Ileal digesta samples stored at -20C for AIA and CP.The collected data were analyzed through completely randomizes design (CRD) under one way ANOVA technique. Means were separated through Duncan’s Multiple Range test with the help of SAS 9.1.3.in conclusion we can say that Addition of microencapsulated butyric acid in broilers diet improved body weight gain, feed conversion ratio, gut health and apparent ileal digestibility of protein but no significant effect was observed on antibody titer against Newcastle disease.
Suggestion and recommendation
Further research is needed to evaluate the protected butyric acid on enzyme secretion and starch utilization, along with other nutrient digestibility in broilers
Availability: Items available for loan: UVAS Library [Call number: 2763-T] (1).
66.
Phylogenetic Analysis And Gis Mapping Of Boophilus Species Of Ticks Of Bovine And Buffalo Of District Peshawar
by Zulfiqar Ahmad (2015-VA-11) | Dr. Muhammad Imran Rashid | Dr. Muhammad Oneeb | Dr. Mamoona Chaudhry.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: Livestock is playing a major role in the uplift of our national economy in terms of revenue from milk, meat and hides. In spite of this major contribution this sector is facing hurdles in its development. The infectious diseases and their vectors have occupied a mainstay in posing the uplift of this sector. Boophilus is an important biological vector for various protozoan and bacterial infections in animal as well as human. To date the identification of these ticks mainly rely on the morphological basis which have many variations among different identification keys. To make the identification more accurate at species level, the use of molecular tools is very necessary. Ticks were collected from the various areas of district Peshawar through random convenient sampling method. Briefly, 50 cattle and 50 buffaloes were sampled through forceps. Various ticks spp. were stored in 70% ethanol for further processing. Among the species Rhepicephalus microplus (Boophilus microplus) was the most prevalent specie (25.64103%) followed by Rhepicephalus annulatus (5.413105%) Rhipicephalus decloratus (5.128205%) Rhipicephalus distinctus (4.273504%), Rhipicephalus arnoldi (3.988604%), Rhipicephalus evertsi (5.698006%), while in Heamaphysalis species Heamaphysalis aciculifer highly prevalent (5.128205%) followed by Haemaphysalis parmata (4.843305%), Haemaphysalis excavatum (3.988604%) and Haemaphysalis houyi (3.988604%), so far Hyalomma species is concerned includes Hyalomma anatolicum (3.988604%), Hyalomma trancatum (4.843305%), Hyalomma detritium (5.982906%), Hyalomma egyptium (4.273504%), Hyalomma impeltatum (0.854701%) Hyalomma rufipes (1.709402%), Amblyomma pomposum (4.273504%), Dermacentor rhinocerinus (2.849003%), D. circumguttatus (3.703704%), and
Summary
44
Dermacentor marginatus (2.564103%) are highly prevalent in cattle. Among the buffalo, Rhipicephalus 173 (43.25 %) followed by Haemaphysalis 82 (20.5 %), Hyalomma 54 (13.5 %), Dermacentor 26 (6.5 %) and Amblyomma 9 (2.25 %). The species prevalent in Rhipicephalus are Rhipicephalus microplus 74 (42.78%), Rhipicephalus annulatus 15 (8.68%), Rhipicephalus decloratus 19 (10.99%), Rhipicephalus distinctus 14 (8.10%), Rhipicephalus arnoldi 16 (9.25%), Rhipicephalus evertsi 17 (9.84%) and Rhipicephalus kochi 18 (10.40%) followed by Haemaphysalis aciculifer 18 (21.96%), Haemaphysalis parmata 15 (18.30%), Haemaphysalis excavatum 23 (28.05%), and Haemaphysalis houyi 26 (31.70%), so far Hyalomma species is concerned, Hyalomma anatolicum 10 (18.52%), Hyalomma tranctum 7 (12.96%), Hyalomma detritium 9 (16.67%), Hyalomma egyptium 7 (12.96%), Hyalomma impeltatum 10 (18.52%), and Hyalomma rufipes 11 (20.37%) and Dermacentor rhinocerinus 9 (34.62%), followed by Dermacentor circumgutattus 8 (30.76%) and Dermacentor marginatus 9 (34.62%) and Amblyomma is concerned Amblyomma pomposum 9 (2.25%). DNA was extracted from the Rhipicephalus (Boophilus) ticks through phenol-chloroform method. The extracted product was then run by gel stained ethidium bromide. The gel was visualized and examined bands on UV illuminator. Different sequences were retrived from database and genus specific primer were designed for the amplification of ITS-2 gene of Rhipicephalus genus of hard ticks. A consensus sequence was retrieved, a set of primers were designed by using Bioedit softwere version 7.2.6. DNA was extracted from 100 ticks and then run by PCR. Specific primers were designed for ITS2 gene. Phylogenetic tree based on the DNA sequences amplified from extracted from all the comparison with ticks and determined Genus Rhipicephalus area that are ITS2 Rhipicephalus ITS2 ribosomal RNA gene sequence 18s, thus obtained from Genebank. Availability: Items available for loan: UVAS Library [Call number: 2848-T] (1).
67.
Molecular Characterization of Carbapenem Resistant Pseudomonas Aeruginosa Isolated from a Tertiary Case Hospital in Lahore
by Sarfraz Hussain (2015-VA-1326) | Dr. Muhammad Imran Najeeb | Prof. Dr. Aftab Ahmed Anjum | Dr. Muhammad Wasim.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: Empty CD. Availability: Items available for loan: UVAS Library [Call number: 2834-T] (1).
68.
Exploration Of Genetic Polymorphisms And Differential Expression Analysis Of Bovine Alpha-Lactalbumin And Osteopontin Genes Involved In Milk Composition
by Sidra Manzoor (2010-VA-92) | Dr. Asif Nadeem | Muhammad Imran | Dr. Abu Saeed Hashmi.
Material type: Publisher: 2017Dissertation note: Economically important traits of dairy animals are usually controlled by a large number of genes. The identification of the single nucleotide polymorphisms in potential genes has been associated with economically important traits. During lactation, mammary epithelial cells produced large amounts of specific milk proteins. Due to the expression sites, physiological properties and chromosomal localization, LALBA and SPP1 genes might be considered as candidate genes for milk composition in buffalo. Alpha-lactalbumin (LALBA) gene has been reported to be highly transcribed in transition and peak phase while late lactation exhibited its decline with progressive rise in SPP1 expression. This project was designed to investigate the effect of single nucleotide polymorphism that influencing the gene expression thus modulates the milk protein content in Nili Ravi. Samples of unrelated Nili-Ravi buffalo were collected from two Government, Buffalo Research Institute, Pattoki, and Livestock Production and Research Institute (LPRI) Bahadarnagar Okara, livestock farms. Milk samples were collected at 15, 90 and 250 days lactation for expression analysis. The genomic DNA was extracted by using the standard Phenol Chloroform Isoamyl alcohol (PCI) protocol. Specific set of primers was designed for the amplification of the LALBA and SPP1 genes. The amplified PCR products were sequenced for the identification of SNPs. To determine the differential expression of bovine LALBA and SPP1 genes, RNA was isolated from milk samples using the TRIzol reagent and converted it into cDNA. Taqman probes were used that are specifically designed to detect and target the DNA sequence. Five intronic polym orphic sites were identified in LALBA while exonic regions exhibited a complete homology with reference sequence. Additionally, eleven polymorphisms were identified in bovine SPP1 gene, six were in coding region and five were
Summary
122
found in intronic portion of the gene. The analysis and correlation of all identified polymorphism was done by using SNPs data analysis software “SNPator”. Results obtained from expression study was stored in in-build software of Real Time PCR and Cycle threshold (Ct) values of LALBA and SPP1 mRNA were compared in individuals of Nili-Ravi buffalo to determine the variation in expression levels. The LALBA gene expression was observed highest in transition phase with a gradual decrease of expression in mid and late lactation. The sample, NR-5, was observed highly expressed (79.30) while NR-2 with low expression (19.28) for alpha lactalbumin in early lactation. The change in LALBA regulation at same stage was considered due to genetic variation of the respective animal. While the SPP1 gene expression was observed with the highest values in peak lactation and remains elevated in late lactation. NR-4 has the highest (72.27) expression among all mastitis free healthy animals while NR-2 was observed with low expression. Thus, the identified SNPs might be used as genetic marker for milk production traits. Gene expression patterns may also help us to understand the molecular mechanisms of bovine LALBA and SPP1 genes influencing milk composition. However, the expression of both genes was considered in a correlation with other genes involved in milk production pathway. Also, the mutational effects of other milk proteins might be involved in determining the expression pattern of both genes in selected animals. Therefore, further studies are likely to explore the regulation of milk protein genes and their translational efficiency during the course of lactation in dairy animals. Availability: Items available for loan: UVAS Library [Call number: 2830-T] (1).
69.
Development Of Novel Mtdna Metabarcodes For The Species Differentiation Of Class Amphibia
by Rehmatullah (2011-VA-365) | Dr. Muhammad Imran | Dr. M. Yasir Zahoor | Dr. Amjad Riaz.
Material type: Publisher: 2017Dissertation note: The Folmer COI mtDNA universal primers that are considered standard for DNA
barcoding of life contain so many mismatches against the target sequences of vertebrate origin
that they often end in failure to amplify many of vertebrate DNA extractions. This discrepancy
favors for the selection and designing of new metabarcode primers that can be used to identify all
individuals of vertebrates or at least all individuals represented in a class of Vertebrata such as
Class Amphibia. The current study embarks on such an endeavor. In this study development of
new mtDNA metabarcode (16SrRNA) that can be used as universal primers to amplify almost all
species of Class Amphibia for different forensic and molecular biodiversity analyses.
Tissue samples were collected from order Urodela of Class Amphibia (Toads , Bull frog
and skittering frogs sample were collected from Punjab, Pakistan). DNA was extracted from the
collected specimens through standard organic method, qualified and quantified and then PCRamplified
using novel universal primers selected from aligned mtDNA sequences originating
from order Urodela mitochondrial DNA genomes submitted to different online sequence
databases such as NCBI nucleotide database. The sensitivity of PCR also be assessed using a
range of DNA concentrations. The amplified products were sequenced on ABI Genetic Analyzer
following Sanger’s dideoxy method of sequencing. The correctness of obtained mtDNA
sequences were examined visually in Chromas Lite 2.1 software and then alignment of these
sequences were performed against highly similar DNA sequences in NCBI nucleotide databases
using BLAST in order to identify origin of unknown mtDNA sequences. With the help of
sequencing and phylogenetic studies specificity of the universal primer set confirmed and
Summary
67
presented as a novel metabarcode (16SrRNA) for species level identification of large number of
Amphibian species.
In summary, we present universal method for species classification of Amphibia using a targeted
parallel sequencing approach. Both sequencing and phylogenetic studies experiments confirm
specificity of universal primer set. Although promising results were obtained with current
settings, rapid improvement of bench top instruments will further develop method with less
hands-on, fewer sequencing errors and lower detection limit. So, in future, this barcode can be
used for species identification in various fields of study such as meat adulteration, illegal trade,
food mislabeling and molecular estimation of biodiversity. Availability: Items available for loan: UVAS Library [Call number: 2874-T] (1).
70.
Molecular Diagnosis Of Brucella Zoonosis As Blood Transfusion Hazard In Metropolitan Population Of Lahore And Okara
by Amna Azam (2011-Va-3560 | Dr. Wasim Shehzad | Dr. Iahtasham Khan | Dr. Muhammad Imran | Dr. Imran Rashid.
Material type: Publisher: 2017Dissertation note: Brucellosis and Coxiellosis are one of the most spreading zoonotic diseases. They both are facultative, intracellular, Gram negative and involved in bioterrorism and agro-terrorism attacks. Brucella abortus and Brucella melitensisare common among all specie of Brucella. Total two hundred Human Blood transfusion samples were collected from hospitals of Okara and Lahore. Blood was collected in vacutainers (without EDTA). After serum isolation serological test RBPT were performed of all samples. Eighty nine out of two hundred were positive to RBPT with seroprevalence of 44.5% (95% Confidence Interval [CI]: 37.61 – 51.4). DNA extraction was done. The concentration of DNA was analyzed through Nanodrop 2000. Then these samples were subjected to Genus specific Real-time PCR analysis. Forty one out of two hundred were positive to Genus specific Real-time PCR with seroprevalence of 20.5% (95% Confidence Interval [CI]: 14.9 – 26.09). Brucella genus positive samples were subjected to two species specific PCR Brucella abortus and Brucella melitensis respectively. Forty one out of forty one Brucella genuspositive samples were positive to Brucella melitensisand none of the sample was positive to Brucella abortus. These two hundred DNA samples were then subjected to Coxiella specific Real-time PCR analysis and 4 were found positive with seroprevalence of 2% (95% Confidence Interval [CI]: 0.06 – 3.94). Results were recorded in the form of Ctvalue. Results indicate that Real-time PCR is more efficient than RBPT and due to increasing seroprevalence in Blood transfusion samples its screening should be included in normal blood transfusion screening procedure through collaboration with Government to prevent transfusion transmitted infections (TTI’s). Availability: Items available for loan: UVAS Library [Call number: 2873-T] (1).
71.
Evaluation Of The Canned/Packed Fruit Juices From Local And Imported Origin For Their Heavy Metalcontents
by Nazeefa Fatima (2015-VA-14) | Dr.Saifur Rehmankashif | Muhammad Imran Najeeb | Dr. Fariha Arooj.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note:
The increased pollution has affected the quality of soil, air and water resulting in the contamination of food and causing serious problems to human health in all over the world. For example the intake of trace heavy metals in excess quantities by the consumption of contaminated food grown in polluted soil or by polluted water. Fruits and their juices are the part and parcel of the daily human lives. And these are one of the affected by the heavy metal toxicity. This study presents how much amount of heavy metals are present in commercially available fruit juices and not been safe for human use.
Purposeofstudywastoestimatethepresenceofheavymetalscontaminantsincommercially available fruit juice samples oflocalmarketsofLahoreandcomparethevaluesofthemwithstandard valuesrecommendedby WHO andevaluatethetoxiclevelofthem.Di-acid digestionmethodwasappliedtodetecttheheavy metalsandmineralsin commercially available fruit juices.After this,by usingatomicabsorption,spectrophotometerheavy metalswere determined.Finally,byusing statisticalanalysisANOVA SPSSSoftware wasconcludedthe results.Oneway ANOVAwasappliedinpresentstudy.
The presentresultsshowedthatthe concentrationofMn, Cr, Fe, Cu, Ni and Pb incommercial juice sampleswasfoundabovethepermissiblelimit in all the areas of Lahore.TheconcentrationofZinc inwasbelowthepermissiblelimit. So after the investigation it is concluded that commercial juices in Lahore is polluted. Availability: Items available for loan: UVAS Library [Call number: 2888-T] (1).
72.
Evaluation of Heavy Metals in Wasted Electronic Items and Their Potential Environmental Threats
by Mehwish Inam (2015-VA-06) | Dr. Saif Ur Rehman Kashif | Dr. Fareeha Arooj | Muhammad Imran Najeeb.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: CD Corrupt. Availability: Items available for loan: UVAS Library [Call number: 2909-T] (1).
73.
Development Of Novel MTDNA Metbarcodes For Species Differentiation Of Class Pisces
by Hira (2010-VA-476) | Dr. Muhammad Imran | Dr. Saadat Ali | Dr. Amjad Riaz.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: The Folmer COI mtDNA universal primers that are considered standard for DNA barcoding of life contain so many mismatches against the target sequences of vertebrate origin that they often end in failure to amplify many of vertebrate DNA extractions. This discrepancy favors for the selection and designing of new metabarcode primers that can be used to identify all individuals of vertebrates or at least all individuals represented in a class of Vertebrata such as Class Pisces. The current study embarks on such an endeavor. In this study development of new mtDNA metabarcode (16SrRNA) that can be used as universal primers to amplify almost all species of Class Aves for different forensic and molecular biodiversity analyses.
Fins/tissue samples were collected from Class Pisces (one specimen from every order reported to be present in Pakistan). DNA was extracted from the collected specimens through standard organic method, qualified and quantified and then PCR-amplified using novel universal primers selected from aligned mtDNA sequences originating from all Pisces mitochondrial DNA genomes submitted to different online sequence databases such as NCBI nucleotide database. The sensitivity of PCR also be assessed using a range of DNA concentrations. The amplified products were sequenced on ABI Genetic Analyzer following Sanger’s dideoxy method of sequencing. The correctness of obtained mtDNA sequences were examined visually in Chromas Lite 2.1 software and then alignment of these sequences were performed against highly similar DNA sequences in NCBI nucleotide databases using BLAST in order to identify origin of unknown mtDNA sequences. With the help of sequencing and phylogenetic studies specificity of the universal primer set confirmed and presented as a novel metabarcode (16SrRNA) for species level identification of large number of Piscean species
In summary, we present universal method for species classification of Pisces using a targeted parallel sequencing approach. Both sequencing and phylogenetic studies experiments confirm specificity of universal primer set. Although promising results were obtained with current settings, rapid improvement of bench top instruments will further develop method with less hands-on, fewer sequencing errors and lower detection limit. So, in future, this barcode can be used for species identification in various fields of study such as meat adulteration, illegal trade, food mislabeling and molecular estimation of biodiversity.
Availability: Items available for loan: UVAS Library [Call number: 2899-T] (1).
74.
A Study Of Chicken Gut To Determine The Colonization Of Bacillus Licheniformis And Changes In The Histological Features
by Arooj Tahir (2015-VA-812) | Mr. Shahid Abbas | Dr. Muhammad Imran | Dr. Saif-ur-Rehman Kashif.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: The most important and commonly used source of animal protein in the whole world these days is poultry meat. With the increase in the world population the demand of poultry meat
is also increasing. Universally, for the treatment of infected chicken and for growth promotion,
antibiotic growth promoters are used. But the extensive and long term use of AGPs for growth
promotion and infection treatments has resulted in the survival of resistant bacterial strains that
poses a very drastic threat to both animal and human health. Because of these radical results,
some of the countries have restricted the use of AGP in poultry and are moved on towards the
use of probitics as growth promoters. The most commonly used strain for probiotics is from
genus Bacillus as they have the tendency to survive even in the harsh and industrial conditions.
Bacillus subtilis, Bacillus licheniformis and Bacillus pumilusare are the ones that are involved in
the spoilage of food and certain medical conditions.
In this study, we considered the effects of probiotics as an alternative of AGP in poultry.
Bacillus spp. can be used as probiotics, as they can efficiently colonize in the small intestine and
improve the growth enhancement in broilers. A selective strain of bacteria Bacillus licheniformis
was used as a probiotic for the broiler chicken. After 42 days, 15 birds from three different
groups were collected, 5 from each group, and slaughtered to collect cecum samples and
intestinal tissue samples. The samples were processed for DNA extraction, PCR and histological
methods to determine the probiotics colonization and growth differences between the normal
ones and the treated ones. There was a considerable increase in the height of the villi in the
treated ones as compared to the control ones which showed that the use probiotic helped increase
the surface area of the intestine for increased absorption. The extracted DNA from the cecum
sample was used for PCR amplification and sequencing, the results confirmed the presence of
Summary
64
Bacillus licheniformis. The results showed that the probiotic was efficiently colonized in chicken
gut and it improved the gut health and also helped chicken in gaining weight. Availability: Items available for loan: UVAS Library [Call number: 2893-T] (1).
75.
Consumer’s Awareness Of Food Safety From Shopping To Eating
by Khakshan Noor (2015-VA-1089) | Dr. Azmat Ullah Khan | Dr. Waqas Ahmed | Dr. Muhammad Imran Najeeb.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: Considerable proportions of foodborne illness arises from malpractices in purchasing food stuff. Such as serving contaminated raw food, insufficient cooking reheating of left overs, and poor hygiene practices. There are no food safety regulations for domestic kitchens hence, houshold womens as primery food handlers have to ensure food safety hygiene practices at home. The present study was an attempt to assess food safety awareness of consumers from shopping to eating in Lahore to understand its status, as there is no previous study found in this field in Lahore . A sample of 1000 consumers from 10 towns of Lahore was collected. Simple Random Sampling was used to select shopping malls and bazars with in towns and convenient sampling for selection of consumers. A KAP survey study ws conducted using a closed-ended questionaire to assess status of food safety awareness among consumers. A variable sheet was generated on SPSS version 22.0. Descriptives statistics was used to calculate mean and percentages of responces and overall knowledge, attitude and practices . Chi-Square test was used to study significant association between knowledge, attitude, practices scores and education levels. And also to study association between knowledge and practices. Mean and standard deviation scores for overall knowledge of consumers was 37.61 ± 1.087 which showed negative food safety knowledge among majority of the consumers. And overall practices mean was 54.89 ± 1.052 which showed unhygieneic food handling practices among
Summary
67
majority of the consumers. Significant difference was observed between education and KAP scores and attitude and practices of consumers. Data obtained served as baseline knowledge and information for emphasis on continues improvement on the knowledge of consumers. Food handlers who is going to prepare food probably have poor knowledge and misunderstandings about food safety and are certainly engaged in culturally focused stereotypical food handling practices. Henceforth, consumers should commit and expose themselves to attaining the prerequisite knowledge and sources of information needed in reducing the probability of potential risks that will eventually lead to progressive food safety culture development in Pakistan. It is thus advised that there is a need for surveillance and interventions at domestic level with professionals assistance for consumers regarding food safety issues. Food safety educational programs through official and casual training and media must be advertised and repeated at specific intervals. Health and educational instituations can communicate and provide short training courses to consumers of all ages, especially brginning at school since education has a bigger impact on food safety KAP in current study. They need to be informed about the basic principles of food safety at home and as well as from purchase using “Five Keys to Safer Food” as Food Safety starts and ends with frequent behaviors of consumers. This study determines that there is a need for additional research to identify the possible risks that could pose to human health in regard to food safety from purchase to home. Availability: Items available for loan: UVAS Library [Call number: 2919-T] (1).
76.
Microbiological Evaluation Of Various Vegetables At Different Processing Stages
by Ammara (2015-VA-1088) | Dr. Zubair Farooq | Dr. Azmat Ullah Khan | Dr. Muhammad Imran Najeeb.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: The current research was planned to investigate the microbial load and identification of
bacteria in fresh vegetables from different locations such as local shops and superstores. Total
108 samples were collected 9 from each place. Samples collected carefully in sterilized bags and
processed in microbiological lab of UVAS Lahore.
Fresh vegetables are an important part of our daily food and especially fresh vegetables
with less processing like lettuce, carrot and beet root which are used as raw without cooking;
such type of vegetables became the cause of illness because of the microbial/cross
contamination. It is alarming situation for suitable agency to take some necessary action, make
guidelines to prevent potential food borne illnesses from the vegetables that contain pathogenic
bacteria, and find natural antimicrobials from plants that control spoilage and pathogenic
microorganisms in vegetables. Microbial quality of vegetables is not in good condition.
The vegetable samples were divided into two categories local shops and superstores.
Total six local shops and six superstores were selected for the collection of samples in triplicate
pattern. All the samples were evaluated for microbial parameters,Like TPC, TCC, detection of
salmonella ,E coli and staphylococcus aureus.
Data was analysed statistically by the two- way ANOVA (Analysis of Variance) for
microbial count with 5% probability. Means were compared by LSD (least significant design)
test (Steel et al.1997).
The aim of present study is to provide awareness and microbial trend data about different
fresh vegetables sold in North-West Lahore.Results of current study shows that the
microbiological quality of fresh vegetables collected from superstores is better than the local
Summary
62
shops. The result of present study shows that consumers should prefer to buy vegetables from
superstores as compared to local shops because the keeping quality and handling practices are
good in superstores than local shops. Availability: Items available for loan: UVAS Library [Call number: 1918-T] (1).
77.
Larvicidal And Adulticidal Effect Of Natural Herbs Against Mosquito Population
by Anam Shahwar (2015-VA-1347) | Dr. Nisar Ahmad | Dr. Muhammad Imran Rashid | Dr. Uzma Farid Durrani .
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: Mosquitoes serve as vectors for a wide assortment of human and veterinary pathogens and cause pervasion of numerous infection. Many processes fall for the control of mosquito but the cross resistance didn’t let them successful. Plants are viewed as the natural industry of such chemicals which have promising medicinal and pesticidal properties. Ocimum basilicum regularly known as Basal and Calotropis procera which is famous as apple of Sodom has shown the insecticidal activities against mosquito. Ocimum basilicum and Calotropis procera has adulticidal and larvicidal activity against laboratory reared mosquito population. For the study plants of Calotropis procera and Ocimum basilicum has collected from Lahore city. Leaves stem and flower of Ocimum basilicum and leaves of Calotrops procera had ground after drying for their soxhelet extraction. Their methanol and aequeous extract was used against laboratory reared mosquito to check their efficacy. Serial dilutions of each plant was given to third and fourth instar larvae and three day old adult. Third and fourth instar larvae has shown complete mortality within one hour in 700ppm and 650 ppm of methanol extract of both plant whereas in water extract the concenteration were 450ppm and 500ppm. Mortality of larvae and adult mosquito has been recorded after every ten minutes for one hour and then after 24 hours. The lethal dose concentration from dose-probit model is 700ppm of and 650ppm (methanol extraction) and 450ppm and 500ppm (water extraction) of Ocimum basilicum and Calotropis procera. according The current study has checked the efficacy of indigenous plant extracts against mosquito for eco-friendly approach to control mosquito. Availability: Items available for loan: UVAS Library [Call number: 2949-T] (1).
78.
Evaluation Of Different Strategies To Improve The Dietary Nitrogen Efficiency In Lactating Dairy Cows In Pakistan
by Muhammad Imran (2005-VA-09) | Prof. Dr. Talat Naseer Pasha | Dr. Muhammad Naveed ul Haque | Dr. Muhammad Qamer Shahid.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: The objectives of this study were to optimize the protein supplies and replacement of SBM with locally available ingredients in the rations of high producing Holstein Friesian cows at mid lactation. On the basis of these objectives, three experiments were conducted. Multiparous cows in mid-lactation received three treatments in a 3×3 Latin square design with a period length of 20 d. Number of animals used were nine in 1st and 3rd experiments and 12 in 2nd experiment (Table 6.1). The trials were conducted at a corporate dairy farm. When we compare the initial and final values of milk yield, milk fat and milk protein contents, there is not a big difference of our diets with that currently being practiced in Pakistan (Table 6.1). This also reveals that the experimental milk production was close to pre-experimental milk production indicating that a successful dietary transition was achieved. Table 6.1: Demonstration of parameters before and during the experiments Exp.
Cows
No.
Initial Parameters During Experiment Parameters
DIM Milk
yield (kg)
Milk
fat (%)
Milk
protein (%)
Milk
yield (kg)
Milk fat
(%)
Milk
protein (%)
1 9 113±25 32±4.1 3.65 3.25 29.7±3.1 3.70 3.27
2 12 153±44 23.3±2.1 3.99 3.34 24.7±1.8 3.98 3.31
3 9 109±19 34±3.7 3.71 3.19 30.7±2.5 3.64 3.21
Exp., experiment; DIM, days in milk In the 1st experiment, three dietary treatments were designed to provide similar energy and increasing supply of MP (g/d)—2371 (low), 2561 (medium), and 2711 (high). Increasing the MP supplies did not modify DMI; however, it increased milk protein, fat, and lactose yield linearly. Similarly, FCM increased (9.3%) linearly due to an increase in both milk yield (5.2%) and milk fat content (7.8%). Milk nitrogen efficiency decreased from 0.26 to 0.20, whereas, the
Summary
102
metabolic efficiency of MP decreased from 0.70 to 0.60 at low to high MP supplies and it average value across the treatments was 0.64 (Table 6.2). In conclusion, increasing the MP supplies resulted in increased milk protein yield; however, a higher BUN and low MNE indicated an efficient utilization of dietary protein in low MP supplies. Milk nitrogen efficiency ranges from 20 to 30% in dairy cows at mid stage of lactation. Milk nitrogen efficiency increases slightly but linearly with the increase of dietary protein up to a certain level of supply of protein. At high protein levels of dietary protein MNE is low and vice versa. In the 2nd experiment, the response of balancing metabolizable Lys to Met ratio (3:1) in low protein diets was investigated. Three experimental diets; 1) LP−: low protein diet (13.6% CP) with imbalanced Lys to Met ratio (3.33), 2) LP+: low protein diet (13.5% CP) with balanced Lys to Met ratio (2.94) through HMBi; and 3) HP−: high protein diet (14.7% CP) without balancing Lys to Met ratio (3.39) in a 3×3 Latin square design were designed. Milk yield of LP- was 0.85 kg/d less as compared with the average milk yield of LP+ and HP-. Dry matter intake decreased by 0.7 kg/d in LP+ compared to HP- treatment whereas milk yield tended to be higher by 0.7 kg/d and protein yield by 23 g/d. Balancing the Lys to Met ratio by supplementing HMBi through feed increased feed, N, and MP conversion efficiencies to milk by 4.4, 1.6, and 13.1% respectively compared to the HP- diet. Similarly, 4% FCM was increased by 4.4% in LP+ diet as compared to HP- diet. Moreover, plasma urea concentration was numerically less in LP+ compared to LP- and HP- treatments whereas no effect was observed on plasma glucose and TG concentrations. In the 3rd experiment, three diets 1) Control: with low protein with SMB as a protein source, 2) SBMD: high protein diet with SBM as a major protein source and 3) CGMD: high
Summary
103
protein diet with CGM as a major protein source. Increasing the protein supplies did not affect DMI, milk fat yield, and milk fat and lactose contents in SBMD and CGMD diets compared to the control diet. Similarly, MP balance and MP/NEL increased by 31.5 and 9.1%, respectively. Increasing the protein supplies tended to increase milk yield. Similarly, milk protein and lactose yield increased by 3.5 and 3.3%, respectively. Milk protein contents tended to increase by 1.5% in SBMD and CGMD treatments compared to the control. Increasing the dietary protein supplies increased FE in SBMD and CGMD treatments compared to control, whereas, MNE decreased by 10.9%. No effect was observed on DM, N and NEL intakes when SBM was partially replaced with CGM. Consequently, milk yield, milk components’ yield, milk composition and feed efficiency remained unaffected. Contrary to this, MNE decreased by 5% in CGM treatment compared to SBM. There were no dietary treatment effects on blood metabolites including BUN, glucose and TG concentrations, which means neither replacement of SBM nor concentration of protein in the diet affected the blood metabolites profile. There was no change in lactation performance of cows by the partial replacement of SBM with CGM. Therefore, SMB could be partially replaced with CGM with urea without affecting animal performance, and saving the feed cost. Table 6.2: Effects of experimental diets on different parameters Exp.
MP
efficiencies
Δ MP
efficiencies (%)
Δ MY
(kg)
Δ DMI
(kg)
Δ milk
fat (%)
Δ milk
protein (%)
1 0.64 14.3 5.20 0.10 7.80 5.30
2 0.65 11.6 1.20 0.70 3.93 1.50
3 0.68 9.85 1.10 0.20 2.18 1.10
Exp., experiment; MP, metabolizable protein; MY, milk yield; DMI, dry matter intake
Summary
104
In conclusion, balancing Lys to Met ratio at low protein diets and partial replacement of SMB with CGM is a mean to improve the MNE and reduce feed costs. 6.1 Conclusion and Recommendations Diets with low MP supply result in high MNE and better utilization with low levels of BUN. Although there was less milk yield in low protein diets but utilizing efficiency was high. Low protein corn-soy-based diets supplemented with rumen protected Met (HMBi) result in increased utilization of protein and low levels of BUN. Partial replacement of SBM with CGM plus urea showed no change in DMI, milk yield. Milk nitrogen efficiency was slightly decreased in CGM diet as compared to SBM diet. Feed cost could be saved by replacing 35% SBM with CGM provided that RDP is balanced by using NPN sources. Diets should be given with possible lowest protein levels having balanced AA particularly Lys and Met, which should be 3:1. High levels of protein could result into increased emission of gases to the environment. Soybean meal replacement with CGM along with some NPN source results in similar outcomes. First strategy is the best out of three currently tested and it can save money. 6.2 Future Perspectives Studies must be conducted to investigate the effects of further lowering the dietary protein levels without affecting milk production in Holstein cows. It will help to improve the dietary N utilization for milk synthesis. The above-mentioned strategies can also be tried simultaneously for improved protein/N utilization in dairy cows. Lysine can also be tried along with Met to balance the low protein corn-soy-based diets. On the basis of RDP and RUP values, other ingredients can also be tried to partially replace SMB. Availability: Items available for loan: UVAS Library [Call number: 2920-T] (1).
79.
Bacterial Profiling And Development Of Molecular Diagnostic Assays For Detection Of Bacterial Pathogens Associated With Bovine Mastitis
by Aqeela Ashraf (2012-VA-388) | Dr. Muhammad Imran | Prof. Dr. Tahir Yaqub | Dr. Muhammad Tayyab.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: The livestock sector plays a critical role in strengthening the economy of Pakistan. Control of livestock diseases is the primary objective of government livestock departments. Bovine mastitis is among the most significant diseases of livestock as reported by various field surveys in Pakistan. Despite considerable knowledge about mastitis and its etiology, this disease is still prevalent in many dairy herds; it remains most difficult to eradicate or control. It is an inflammation of mammary gland resulting in decreased milk production, veterinary care costs and culling losses.
In animal health improvement, there is a paradigm shift from treatment of clinical illness to disease prevention. Recognition of disease is the foundation of disease control and prevention. California mastitis test and somatic cell counting are the most commonly used methods for diagnosis of bovine mastitis. These methods are unable to identify the causative agent. Detection of pathogen is critically important for better control of mastitis. Microbial culturing and biochemical tests are traditionally used methods for pathogen identification. But, these methods are very time consuming and can only detect viable bacteria from the sample and can lead to false negative results. The progress in molecular methods based on PCR has improved the veterinary diagnostics.
For the identification of bovine mastitis pathogens, an economical, rapid and sensitive molecular diagnostic assay was developed using multiplex PCR, detecting the pathogenic species-specific DNA. The target species areS. aureus,E. coli, S. uberis, S. agalactiae, S. dysagalactia, S. haemolyticus, S. epidermidis, S. chromogenes andM. bovis. Multiplex PCR assay was developed for the detection of these significantly important bacterial pathogen
causing bovine mastitis. Species specific primers were designed which have the ability to specifically amplify the particular gene in the target species. For this purpose various gene regions were selected for different bacterial species which included 16S rRNA, cpn60, phoA and rdr. Initially monoplex PCRs were optimized individually for each target species. For optimizing multiplex PCR assay, various combinations of individual PCRs with varying concentrations of primers and template DNA were used. The final protocol included all the nine sets of primer pairs, every set targeting a unique mastitic pathogen. Multiplex PCR assay was checked for its specificity and analytic sensitivity was calculated. Mastitic milk samples were collected aseptically from various farms. Initial screening was based on Surf field mastitis test and California mastitis test. Milk samples were cultured on nutrient agar, blood sheep agar and MacConkey’s agar. The bacterial isolates were identified and further sub-cultured in nutrient broth. All the isolates were identified on the basis of 16S rRNA sequencing analysis.
The developed multiplex PCR assay was used to detect the target bacterial pathogens from the collected milk samples. Limit of detection of developed assay was up to 50 pg for DNA isolated from pure cultures and 104 CFU/ml for spiked milk samples. The results obtained by 16S rRNA sequencing, bacterial culture based identification and multiplex PCR assay were compared. Sensitivity and specificity were calculated using latent class analysis, specificity was up to 88% and sensitivity was up to 98% for targeted mastitic pathogens. The developed multiplex PCR detected nine bacterial species in a single reaction. Multiplex PCR assay has also detected the bacterial pathogens in a few culture-negative mastitis milk samples. This is the first multiplex PCR assay which can efficiently detect nine important mastitic bacterial pathogens in a single reaction. The development of multiplex PCR assay is useful in early diagnosis and prevention & control of bovine mastitis.
Mycoplasma is often ignored as a major mastitis-causing pathogen due to lack of rapid and accurate diagnostic tools. In this study a LAMP assay was developed for the identification of M. bovis from clinical mastitic milk samples. LAMP primers were designed from three gene regions including uvrC, 16S rRNA and gyrB. Bacterial reference strains and mastitic milk samples positive for M. bovis were collected from Quality Milk Production Services, Cornell University, Ithaca, NY. Bacterial strains were further cultured on Hayflick medium containing 15% horse serum and incubated for up to 7 d at 37°C with CO2 enrichment. DNA was isolated from mastitic milk samples and bacterial culture using Qiagen DNeasy Blood and Tissue Kit (Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions with few modifications. PCR and LAMP assay was performed for all the samples obtained. Analytic sensitivity was calculated and the limit of detection was up to 50pg/reaction for LAMP assay which is higher as compared to PCR.
Sensitivity and specificity was calculated for each of the three tests. Cohen’s kappa values obtained were 0.940 for uvrC, 0.970 for gyrB and 0.807 for 16S rRNA. All three tests showed a high level of agreement between test results and the true mastitis status, indicated by the receiver operating characteristic (ROC) curve. A robust, sensitive and specific LAMP assay has been developed for the detection of M. bovis from mastitic milk. These novel molecular assays could be helpful for correct and timely identification of bovine mastitic pathogens, which is crucial for the control and treatment of the disease.Molecular diagnostic assayshave been developed in the current study based on multiplex PCR assay and loop-mediated isothermal amplification assay.
Availability: Items available for loan: UVAS Library [Call number: 2930-T] (1).
