Phd. Theses Subscribe to this list

| Select titles to:
A Comparative Study Of Brucellosis In Livestock And Human Beings

by Amra Akram | Muhammed Ajmal | Ata- Ur -Rehman Rizvi | Faculty of Veterinary Sciences.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 1991Dissertation note: Seroprevalence of brucellosis in 541 cattle, 708 sheep, 780 goats and 63 human beings of one farm and 189 cattle, 125 buffaloes, 68 goats and 51 human beings of the other farm was studied. The various serologic tests used for this investigation included the slide agglutination test for initial screening, and the standard tube agglutination test (SAT) and the enzyme-linked immunosorbent assay (ELIS1) for further processing of the sera i.e. quantitation of Brucella antibodies. The higher prevalence of the disease was observed in cattle than buffaloes while goats outnumbered sheep in this respect. The prevalence of the disease in human beings was found to be related positively with the prevalence of the disease in animals. The overall prevalence of the disease in sheep of one farm was found to be 35(4.947.), 27(3.817.) and 29(4.097.), respectively, by the slide agglutination, standard tube agglutination test (SPIT) and ELISA. Goats of one farm displayed a prevalence of 202(25.897.), 173(22.187.) and 183(23.467.) and that of the other, 3(4.417.), 2(2.947.) and 2(2.947.), respectively, by the slide agglutination, SPT and ELISA. This remarkable difference in the incidence of the disease in two farms may be attributed to the difference of sample size. A prevalence of 127(23.48%), 87 (16.08%) and 91(16.82%) was recorded in cattle of one farm while 30(15.877.), 19(10.057.) and 20(10.587.) cattle of the other proved positive respectively to the slide agglutination, SpiT and ELIS. In buffaloes, a prevalence of 17(13.67.) and 11(8.87.) and 11(8.97.) was noted by the slide agglutination, ST and ELISA tests, respectively. While interpreting the age-group relationship of the disease, it was found that adult and old animals had a higher prevalence than the young animals. Owing to the small number of male serum samples, the sex- based analysis of the disease could not have been adequately discussed The enzyme linked immunosorbent assay was found to be a sensitive approach in detecting anti-Brucella antibodies than the slide agglutination and standard tube agglutination tests. The ELISA titres were, on average, about 8 times higher than the corresponding SAT titres The results of this study have revealed an alarming prevalence of brucellosis in animals of farms which calls for an emergent response of experts for reappraisal and reassessment of the present brucellosis control situation, especially when the disease is an important zoonosis and a potential threat to the human health. Availability: Items available for loan: UVAS Library [Call number: 0168,T] (1). Place hold
A Metagenomic Analysis Of The Respiratory Microbiota Of Birds

by Muhammad Zubair Shabbir | Prof.Dr. Masood Rabbani | Prof. Dr. Khushi Muhammad.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2013Dissertation note: The respiratory systems of birds are susceptible to and are a reservoir for numerous bacterial species, including those of significance to public health. A number of bacteria, either as primary or secondary infectious agents, have been associated with respiratory outbreaks in poultry and subsequent losses worldwide. A key component of a poultry development policy is the proper diagnosis and control of infectious diseases, which requires substantial knowledge of the microbiome in diseased and healthy birds. Because only a small proportion (< 1%) of organisms are culturable, limited as well as highly variable and time-consuming conventional microbiological procedures have typically excluded the normal flora present in the respiratory tract or have restricted the analysis to potential pulmonary pathogens. This limitation provides only a partial representation of the airway microbiota of birds and has little potential for determining or discovering novel organisms/pathogens and their association with clinical outcomes. Using the hypervariable region of the 16S rRNA gene, culture-independent techniques such as 454-pyrosequencing, can provide species-specific sequences of any bacteria in a given clinical sample. This approach has identified a number of novel bacterial species in recent years. Based on the quality and quantity of the double-stranded gDNA, a total of 30 T-BAL samples including houbara bustard and ostrich, were collected from equal numbers of clinically diseased and healthy birds originating from flocks within different management systems, including free range, open house, and controlled house. Using 454 bar-coded pyrosequencing, the hypervariable regions of the 16S rRNA gene corresponding to V1 - V5 (~ 1,000 bp) were sequenced. Of the high-quality reads obtained (296,811) using the MOTHUR platform, the sequences were processed for sequence alignment with the 16S RDP database via BLASTn, and subsequent taxonomic analysis through MEGAN programs using a homology-based method to bin sequence reads. Almost all of the read were classified to the bacterial domain and its subsequent descendants. The birds were shown to be susceptible to a diverse microbial community belonging to a variety of phyla, families, genera, and well-characterized bacterial species. The bacterial communities were relatively conserved at the phylum level; however, at lower taxonomic levels, differences were observed in the phylotypes and abundance between the clinically diseased and healthy birds as well as between different management systems. The biodiversity and richness in the taxonomic content was higher in the clinically healthy birds compared with the diseased birds, as indicated by the rarefaction plot and the Shannon-Wiener and Simpson-Reciprocal diversity indices. Regardless of the management type, bird species, and health status, a number of new bacterial species were identified. Although the clinical importance of these bacteria as part of the respiratory microbiome of birds has not been established, a number of these bacterial species have been found to be associated with infectious diseases in humans and other species. The interactions of bacterial species with one another and, potentially, with the birds themselves provide a fascinating avenue for continued research. Further clinico-pathological studies will be needed to establish the links between causes versus effects. This information may help us gain insight into the ecological roles of these bacterial species and their potential co-evolution with birds. Availability: Items available for loan: UVAS Library [Call number: 1560,T] (1). Place hold
Alleviation Of Cyclic Heat Stress In Broilers By Dietary Supplementation Of Mannan-Oligosaccharides And Lactobacillus-based Probiotic

by Muhammad Umar Sohail | Prof. Dr. Ijaz Ahmad | Prof. Dr | Prof. Dr. Hibib ur Rehman | Faculty of Biosciences.

Material type: book Book; Format: print Publisher: 2011Dissertation note: The antiviral activity of plants Silybum marianum (seeds), Chenopodium album (whole plant) and Nigella sativa (seeds) were evaluated against Peste des petitis ruminants virus (PPRV) and Foot and Mouth Disease virus (FMDV) in this study. Methanolic extraction of these plants was done by using Soxhlet apparatus and extracts were dried by using rotary evaporator. Six dilutions of each extracts 100, SO, 2S, 12.S, 6.2S, 3.12~g/ml were made in distilled water. Vero cells were infected by PPRV and BHK-21 by FMDV respectively. The herbal extracts assays of antiviral and cytotoxic were carried out in cell culture plates. Each well of 96 well cell culture plate were seeded with 104cell/ml of cell suspension. Cell counting was performed by hemocytometeric method. Positive and negative controls for antiviral and cytotoxic assay were also used, incubated the 96 well cell culture plates at 37°C for 4 days. After this incubation, MTT [3-(4,S-dimethylthiazol-2-yl)- 2,S-diphenyltetrazolium bromide] colorimetric assay were used for the determination of their quantification. Endpoint of this assay was considered in terms of cell survival percentage. Results were compared for qualitative variables using Chi-square technique and quantitative variables by linear regression analysis. 1 OO~g/ml and SOIlg/ml concentrations of Chenopodium album showed cell survival percentages of 87.9% and 86% respectively in PPRV and all six test dilutions of same plant showed no cytotoxicity for Vero cells. IOuug/ml and SO~g/ml concentrations of Chenopodium album showed cell survival percentages of 88.5% and 87.2% respectively in FMDV and all six test dilutions of same plant showed no cytotoxicity for BHK-21 cells. Two concentrations of Nigella sativa 50!J. glml and 25!J. glml showed prominent cell s urvival of 85% and 84% respectively in PPRV and only one concentrations l Ouug/ml were found cytotoxic.Two concentrations of Nigella sativa 50uglml and 25!J.glml showed prominent cell survival of 79% and 77% respectively in FMDV and only one concentrations IOuug/ml were found cytotoxic. Only IOuug/ml of Silybum marianum has shown cytotoxicity and 50!J.glml and 25!J.glml shown prominent antiviral activity 91% and 85% respectively in PPRV. In FMDV l Otlug/ml of Silybum marianum has shown cytotoxicity and 50!J.glml and 25!J.g/ml shown prominent antiviral activity 93% and 91 % respectively. The results of present study are helpful in the treatment of Peste des petitis ruminants and Foot and Mouth Disease. Availability: Items available for loan: UVAS Library [Call number: 1360,T] (1). Place hold
An Epidemiological Study Of Nosocomial Infections At Mayo Hospital, Lahore

by Tayyaba Ijaz (Phd) | Prof. Dr. Muhammad Akram Muneer | Dr. Mansur-ud-Din Ahmad | Faculty of Veterinary Sciences.

Material type: book Book; Format: print Publisher: 2005Dissertation note: The present study was designed to investigate the Prevalence of Etiological Agents of Nosocomial Infections in Mayo Hospital, Lahore-Pakistan of the 32,620 patients studied during 1997-2001; a total of 4502 (13.80%) patients acquired various types of nosocomial infections during their stay at Hospital. Clinical samples collected from various types of patients consisted of 1040 samples of Pus & Wound Swabs, 109 samples of blood; 115 of Pleural Fluids, 286 of Ascetic Fluids, 37 of Cerebrospinal Fluid, 1398 of Urine, 988 of Sputum; 329 of Burn Swabs, 99 of Patient Body Devices and 101 of Fecal and Drainage Material. The routine techniques for isolation. Identification through Biochemical, Serological and Antibiotic Sensitivity Testing were used for studying the Bacteriology of the selected samples. The present findings revealed that from a total of 4502 samples, 1287 Strains of Staphylococci, 429 Strains of Streptococci, 328 Strains of Enterococci, 781 Strains of Pseudomonas, 349 Strains of Enterobacter, 41 Strains of Acinetobacter, 26 Strains of Klebsiella, 140 Strains of Proteus, 1031 Strains of Escherichia, 67 Strains of Serratia, 93 Strains of Haemophilus, 119 Strains of other types of Gram Positive Bacteria, 13 Strains of other types of Gram Negative Bacteria, and 189 Strains of Yeast and Fungi were found as Etiological Agent for Nosocomial Infections. Availability: Items available for loan: UVAS Library [Call number: 0912,T] (1). Place hold
Assessment Of Avian And Mammalian Diversity At Selected Sites Along River Chenab

by Muhammad Altaf (2008-VA-725) | Dr. Arshad Javid | Dr. Waseem Ahmad Khan | Prof. Dr. Muhammad Ashraf.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: The River Chenab is an important wetland of Punjab province and the tree plantations around the river are the part of tropical thorn forest. But as a consequence of deforestation much of the natural forested areas have been turned to agricultural land. The main objective of study was to assess the avian and mammalian diversity of the study area; to identify and assess anthropogenic impacts on avian and mammalian diversity of the study area; and to explore the level of humanwildlife conflict selected sites of river Chenab i.e. district Sialkot, district Gujrat and district Gujranwala from May, 2013 through April. Surveys were made during dawn (5:00 am to 8:00 am) and dusk (4:00 pm to 7:00 pm). During the waterfowl study recorded 51 species belonging to 33 genera, 16 families and 8 orders were recorded from the study area. Throughout the year a total of 2531 birds from recorded from head Marala, 2026 from the head Khanki and 2230 from head Qadirabad. Diversity indices were analyzed through statistical software PAST version 2.17 C. The Shannon-Weiner diversity index at head Marala was 2.62, at head Khanki it was 2.64 while at head Qadirabad it was 2.78. It can be concluded from the present study that the River Chenab is waterfowl rich and should be declared as protected site for waterfowls. The study area was divided into different habitat types on the basis of vegetation and urbanization and was designated as forest habitat (FH), wetland habitat (WLH), rural forest habitat (RFH), agriculture habitat (AH), agriculture rural habitat (ARH), urban non vegetative habitat (UNVH) and urban vegetative habitat (UVH). A linear count method was applied and data was collected through direct and indirect observations. Habitat preference of the birds varied f declined from forested habitats to the urban landscapes. It can be concluded from the study that Summary 152 many of the avian species are habitat specific and the connection/corridors between similar habitat types might be fruitful for the conservation of avian species. The anthropogenic impacts and habitat preferences of mammalian species along river Chenab, Pakistan was also assessed the mammalian diversity was recorded along forested landscapes, cultivated plantations, semi-urban and urban areas. The data on diversity and distribution of various mammalian species was collected through point count method viz. direct observation (personal count and record voices) and indirect observation (presences of carcasses, fecal pellet, pug marks and meeting with local communities). The habitat preferences of large, medium and small mammals varied significantly. A decline in mammalian diversity was observed from forest habitat to urban landscapes. Indian wild boar, Asiatic jackal, Indian fox, jungle cat, Indian pangolin and long eared desert hedgehog preferred forested areas as well as slightly modified habitats while Northern palm squirrel, house mouse, house shrew and rat species preferred human habitations. Similarly, few species such as the small Indian mongoose, Soft-furred field rat, short tailed mole rat, Asiatic jackal and Indian gerbil preferred cultivated areas. It can be concluded that many of the mammalian species are habitat specific and corridors and connections between different landscapes are important for the conservation of mammalian diversity. Medicinal and cultural significance of avian species along the River Chenab were assessed through Relative Popularity Level (RPL) and Rank Order Priority (ROP). One hundred and nine persons were interviewed and data regarding socio-economic status of the respondents, qualitative data on cultural significance from three selected districts. The compiled data are analyzed using different quantitative tools, such as relative frequency of mention (RFM), fidelity level (FL), relative popularity level RPL and rank order priority (ROP). Out of total 155 Summary 153 avian species recorded from the study area, 28 have medical importance while local people were using feathers of almost all the bird species for making different toys. Ten species were most popular and highest RFM values (0.58) were recorded for house sparrow (Passer domesticus). Similarly, highest FL values (100%) were recorded for house sparrow (P. domesticus) and domestic chicken (Gallus gallus). These studies indicated that the area is rich in avian diversity and many of these species have medical and cultural significance for the locales. Mammals are source of food and medication for humans from ancient times. A survey was conducted along the Rver Chenab, Punjab, Pakistan and 109 persons were interviewed to investigate the extent of human dependency on mammalian species of the area. A total of 30 mammalian species were recorded from the study area. Highest relatively frequency of mention (RFM) values (0.5) were observed for desert hare, Lepus migricollis dayanus while maximum (100%) fidelity level (FL) was recorded for cow Bos gaurus, sheep Ovis aries and cat Felis domesticus. Seven species were most popular. It can be concluded from present survey that local people have strong association with mammalian species of the study area and dependent for food and medicines on these species. In depth studies are recommended to explore medicinal importance of the species. The study area was part of tropical thorn forest but a larger portion has been changed into agricultural land or human habitations. Data regarding socio-economic value of area, financial losses to crops and livestock, peoples’ attitude and tolerance towards wildlife, protection methods for livestock and crops from predators and profile of 150 respondents were collected through a questionnaire. The age of the respondents was between 20 to 65 years, out of them 54% were literate, 99% were Muslims and all these respondents were from different professions viz. farmers (32%), livestock managers (37%) and others (31%). Most of the respondents (52%) Summary 154 were unaware about the role of wild species in ecosystem, certain respondents (28%) disliked wild species in their areas and 20% respondents had positive view about wildlife in the area. The collected data revealed that crops are mostly damaged by the Indian wild boar (42%), Asiatic jackal (34%), diseases (11%), Indian crested porcupine (6%) and others (7%) including rats, squirrels, crows and sparrows. Similarly, the livestock animals are affected mostly by diseases (36%), Asiatic jackal (34%), jungle cat (10%), Indian fox and others (6%) including raptor birds. Most of the respondents were of the view that wildlife is declining in the area. The River Chenab is an important wetland of Punjab, Pakistan. Water of the river is becoming pollutedt due to anthropogenic impact i.e. industrial waste, urbanization, agriculture intensification. The main objectives of the study were to know the diversity and distribution of fish species of river Chenab. Both, direct and indirect methods were applied to find out fish diversity of the area. The diversity indices were analyzed through statistical software PAST version 2.17 C. During the sampling 34 species was recorded from the river Chenab. The diversity indices indicate that higher diversity is present at the head Qadirabad than head Khanki and Marala. The reason is that there is present large number of natural and manmade ponds; during the flood these pond fishes move to the river further eggs and fingerlings move to rivers through birds and fisherman. Availability: Items available for loan: UVAS Library [Call number: 2520-T] (1). Place hold
Bat Biodiversity (Vespertilioniformes: Order Chiroptera) In Some Tropical And Arid-Subtropical Regions Of Pakistan

by Arshad Javid | Dr. Muhammad Mahmood-ul-Hassan | Dr. Muhammad Ali Nawaz | Prof. Dr.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2011Dissertation note: The present study was conducted from June 2009 to May 2011 in those arid subtropical and tropical regions of Pakistan which included less pronounced monsoon influenced areas of the Salt Range, the Upper Indus Plains and the sand dune areas typified by the Cholistan. Bat surveys were conducted in two protected areas i.e. the Margallah Hills National Park (SA1) and the Chinji National Park (SA2) that were located in the arid subtropical region and in another, the Lal Suhanara National Park (SA3), situated in the tropical sand dune region of the Upper Indus Plains. In addition, bat samples were also collected from Gujranwala, Lahore, Tob Tek Singh and Kasur districts (SA4). These sub-areas were selected to maximize the chances of capture of as many bat species inhabiting arid-subtropical and tropical habitats of Pakistan as possible. A total of 182 bats belonging to twelve species were recorded. These included R. blasii (Family Rhinolophidae), R. hardwickii (Family Rhinopomatidae), Taphozous nudiventris and T. perforatus (Family Emballonuridae), Scotoecus pallidus, Scotophilus heathii, S. kuhlii, Pipistrellus ceylonicus, P. javanicus, P. pipistrellus, P. tenuis and Hypsugo savii (Vespertilionidae). Rhinolphous blasii was captured only from SA1, R. hardwickii and S. pallidus from SA3 and P. tenuis from SA1. Taphozous nudiventris and T. perforatus were captured from SA1 and SA3, S. kuhlii and P. ceylonicus from SA1 and SA4, H. savii from SA1 and SA2 and P. javanicus from SA1 and SA2. Scotophilus heathii and P. pipistrellus were recroded throughout the study area. Maximum bat activity was recorded in spring (n = 65) that was followed by summer ( n = 61), autumn (n = 32) and winter (n = 24). Rhinolophus blasii and S. pallidus were recorded only during winter, R. hardwickii and P. tenuis during autumn, while S. kuhlii was recorded only during summer. Taphozous nudiventris and T. perforatus were captured during summer and autumn. Pipistrellus pipistrellus was recorded during autumn, spring and winter while S. heathii was captured throughout the year. Although the netting effort was the same, the number of bats captured from the SAs was different. A total of 72 bats were recorded from SA1, 52 from SA4, 43 from Lal SA3 and 15 from SA2. The dominance was highest for SA2 and lowest for SA1. Both Shannon and Simpson indices show that the diversity was the highest at SA1 followed by SA3, SA4 and SA2. Evenness was found to be highest at SA4 followed by SA3, SA2 and SA1. The mean head and body length of three Rhinolophus blasii was 39.33 mm ± 0.577 (SD) forearm length was 40.17 mm ± 1.155 (SD) and the tail length was 19.23 mm ± 1.940 (SD). The greatest skull length of a single R. blasii was 17.22 mm and mandible length was 11.80 mm. The baculum of a single R. blasii sample was 3.5 mm long. The mean head and body length of two Rhinopoma hardwickii 66.00 mm ± 5.657 (SD). The mean forearm length was 54.00 mm ± 0.0 (SD). The tail length was 59.00 mm ± 2.828 (SD). The greatest skull length was 19.68 mm ± 0.108 (SD), and the length of mandible was 11.28 mm ± 1.652. The baculum of single R. hardwickii was 1.1 mm long. The mean head and body length of twenty six Taphozous nudiventris was 86.87 mm ± 5.556 (SD) and the tail length was 27.57 mm ± 12.187 (SD). The greatest skull length was 26.16 mm ± 0.323 (SD) and the length of mandible was 17.53 mm ± 1.149 (SD). The mean total baculum length of the two specimens was 0.58 mm ± 0.017 (SD). The head and body length of four T. perforatus was measured as 84.30 mm ± 5.450 (SD) long. The forearm was 64.30 mm ± 3.457 (SD) long and the length of tail was 22.10 mm ± 2.702 (SD). The greatest length of skull was 22.24 mm and the length of mandible was recorded as 16.25 mm. The total length of a single T. perforatus was measured as 0.69 mm. The head and body length of fifty three Scotophilus heathii was 79.46 mm ± 6.941 (SD). The mean forearm length was 58.69 mm ± 2.929 (SD) and the tail length was 55.00 mm ± 7.360 (SD). The greatest length of skull was 21.39 mm ± 1.378 (SD) and the length of mandible was recorded as 16.08 mm ± 0.882 (SD). Mean total bacular length of ten S. heathii was measured 1.76 mm ± 0.150 (SD). The mean head and body length of five specimens of S. kuhlii was 72.10 mm ± 8.096 (SD). The forearm was 49.40 mm ± 3.03 (SD) long and the length of tail was 42.40 mm ± 4.04 (SD). The greatest length of the skull was 18.98 mm ± 0.613 (SD) and the mandible length was 14.41 mm ± 1.173 (SD). The total length of the baculum of a single S. kuhlii was 1.74 mm. The head and body length of two Scotoecus pallidus was 56.50 mm ± 3.536 (SD). The forearm was 35.50 mm ± 0.707 (SD) long and the length of the tail was 35.50 mm ± 3.536 (SD). The greatest length of skull was 15.46 mm ± 0.449 (SD) and mandible length was measured 9.64 mm ± 2.425 (SD). The total length of the baculum of a single S. pallidus captured from SA3 was 5.0 mm. The mean head and body length of twenty two Pipistrellus ceylonicus was 63.60 mm ± 7.486 (SD). The length of forearm was 29.92 mm ± 2.492 (SD) and tail length was 25.68 mm ± 3.442 (SD). The greatest length of the skull was 10.76 mm ± 0.257 (SD) and the length of mandible was 9.28 mm ± 3.956 (SD), respectively. Mean total length of the bacula of four P. ceylonicus was 3.66 mm ± 1.190 (SD). Mean head and body length of the ten P. javanicus was 52.00 mm ± 2.712 (SD). The forearm was 35.13 mm ± 1.996 (SD) long and the length of the tail was 30.38 mm ± 5.236 (SD). The greatest skull length was 13.01 mm ± 4.546 (SD) and the length of mandible was 10.29 mm ± 1.679 (SD). The mean total length of the four bacula was 3.57 mm ± 0.860 (SD). The head and length of fifty two P. pipistrellus was 39.33 mm ± 2.690 (SD). The forearm was 28.23 mm ± 1.264 (SD) long and the length of the tail was 25.86 mm ± 3.396 (SD). The greatest length of skull was 11.04 mm ± 0.342 (SD) and the length of mandible was 7.87 mm ± 0.802 (SD). The mean total length of the eleven bacula of P. pistrellus was 3.19 mm ± 0.421 (SD). Only two specimens of P. tenuis were captured from SA1. The head and body length of these specimens was 35.00 mm ± 2.828 (SD). The forearm length was 28.00±0.707 while the length of the tail was 22.25 mm ± 3.182 (SD). The greatest length of the skull was 10.19 mm. and the mandible length was 7.82 mm. The total bacular length was 2.79. The head and body length of the two Hypsugo savii was 55.50 mm ± 19.092 (SD). The forearm was 36.75 mm ± 3.889 (SD) long while the length of the tail was 33.50 mm ±6.364 (SD). The greatest length of the skull was 11.18 mm and the length of mandible was 7.08 mm. The total bacular length of a single H. savii was 2.67 mm. The echolocation calls of bats of Pakistan have never been recorded and thus the accuracy of species identification on the basis of their calls remains a bit doubtful. Availability: Items available for loan: UVAS Library [Call number: 1374,T] (1). Place hold
Bats (Chiroptera: Mammalia) Of Malakand Division, Pakistan

by Mohammad Salim (2007-VA-543) | Dr. Arshad Javid | Dr. Muhammad Sajid Nadeem | Dr. Zulfiqar Ali | Prof. Dr. Azhar Maqbool.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: The present study was conducted from 2010 to 2013 in three districts (Malakand, Dir and Swat) of Malakand Division. A total of 49 stations were sampled for bats where total 1982 bats were recorded. A total of 21 species of bats belonging to six families, fourteen genera were recorded. These includes the Indian flying fox (Pteropus giganteus), the greater short-nosed fruit bat (Cynopterus sphinx), the fulvous fruit bat (Rousettus leschenaultia), the greater mouse-tailed bat (Rhinopoma microphyllum), the lesser mouse tailed bat (Rhinopoma hardwickii), the greater false vampire (Megaderma lyra), the greater horseshoe bat (Rhinolophus ferrumequinum), the Blyth‟s horseshoe bat (Rhinolophus Lepidus), the fulvous leaf-nosed bat (Hipposideros fulvus), the Hodgson‟s bat (Myotis formosus), the Asian barbastelle (Barbastella leucomelas), the Asiatic greater yellow house bat (Scotophilus heathii), the Asiatic lesser yellow house bat (Scotophilus kuhlii), the serotine (Eptesicus serotinus), the common pipistrelle (Pipistrellus pipistrellus), the javan pipistrelle (Pipistrellus javanicus), the coromandel pipistrelle (Pipistrellus coromandra), the least pipistrelle (Pipistrellus tenuis), the Dormer‟s bat (Pipistrellus dormeri), the desert yellow bat (Scotoecus pallidus) and the Schreiber‟s long-fingered bat (Miniopterus fuliginosus) were recorded throughout the study area. M. formosus was common to all the three districts while B. leucomelas and P. pipistrellus were captured only from Dir district. The Hodgson‟s bat (M. formosus) and the Schreiber‟s long-fingered bat (M. fuliginosus) were captured from Malakand and Swat districts. The skeleton of C. sphinx was recorded only from adjacent area of Malakand district. The Indian flying fox (Pteropus giganteus) was not previously recorded from Khyber Pakhtunkhwa while it has been reported from Punjab and Sindh province of the country. There are only six species which has Summary 181 previously been reported from Khyber Pakhtunkhwa while thirteen bats were newly recorded from the study area. Only two bats were newly recorded for the first time in the country. The mean forearm length of the three P. giganteus was 152.23 mm ± 3.72 (SD). The mean greatest skull length was 65.96 mm ± 1.42 (SD). The maxillary toothrow length was 24.91 mm ± 0.84 (SD). The mandible and mandibular toothrow length were 50.78 mm ± 0.87 (SD) and 27.41 mm ± 0.66 (SD), respectively. The thumb and forearm length of one C. sphinx was 25.80 mm and 65.48 mm, respectively. The greatest length of skull was 32.20 mm. The maxillary and mandibular toothrow length were 10.86 mm and 12.64 mm. The mandible was 24.75 mm long. The mean forearm and thumb of R. leschenaultii was 80.23 mm ± 3.26 (SD) and 27.79 mm ± 1.22 (SD), long, respectively. The mean greatest skull length was 36.97 mm ± 1.11 (SD). The mean mandible, maxillary and mandibular toothrow length were 28.95 mm ± 0.90 (SD), 14.08 mm ± 0.44 (SD) and 15.51 mm ± 0.47 (SD), respectively. Mean thumb and forearm length of three R. microphyllum was 8.80 mm ± 0.95 (SD) and 67.45 mm ± 4.60 (SD), respectively. The mean greatest length of skull was 20.15 mm ± 0.64 (SD). The mandible, maxillary and mandibular toothrow length were 7.30 mm ± 0.18 (SD), 8.11 mm ± 0.11 (SD) and 14.38 mm ± 0.63 (SD), respectively. Mean thumb and forearm length of R. hardwickii was 8.23 mm ± 0.38 (SD) and 59.90 mm ± 1.21 (SD), respectively. The mean greatest length of skull of the four specimens was 18.20 mm ± 0.48 (SD). The maxillary and mandibular toothrow length were 6.08 mm ± 0.07 (SD) and 6.72 mm ± 0.13 (SD), respectively. The mandible length was measured as 12.38 mm ± 0.0.23 (SD). Mean thumb and forearm length of M. lyra was 11.80 mm ± 0.44 (SD) and 70.06 mm ± 0.69 (SD), respectively. Mean greatest length of skull of the three specimens was 29.60 mm ± 0.46 Summary 182 (SD). The maxillary toothrow length was 11.40 mm ± 0.10 (SD). The mandibular toothrow length was 11.94 mm ± 0.04 (SD). The mandible length was measured as 20.04 mm ± 0.03 (SD). Mean thumb and forearm length of R. ferrumequinum was 4.01 mm ± 0.01 (SD) and 60.01 mm ± 1.41 (SD), respectively. The mean greatest length of skull of the two specimens was 23.35 mm ± 0.20 (SD). The maxillary toothrow length was 9.18 mm ± 0.02 (SD). The mandibular toothrow length was 9.86 mm ± 0.01 (SD). The mandible length was measured as 16.33 mm ± 0.13 (SD). The mean thumb and forearm length of R. lepidus was 3.87 mm ±0.13 (SD) and 38.02 mm ± 0.63 (SD), respectively. The mean greatest length of skull of the two specimens was 15.94 mm ± 0.15 (SD). The maxillary toothrow length was 5.86 mm ± 0.02 (SD). The mandibular toothrow length was 6.57 mm ± 0.64 (SD). The mandible length was measured as 10.34 mm ± 0.04 (SD). Mean thumb and forearm length of H. fulvus was 4.91 mm ± 0.17 (SD) and 41.41 mm ± 0.97 (SD), respectively. The mean greatest length of skull of the thirteen specimens was 18.45 mm ± 0.16 (SD). The maxillary toothrow length was 6.50 mm ± 0.14 (SD). The mandibular toothrow length was 6.96 mm ± 0.18 (SD). The mandible length was measured as 11.73 mm ± 0.14 (SD). Mean thumb and forearm length of M. formosus was 9.26 mm ± 0.70 (SD) and 48.74 mm ± 2.02 (SD), respectively. The mean greatest length of skull of the three specimens was 17.81 mm ± 0.12 (SD). The maxillary toothrow length was 7.15 mm ± 0.05 (SD). The mandibular toothrow length was 7.80 mm ± 0.05 (SD). The mandible length was measured as 13.85 mm ± 0.07 (SD). Thumb and forearm length of B. leucomelas was 5.65 mm and 42.88 mm, respectively. The tragus height was 10.32 mm. The greatest length of skull of a single specimen was 15.87 mm. The maxillary toothrow length was 4.91 mm. The mandibular toothrow length was 5.43 mm. The mandible length was measured as 10.02 mm. Summary 183 Mean thumb and forearm length of S. heathii was 9.06 mm ± 0.41 (SD) and 62.25 mm ± 1.76 (SD), respectively. The mean greatest length of skull of the nine specimens was 23.12 mm ± 0.46 (SD). The maxillary toothrow length was 7.87 mm ± 0.16 (SD). The mandibular toothrow length was 8.93 mm ± 0.16 (SD). The mandible length was measured as 16.62 mm ± 0.19 (SD). Mean thumb and forearm length of S. kuhlii was 7.01 mm ± 1.41 (SD) and 50.06 mm ± 7.13 (SD), respectively. The mean greatest length of skull of the two specimens was 19.24 mm ± 0.71 (SD). The maxillary toothrow length was 6.49 mm ± 0.11 (SD). The mandibular toothrow length was 7.42 mm ± 0.01 (SD). The mandible length was measured as 13.78 mm ± 0.47 (SD). Mean thumb and forearm length of E. serotinus was 8.92 mm ± 0.32 (SD) and 53.37 mm ± 1.39 (SD), respectively. The mean greatest length of skull of the fifteen specimens was 21.40 mm ± 0.70 (SD). The maxillary toothrow length was 7.84 mm ± 0.21 (SD). The mandibular toothrow length was 9.28 mm ± 1.95 (SD). The mandible length was measured as 15.51 mm ± 1.94 (SD). Thumb and forearm length of P. pipistrellus was 4.01 mm and 31.06 mm, respectively. The greatest length of skull of a single specimen was 12.14 mm. The maxillary toothrow length was 4.22 mm. The mandibular toothrow length was 4.45 mm. The mandible length was measured as 8.27 mm. Thumb and forearm length of P. javanicus was 4.02 mm and 32.01 mm, respectively. The greatest length of skull of a single specimen was 13.13 mm. The maxillary toothrow length was 4.60 mm. The mandibular toothrow length was 5.20 mm. The mandible length was measured as 9.46 mm. Mean thumb and forearm length of P. coromandra was 4.70 mm ± 0.45 (SD) and 32.28 mm ± 1.17 (SD), respectively. The mean greatest length of skull of the eight specimens was 12.67 mm Summary 184 ± 0.40 (SD). The maxillary toothrow length was 4.44 mm ± 0.24 (SD). The mandibular toothrow length was 4.74 mm ± 0.23 (SD). The mandible length was measured as 9.13 mm ± 0.46 (SD). Mean thumb and forearm length of P. tenuis was 4.43 mm ± 0.47 (SD) and 29.24 mm ± 1.03 (SD), respectively. The mean greatest length of skull of the 23 specimens was 11.56 mm ± 0.25 (SD). The maxillary toothrow length was 3.87 mm ± 0.09 (SD). The mandibular toothrow length was 4.10 mm ± 0.06 (SD). The mandible length was measured as 7.89 mm ± 0.60 (SD). Mean thumb and forearm length of P. dormeri was 5.28 mm ± 0.70 (SD) and 34.30 mm ± 1.25 (SD), respectively. The mean greatest length of the skull was 13.77 mm ± 0.11 (SD). The mandible, maxillary and mandibular toothrow length were measured as 10.53 mm ± 0.09 (SD), 5.33 mm ± 0.02 (SD) and 5.56 mm ± 0.07 (SD), respectively. Mean thumb and forearm length of S. pallidus was 6.26 mm ± 0.41 (SD) and 36.83 mm ± 0.42 (SD), respectively. The mean greatest length of skull of the twenty two specimens was 15.00 mm ± 0.26 (SD). The maxillary toothrow length was 5.66 mm ± 0.10 (SD). The mandible and mandibular toothrow length were 11.35 mm ± 0.23 (SD) and 6.11 mm ± 0.12 (SD), respectively. Mean thumb and forearm length of M. fuliginosus bat was 6.61 mm ± 0.43 (SD) and 37.59 mm ± 5.37 (SD), respectively. The mean greatest length of skull of the six specimens was 14.48 mm ± 0.58 (SD). The maxillary toothrow length was 5.32 mm ± 0.39 (SD). The mandible and mandibular toothrow length were 10.54 mm ± 0.65 (SD) and 5.71 mm ± 0.49 (SD), respectively. FUTURE RECOMMENDATIONS 1. Bat surveys. This is the first extensive exploration of that small portion of the Khyber Pakhtunkhwa which comprises of only three districts of Malakand Division i.e. Malakand, Dir and Swat. Although more focus remained towards Malakand district, six families, fourteen genera, twenty one species were identified. Moreover, two new country Summary 185 records (Myotis formosus and Miniopterus fuliginosis) were also explored. Further bat surveys in poorly surveyed parts of the country especially in KPK and Baluchistan may result in identification of some other new bat taxa. More bat surveys involving greater field efforts may also confirm the presence or absence of those already described from the country. 2. Distribution ranges and species specific habitat analysis. Presence of thirteen new locality records (Pteropus giganteus, Cynopterus sphinx, Rhinopoma hardwickii, Megaderma lyra, Rhinolophus Lepidus, Hipposideros fulvus, Barbastella leucomelas, Scotophilus heathii, Scotophilus kuhlii, Eptesicus serotinus, Pipistrellus javanicus, Pipistrellus dormeri and Scotoecus pallidus) and two new country records (Myotis formosus and Miniopterus fuliginosis) gives credence to the idea that distribution ranges of most of the bat species has change over the past sixty years. Thus serious scientific studies are needed to redefine distribution ranges and identify species specific habitats using global positioning system and radio-telemetric studies. 3. Reconfirmation of bat taxonomy. Genetic analysis of none of the bat species of the country has been made using molecular markers thus leaving behind a chance to doubt identification of cryptic bat species. Thus molecular genetic studies of all the bat species of the country is highly recommended which may also lead to the discovery of such bat taxa which are new to science. 4. Bat call library. The only bat detector (Patterson D 1000X) present in the country fell down from my hand in a water body and became out of order. So none of the bat could be recorded. Bat call analysis has boosted bat identification throughout the world but the Summary 186 lack of such sophisticated equipment in the country has become a major bottle neck in the establishment of a bat call library. 5. Awareness campaigns. Majority of the countrymen are unaware of the ecological services rendered by bats. Khyber Pakhtunkhwa is the major fruit growing region of the country. Based on misperceptions, the locals consider all bats as vermin and kill them ruthlessly. Conservation education to highlight the significance of bats must be included in the curriculum of children at primary school level so that they may adopt a pro-conservation attitude in the first few years of their personality building. Availability: Items available for loan: UVAS Library [Call number: 2610-T] (1). Place hold
Bioconversion Of Agricultural Waste To Alginate By Azotobacter Vinelandii Using Fermentation

by Shagufta Saeed (2008-VA-742) | Dr.AbuSaeed Hashmi | Prof. Dr.Ikram-ul-Haq | Dr. Muhammed Tayyab | Dr. Ali Raza Awan.

Material type: book Book; Literary form: not fiction Publisher: 2015Dissertation note: Alginate is an exopolysaccharide composed of varying ratios of β-D mannuronic acid and its C5 epimer α-L-guluronic acid linked together by β-1,4 - glycosidic bond. It has wide range of industrial applications particularly in food sector as a viscosifier, stabilizer, thickener, emulsifier, gelling and water binding agent. Commercial alginate is extracted from brown algae but due to variation in composition of biopolymer isolated from species of different locations, there is growing interest in bacterial alginate. At present two strains of bacteria are reported to produce alginate, Pseudomonas and Azotobacter. Hence present study was designed to produce alginate by Azotobacter vinelandii utilizing cheap substrates to save the foreign exchange. To achieve the goal, different physio-chemical parameters were optimized to have hyper-production of alginate through submerged fermentation. Different agricultural wastes like wheat bran, rice polishing and molasses were utilized as substrates through fermentation with Azotobacter vinelandii.On fermentation of 7.5% (w/v) wheat bran by A.vinelandii, maximum alginate production (5.21 g/L) was observed at 48 hours of incubation time with 6% (v/v) inoculum size, pH 7.0, 300C and agitation speed of 200 rpm. Addition of different optimum levels of ionic salts i.e. 1.5% CaCl2 and 2% MgSO4. 7H2O in the growth medium gave significantly (P< 0.05) higher quantity of alginate (6.08 g/L) where as addition of KH2PO4 and NaCl reduced the yield of alginate. Among different nitrogen sources tested, 2% corn steep liquor resulted significantly (P<0.05) higher yield of alginate (7.46 g/L). The bacterial strain was improved by exposure to physical (UV irradiation) and chemical mutagens (Nitrous acid and ethidium bromide) to obtain more than 90% killing. The survivors were screened for hyper-production of alginate against the wild strain of A.vinelandii using pre-optimized conditions. The highest alginate production (13.8 g/L) was obtained by the ethidium bromide treated strain (EtBr-02). The mutant strain was used for optimization of fermentation parameters. The maximum concentration of alginate (15.61 g/L) was obtained by utilizing 10% (w/v) wheat bran, 8% (v/v) inoculum at 48 hours of incubation, pH 7.0, 300C and an agitation speed of 200 rpm. Inclusion of 2.5% cornsteep liquor raised the alginate concentration to 15.8 g/L. Batch fermenter studies were carried out in 2 L fermenter with working volume of 1.5 L using the mutant strain A.vinelandii, EtBr-02. Optimization of process parameters like agitation, aeration and pH in the fermenter showed that maximum alginate (16.8 g/L) was achieved at 300 rpm, 2.5 vvm aeration and controlled pH condition at 32 hours of incubation time. The alginate produced was identified by FTIR spectrum after precipitation. The purity of alginate was estimated by HPLC against the standard alginic acid from Sigma-Aldrich and was found to be 98% pure. The alginate produced was used at 3% concentration for immobilization of yeast cells. Immobilized and free cells were compared for ethanol production using 10% sucrose as the carbon source in fermentation medium. The maximum amount of ethanol obtained was from free cells i.e. 38 g/L whereas immobilized cells produced 32.5 g/L ethanol. The advantage of immobilization is that beads can be reused in eight sequential fermentation cycles of 10 h each. Thus a cheap and practical bioprocess of alginate production was developed, that can be exploited commercially to save foreign exchange. Availability: Items available for loan: UVAS Library [Call number: 2460-T] (1). Place hold
Bioconversion Of Agricultural Wastes To Lysine And Its Biological Evaluation In Broiler Chicks

by Shagufta Irshad | Dr. Abu Saeed Hashmi | Dr. Ali Raza | Dr. Masroor Ellahi Babar.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2100,T] (1). Place hold
Biological Studies on Various Avian Influenza Virus Types In Poultry

by Tariq Mahmood Shaukat (2003-VA-189) | Prof. Dr. Akram Muneer | Prof. Dr. Mansur-ud-Din Ahmad | Prof. Dr. Azhar Maqbool.

Material type: book Book; Literary form: not fiction Publisher: 2011Dissertation note: Theses submitted with blank cd. Availability: Items available for loan: UVAS Library [Call number: 2390-T] (1). Place hold
Biomass Production Of Pasteurella Multocida By Using Biofermentor For Preparation Of Montanoid Based Vaccine

by Noreen Sarwar | Prof. Dr. Khushi Muhammad | Dr. Atif Hanif | Prof. Dr. Muhammad.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2012Dissertation note: Hemorrhagic septicemia is a contagious bacterial disease of large ruminants principally in cattle and buffalo with high morbidity and mortality. The disease is endemic in nature and outbreaks are common during hot, humid and wet season. The acute and fatal nature and brief duration of the disease limit the antimicrobial therapy. In Pakistan, the disease causes heavy economic losses to dairy industry. Vaccination therefore, is an option for controlling the disease. For a quality vaccine, biomass production of P. multocida along with well developed capsule (immunogen) is necessary. The problem associated with the production of a quality vaccine is poor biomass production of P. multocida when grown in ordinary or routine media. Present study was designed to isolate P. multocida from sick animals and its molecular characterization in the laboratory and study factors (temperature, media composition, pH incubation time and agitation or shaking) affecting its immunogen production and "in process quality control" factors (biological titer, dry mass, adjuvant and storage time) that affect antibody response. Finally, biomass production of the organism using biofermentor and monitoring of the antibody response of buffaloes to inactivated Montanide ISA-70 based P. multocida vaccine. Each of the field isolates showed grey, viscous, mucoid, translucent and non hemolytic colonies on blood agar. There was no growth on MacConkey's agar. It was Gram negative coccobacilli or thin rods and bipolar when stained with Leishman's stain. The isolates were positive for Catalase, Oxidase, Hydrogen sulphide and Indole production along with nitrate reduction while it was negative for urease production, citrate utilization and gelatin liquefaction. The bacteria fermented glucose, sucrose, mannitol, mannose, but failed to ferment arabinose, maltose, salicin, lactose, dulcito and inositol. Polymerase chain reaction (PCR) was performed on isolated colonies by using P. multocida specific and HS causing serotype B specific primers. P. multocida specific PCR gave product of 465 bp while HS causing serotype B specific primers amplified a product of approximately 590 bp. Growth of the bacteria in casein yeast sucrose broth was optimized under different conditions. CSY broth showed dense growth of P. multocida during incubation for 18 hours. A temperature in between 35°C and 40°C showed its optimum growth. Poor growth was observed below 30°C and no growth was detected at 50°C and above. No growth occurred at pH 0.5 and 10.0 but best growth was obtained at pH 7.0 and 8.0. There was positive correlation between shaking in terms of rpm and growth. There was optimum growth at 500 rpm for 24 hours. Inactivated HS Vaccine was prepared from dense growth in biofermentor on the basis of dry mass and bacterial count. The effect of biomass, adjuvant, storage of the vaccine, priming alone or with boosting on its potency was also studied along with boosting effect of montanoid ISA 70 oil based vaccine. Dry mass 1.7 mg/dose produced protective antibody titer while bacterial count 10-14/ml was sufficient to produce the protective antibody titer. Montanoid ISA 70 based vaccine provided immunity to buffalo calves better than aluminium hydroxide gel and bacterins. Boosting with oil based vaccine can help to keep the animal immunized for whole year. For better results of vaccine, it can be stored at 4oC for six months. It is concluded that the proposed study improved quality of the vaccine and reduced volume of the vaccine dose, cost of its production and frequency of vaccination. Availability: Items available for loan: UVAS Library [Call number: 1581,T] (1). Place hold
Characterization Of Linear Type Traits In Nili Rivei Buffaloes Of Pakistan

by Riaz Hussain Mirza | Prof. Dr. Khalid Javed | Prof. Dr. Muhammad Abdullah.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2013Dissertation note: The present study on conformation recording of Nili Ravi buffaloes was planned because there was lack of studies on this aspect of Nili Ravi buffaloes. The main objective of the study was to document and characterize linear type traits in Nili Ravi buffaloes so that the buffaloes with proper body characteristics could be identified for selection and breeding programs. Nili Ravi buffalo herds maintained at Livestock Experiment Station Bhunikey, Pattoki, distt. Kasur, Livestock Experiment Station, Chack Katora distt. Bahawalpur, Livestock Experiment Station Haroonabad distt. Bahawalnagar, Livestock Experiment Station Khushab, distt. Khushab, Livestock Experiment Station Rakh Ghulaman distt. Bhakhar and some private breeders were utilized in this study. The guidelines for conformational recording of dairy cattle provided by the International Committee for Animal Recording (ICAR) were followed in this study. A total of 437 milking buffaloes were scored for linear type traits on a scale of 1-9. First scoring was performed within 15 to 90 days of calving and then each after about 90 days interval. Genetic parameters viz. heritabilities, phenotypic and genetic correlations were estimated using Best Linear Unbiased Prediction (BLUP) evaluation techniques. Influencing factors such as age of the buffalo at scoring, stage of lactation, parity, herd and season of scoring were included in the model. Individual Animal Model was fitted under Restricted Maximum Likelihood (REML) Procedure. Data were analysed using the mixed model procedure of the Statistical Analysis Systems. Genetic parameters were estimated fitting an Individual Animal Model using the ASREML set of computer programs. A total of 1180 records on different linear type traits and body measurements were generated over a scoring period of 2 years. Most of the average values for linear type traits were seen to fall under the intermediate category of 4-6. The means±SD for different linear type traits were found as 5.07±1.35, 5.23±2.35, 5.41±1.45, 5.76±0.98, 6.73±1.53, 4.91±1.85, 4.99±0.88, 4.99±0.90, 5.39±2.13, 4.78±1.1, 5.36±1.56, 4.91±1.84, 5.76±1.67, 3.58±0.88, 5.66±2.24, 6.42±0.88, 4.88±0.69, 4.92±1.08, 4.87±0.84, 5.34±1.79, 4.76±1.78, 5.97±0.94, 5.04±2.488, 5.15±1.65 and 6.44±1.03 for stature, chest width, body depth, angularity, rump angle, rump width, rear legs set, rear legs rear view, foot angle , fore udder attachment, rear udder height, central ligament, udder depth, front teat placement, teat length, rear teat placement, locomotion, body condition score, top line, bone structure, rear udder width, udder balance, teat thickness, thurl width, and temperament, respectively. A highly significant effect of herd was observed on all of the linear type traits (P< 0.0001). Effect of stage of lactation was found to be highly significant for udder conformation related traits. Parity was observed as a highly significant source of variation for some of the body traits including stature, body depth, body condition score and bone structure. However most of the udder related traits were affected by this factor. A non significant effect of parity was observed on chest width, angularity, rump angle, rump width, central ligament, locomotion, top line, udder balance, thurl width and temperament. A highly significant effect of season of scoring was observed on chest width, angularity, rump angle, rear legs set, rear legs rear view, locomotion and thurl width among body traits. However, stature, body depth, body condition score, top line, bone structure and temperament were not affected by season of scoring. Udder conformation traits including fore udder attachment, rear udder height, central ligament, rear udder width, and udder balance were affected by the season of scoring, however rest of the udder traits including udder depth, front teat placement, teat length, rear teat placement and teat thickness were not significantly different in different seasons. Significant linear effect of age of the buffalo at scoring was seen on most of the linear type traits. including stature, body depth, rear legs set, rear legs rear view, foot angle, fore udder attachment, rear udder height, central ligament, udder depth, teat length, body condition score, bone structure, rear udder width, teat thickness and thurl width. However, chest width, angularity, rump angle, rump width, front teat placement, rear teat placement, locomotion, top line, udder balance and temperament were not affected by linear effect of age. Quadratic effect of age was found as significant on most of the linear type traits except chest width, angularity, rump width, front teat placement, rear teat placement, locomotion, udder balance and temperament. Univariate heritability estimates of linear type traits were observed as for stature, 0.36±0.092; chest width, 0.10±0.081; body depth, 0.32±0.081; angularity, 0.06±0.071; rump angle, 0.15±0.071; rump width, 0.38±0.092; rear legs set, 0.02±0.07; rear legs rear view, 0.08±0.07; foot angle, 0.09±0.07; fore udder attachment, 0.21±0.07; rear udder height, 0.09±0.07; central ligament, 0.09±0.09; udder depth, 0.10±0.091; front teat placement, 0.11±0.091; teat length, 0.08±0.091; rear teat placement, 0.11±0.081; locomotion, 0.06±0.06; body condition score, 0.14±0.091; top line, 0.03±0.05; bone structure, 0.09±0.09; rear udder width, 0.15±0.09; udder balance, 0.16±0.07; teat thickness, 0.22±0.091; thurl width, 0.31±0.09 and temperament, 0.14±0.07, respectively. Some important positive phenotypic correlations of linear type traits with 305 days milk yield were observed as 0.18±0.04 for body depth, 0.15±0.04 for rump angle, 0.13±0.04 for rump width, 0.30±0.04 for rear udder height, 0.43±0.03 for central ligament, 0.16±0.03 for rear teat placement and 0.19±0.04 for rear udder width. Rest of the phenotypic correlations were very low. Considerable negative phenotypic correlations included -0.16±035 for body condition score, -0.15±0.04 for top line, -0.16±0.03 for front teat placement, -0.14±0.04 for udder depth and -0.26±0.04 for fore udder attachment. Most of the linear type traits showed positive but low genetic correlation with 305 days milk yield including 0.140±0.0001 with stature, 0.210±0.0001 with body depth, 0.11±0.0001 with rump angle, 0.19±0.0002 with rump width, 0.14±0.0001 with rear udder height, 0.20±0.000001 with central ligament, 0.14±0.0000001 with rear teat placement, 0.13±0.0001 with rear udder width, 0.14±0.0000001 with udder balance, 0.09±0.0001 with thurl width and 0.12±0.0000001 with temperament. Phenotypic and genetic correlations of most the linear type traits with score day milk yield were generally higher than with 305 days milk yield. Phenotypic correlations with score day milk yield were observed as 0.09±0.03 for stature, -0.21±0.03 for chest width, -0.05±0.04 for body depth, -0.17±0.03 for angularity, -0.12±0.03 for rump angle, -0.16±0.05 for rump width, -0.32±0.03 for rear legs set, -0.16±0.04 for rear legs rear view, -0.22±0.03 for foot angle, -0.34±0.03 for fore udder attachment, -0.16±0.04 for rear udder height, -0.16±0.04 for central ligament, -0.25±0.03 for udder depth, 0.06±0.04 for front teat placement, 0.008±0.03 for teat length, -0.19±0.04 for rear teat placement, -0.15±0.04 for locomotion, -0.22±0.03 for body condition score, -0.35±0.03 for top line, -0.08±0.04 for bone structure, -0.17±0.05 for rear udder width, -0.18±0.04 for udder balance, -0.20±0.03 for teat thickness, -0.11±0.04 for thurl width and -0.11±0.05 for temperament, respectively. Genetic correlations with score day milk yield were observed as 0.57±0.05 for stature, 0.09±0.02 for chest width, 0.31±0.04 for body depth, 0.06±0.02 for angularity, 0.15±0.03 for rump angle, 0.30±0.05 for rump width, 0.04±0.02 for rear legs set, 0.06±0.01 for rear legs rear view, 0.06±0.02 for foot angle, 0.10±0.02 for fore udder attachment, 0.18±0.03 for rear udder height, 0.12±0.02 for central ligament, 0.18±0.02 for udder depth, 0.60±0.06 for front teat placement, 0.23±0.03 for teat length, 0.07±0.01 for rear teat placement, 0.021±0.02 for locomotion, 0.12±0.02 for body condition score, 0.08±0.02 for top line, 0.08±0.03 for bone structure, 0.19±0.04 for rear udder width, 0.19±0.03 for udder balance, 0.095±0.02 for teat thickness, 0.12±0.02 for thurl width and 0.27±0.05 for temperament, respectively. Among body measurements, head related measurements included head length, horn diameter at base, length and width of ear and poll width and their average values were found as 54.13±3.48, 18.65±2.06, 29.5±2.12 and 18.66±1.22, and 30.95±2.35 cm, respectively. Average values for neck length and neck circumference were observed as 53.32±4.56 and 95.77±8.58 cm, respectively. The height and length of body was measured at different body points and average values were found as 139.56±6.29 cm for horizontal body length, 154.01±7.61 cm for diagonal body length, 135.77±4.4 cm for height at sacrum, 132.04±4.57 cm for height at withers, 130.77±4.61 cm for height at 6th rib position, 126.34±4.51 cm for height at last rib position, 128.89±4.83 cm for height at hook bone and 118.81±4.45 cm for height at pin bone. The average values for heart girth, paunch girth, sprung at 6th rib position and sprung at last rib position were resulted as 194.46±10.31, 238.52±13.96, 45.15±4.48 and 68.72±5.2 cm, respectively. Mean estimates for top wedge area, front wedge area and side wedge area were obtained as 3152.79±309.53, 1030.17±136.34 and 3105.07±345.26 cm2, respectively. The length of tail and its diameter at base was measured and its value averaged 103.51±12.55 and 22.41±2.005 cm, respectively. Average values of skin thickness at neck, ribs, belly and tail region were found as 4.16±1.16, 5.85±1.36, 7.34±1.49 and 1.71±0.55 mm, respectively. Mean values for some other traits included 43.52±2.582 cm for rump length, 3.12±0.56 cm for heel depth and 523.13±81.63 kg for body weight. It was observed that herd was a significant source of variation for all body measurement traits. Age of the buffalo at classification was a significant source of variation for all of the body measurements except horn diameter at base, poll width, tail length, skin thickness at tail and height at hook bone. Most of the body measurements have been found to be lowly to moderately heritable in the current study. Heritability estimates for various body measurements were observed as 0.16±0.09 for horn diameter at base, 0.38±0.04 for ear length, 0.06±0.09 for ear width, 0.25±0.091 for head length, 0.14±0.09 for poll width, 0.03±0.06 for neck circumference, 0.05±0.07 for neck length, 0.05±0.09 for body length, 0.05±0.09 for diagonal body length, 0.41±0.09 for tail length, 0.28±0.091 for tail diameter at base, 0.04±0.09 for skin thickness at neck, 0.02±0.09 for skin thickness at ribs, 0.10±0.09 for skin thickness at belly, 0.07±0.08 for skin thickness at tail, 0.11±0.09 for height at sacrum, 0.28±0.09 for height at withers, 0.22±0.092 for height at 6th rib position, 0.25±0.092 for height at last rib position, 0.18±0.091 for height at hook bone, 0.07±0.08 for height at pin bone, 0.04±0.06 for sprung at 6th rib position, 0.07±0.06 for sprung at last rib position, 0.13±0.09 for heart girth, 0.05±0.09 for paunch girth, 0.11±0.09 for top wedge area, 0.05±0.06 for front wedge area, 0.16±0.07 for side wedge area, 0.13±0.08 for rump length, 0.02±0.06 for heel depth and 0.33±0.07 for body weight. Phenotypic correlations of 305 days milk yield with various body measurements were in low range. Positive phenotypic correlations ranged from 0.02±0.04 for sprung at 6th rib position to 0.17±0.05 for ear length. Some of the important body measurements have positive phenotypic correlation with 305 days milk yield as 0.15±0.04 for head length, 0.04±0.04 for diagonal body length, 0.04±0.02 for height at withers, 0.11±0.03 for height at sacrum, 0.11±0.04 for sprung at last rib position, 0.04±0.04 for heart girth, 0.08±0.03 for rump length and 0.07±0.03 for body weight. Negative phenotypic correlations with 305 days milk yield ranged from -0.03±0.03 for side wedge area to -0.25±0.03 for horn diameter at base. Some important negative phenotypic correlations included -0.25±0.03 for horn diameter at base, -0.04±0.04 for neck circumference, -0.12±0.03 for skin thickness at neck and -0.08±0.03 for front wedge area. Positive phenotypic correlation with score day milk yield included 0.09±0.05 for body weight, 0.07±0.002 for rump length, 0.09±0.003 for sprung at last rib position, 0.09±0.005 for height at hook bone, 0.08±0.02 for height at sacrum. Rest of all the traits were low in correlation with milk yield. Negative phenotypic correlation with score day milk yield included horn diameter at base as -0.15±0.02 and heel depth as -0.13±0.04. Rest of all negative phenotypic correlations were very low. Positive genetic correlations of 305 days milk yield varied from 0.02±0.002 for ear width to 0.23±0.02 for side wedge area. Some important body measurements have positive genetic correlation values as 0.121±0.000001 for head length, 0.162±0.000001 for diagonal body length, 0.080±0.000001 for height at withers, 0.15±0.000001 for height at sacrum, 0.15±0.000001 for sprung at last rib position, 0.14±0.0005 for heart girth and 0.16±0.007 for body weight. Negative genetic correlation for this trait was observed only for skin thickness at neck region as -0.16±0001. About 40 traits regarding udder and teat measurements before and after milking were analysed. Average values for udder length, width, height, depth and circumference before milking were found as 52.65±6.87, 53.52±6.19, 54.34±4.99, 18.76±3.87, and 77.05±11.69 cm, respectively while the corresponding values for the same traits after milking were found as 47.08±6.57, 48.15±5.79, 55.39±5.15, 18.11±4.11 and 67.04±8.11 cm, respectively. Teat impression distances between front teats, rear teats, fore and rear teats from right side and fore and rear teats from left side were found as 12.46±3.01, 7.01±1.91, 8.08±1.8 and 7.71±1.75 cm, respectively. Pre stimulation and after milking teat characteristics were found as 12.93±3.12 and 11.71±2.83 cm for distance between front teats; 7.48±1.93 and 6.61±1.58 cm for distance between hind teats; 8.34±1.91 and 7.54±1.60 cm for distance between fore and hind teats of right side; 8.004±1.95 and 7.17±1.60 cm for distance between fore and hind teats of left side; 10.19±2.17 and 9.057±1.50 for diameter of fore right teat; 10.92±2.45 and 9.611±1.66 cm for diameter of rear right teat; 10.33±2.11 and 9.33±1.45 cm for diameter of fore left teat; 11.25±2.54 and 9.937±1.76 cm for diameter of rear left teat; 10.71±2.63 and 11.2±2.39 cm, for teat length of fore right teat; 13.05±3.27 and 13.13±3.03 for teat length of rear right teat; 11.09±2.71 and 11.88±2.61 cm for teat length fore left teat and 13.75±3.04 and 14.47±2.99 for teat length of rear left teat, respectively. All of the udder conformation traits before and after milking were highly significantly different in different herds (P<0.0001). Stage of lactation was found to be highly significant source of variation (P<0.0001) for before milking udder length, before milking udder height, average before milking udder circumference, after milking udder length, after milking average udder circumference, teat impression distance between fore, between rear and between fore and rear teats on both sides. However, before milking average udder width, before milking udder depth, after milking average udder width, after milking udder height and after milking udder depth were not affected by this factor. All of the above mentioned traits were significantly affected by parity except after milking udder depth and teat impression distance between fore teats and between rear teats. Season of scoring significantly affected before milking udder length (P<0.01), before milking average udder width (P<0.05), before milking average udder circumference (P<0.01), after milking average udder width (P<0.01), after milking average udder circumference (P<0.0001), teat impression distance between fore and hind teats of left side (P<0.05). Rest of all the traits were not significantly different in different seasons. Most of the udder traits were significantly affected by linear and quadratic effect of age of the buffalo at classification. Herd was a significant source of variation for all teat related traits recorded at pre stimulation before milking time. Stage of lactation significantly affected pre stimulation distance between front teats, pre stimulation distance between hind teats, pre stimulation distance between fore and hind teats on right and left side, pre stimulation diameter of fore right teat, pre stimulation teat length of fore right teat, pre stimulation teat length of rear right teat, pre stimulation teat length of fore left and rear left teat. However, pre stimulation diameter of rear right teat, pre stimulation diameter of fore left teat and pre stimulation diameter of rear left teat were not affected by this factor. All of these parameters were affected by parity except pre stimulation distance between hind teats and pre stimulation teat length of fore left teat. Similarly all of these traits were affected by season of scoring except pre stimulation distance between fore, between hind, between right and between left teats. All of teat characteristics after milking were significantly affected by herd. Stage of lactation significantly affected after milking distance between fore and hind teats of right side (P<0.05), after milking teat length of fore right and rear right teat (P<0.01), after milking teat length of fore left teat (P<0.05) and rear left teat (P<0.0001). Rest of all traits after milking were not affected by stage of lactation. Most of the teat parameters after milking were significantly affected by parity except after milking distance between front and between rear teats, after milking teat length of rear right teat and after milking teat length of fore left teat. Distances among teats after milking and after milking diameter of rear left teat were not significantly affected by season. Rest of all traits were significantly affected by this factor. Heritability estimates for before milking udder length, average udder width, udder height, udder depth and average udder circumference were found as 0.08±0.07, 0.22±0.08, 0.22±0.09, 0.05±0.06 and 0.21±0.07, respectively. The corresponding values after milking for these traits were observed as 0.14±0.07, 0.20±0.08, 0.09±0.08, 0.02±0.08 and 0.09±0.07, respectively. Heritability estimates for before milking and after milking teat characteristics were found as 0.11±0.09 and 0.15±0.09 for distance between front teats; 0.03±0.06 and 0.03±0.07 for distance between hind teats; 0.32±0.09 and 0.06±0.07 for distance between fore and hind teats of right side; 0.16±0.08 and 00.09±0.07 for distance between fore and hind teats of left side; 0.21±0.08 and 0.11±0.08 for diameter of fore right teat; 0.05±0.05 and 0.02±0.05 for diameter of rear right teat; 0.19±0.08 and 0.25±0.09 for diameter of fore left teat; 0.07±0.06 and 0.03±0.07 for diameter of rear left teat; 0.12±0.06 and 0.08±0.06 for teat length of fore right teat; 0.02±0.05 and 0.11±0.07 for teat length of rear right teat; 0.29±0.09 and 0.29±0.092 for teat length of fore left teat and 0.14±0.08 and 0.08±0.07 for teat length of rear left teat, respectively. Phenotypic correlations of before and after milking udder length, average udder width, udder height, udder depth and average udder circumference with 305 days milk yield were found as 0.29±0.04 and 0.18±0.04; 0.30±0.04 and 0.33±0.04; -0.26±0.03 and -0.20±0.03; 0.07±0.04 and 0.06±0.05 and 0.18±0.04 and 0.14±0.04, respectively. Corresponding values in the same order for genetic correlations were observed as 0.17±0.0002 and 0.21±0.0003; 0.33±0.0002 and 0.19±0.0003; -0.29±0003 and -0.34±0003; 0.10±0.0001 and 0.07±0.0001 and 0.28±0.0004 and 0.23±0.0003, respectively. Phenotypic correlations of before and after milking udder length, average udder width, udder height, udder depth and average udder circumference with score day milk yield were found as 0.29±0.03 and -0.18±0.02; -0.32±0.02 and 0.17±0.01, -0.38±0.001 and -0.20±0.002, 0.28±0.01 and -0.04±0.04 and 0.21±0.04 and -0.15±0.04, respectively. Phenotypic correlations for pre stimulation and after milking teat characteristics with 305 days milk yield were found as 0.19±0.03 and 0.07±0.03 for distance between front teats; 0.20±0.04 and 0.20±0.04 for distance between hind teats; 0.21±0.03 and 0.21±0.03 for distance between fore and hind teats of right side; 0.18±0.03 and 0.18±0.03 for distance between fore and hind teats of left side; 0.07±0.03 and 0.27±0.04 for diameter of fore right teat; -0.04±0.03 and 0.14±0.04 for diameter of rear right teat; -0.03±0.04 and 0.20±0.04 for diameter of fore left teat; -0.02±0.04 and 0.20±0.03 for diameter of rear left teat; 0.24±0.03 and 0.28±0.03, for teat length of fore right teat; -0.13±0.03 and -0.009±0.04 for teat length of rear right teat; 0.01±0.02 and 0.12±0.03 for teat length fore left teat and 0.06±0.03 and 0.22±0.03 for teat length of rear left teat, respectively. Genetic correlations for pre stimulation and after milking teat characteristics with 305 days milk yield were found as 0.22±0.0002 and 0.12±0.0003 for distance between front teats; 0.26±0.0001 and 0.13±0.0001 for distance between hind teats; 0.11±0.0001 and 0.09±0.0001 for distance between fore and hind teats of right side; 0.10±0.0001 and 0.07±0.0001 for distance between fore and hind teats of left side; 0.11±0.0001 and 0.11±0.0001 for diameter of fore right teat; 0.09±0.0002 and 0.16±0.0001 for diameter of rear right teat; 0.001±0.000001 and 0.001±0.0001 for diameter of fore left teat; 0.001±0.000001 and 0.001±0.0001 for diameter of rear left teat; 0.080±0.00001 and 0.11±0.0001 for teat length of fore right teat; 0.07±0.000001 and 0.001±0.0002 for teat length of rear right teat; 0.003±0.000001 and 0.003±0.0003 for teat length fore left teat and 0.003±0.000001 and 0.002±0.0002 for teat length of rear left teat, respectively. Phenotypic correlations for pre stimulation and after milking teat characteristics with score day milk yield were found as -0.37±0.02 and -0.48±0.03 for distance between front teats; 0.04±0.04 and 0.06±0.04 for distance between hind teats; 0.04±0.04 and 0.03±0.04 for distance between fore and hind teats of right side; 0.03±0.039 and 0.08±0.04 for distance between fore and hind teats of left side; -0.33±0.03 and -0.16±0.04 for diameter of fore right teat; -0.46±0.03 and -0.26±0.04 for diameter of rear right teat; -0.41±0.03 and -0.24±0.04 for diameter of fore left teat; -0.30±0.03 and -0.28±0.04 for diameter of rear left teat; -0.43±0.03 and -0.49±0.03 for teat length of fore right teat; -0.36±0.02 and -0.47±0.02 for teat length of rear right teat; -0.41±0.034 and -0.43±0.03 for teat length fore left teat and -0.28±0.021 and -0.53±0.02 for teat length of rear left teat, respectively. Genetic correlations for before and after milking teat characteristics with score day milk yield were found as 0.13±0.016 and 0.15±0.02 for distance between front teats; 0.30±0.04 and 0.40±0.05 for distance between hind teats; 0.19±0.05 and 0.38±0.05 for distance between fore and hind teats of right side; 0.32±0.06 and 0.44±0.06 for distance between fore and hind teats of left side; 0.22±0.03 and 0.27±0.04 for diameter of fore right teat; 0.16±0.02 and 0.23±0.03 for diameter of rear right teat; 0.15±0.02 and 0.22±0.03 for diameter of fore left teat; 0.11±0.02 and 0.24±0.03 for diameter of rear left teat; 0.19±0.02 and 0.17±0.02 for teat length of fore right teat; 0.075±0.01 and 0.07±0.01 for teat length of rear right teat; 0.27±0.029 and 0.27±0.03 for teat length of fore left teat and 0.10±0.01 and 0.08±0.01 for teat length of rear left teat, respectively. Least squares means for various performance traits were found as 7.02±2.46 for score day milk yield, 1801.61±624.59 for lactation milk yield, 2074.1±360.85 for 305 days milk yield, 2149.09±680.59 for best milk yield, 272±69 for lactation length, 408.553±203.63 for preceeding dry period, 1762.05±305.97 for age at first calving, 477.68±64.53 for weight at first calving, 110±33 for age at scoring in months, 523.133±81.63 for weight at scoring in Kg. Most of the phenotypic studies on Nili Ravi breed are limited to recording only few body measurements. In order to explore the physical features of this breed, linear scoring system needs to be adopted which is based on measurement of certain specific parts of body as per international standards according to the ICAR guidelines. However, some of the linear scores developed for dairy cattle breeds do not fit for this breed and harmonization of certain trait definitions is needed even for the linear score system for this breed. The following points are important regarding linear scoring system for Nili Ravi buffaloes: " In case of rump angle, the score ranging as 1-3 which refers to higher pin bone than hook bone is not present in Nili Ravi buffaloes. The score for central ligament ranging as 1-3 which refers to convex floor of udder has not been observed in this breed. The position of front teat placement as inside of quarter scoring as 7-9 has not been observed in Nili Ravi buffaloes. The position of rear teat placement as outside of quarter scoring as 1-3 has not been observed in Nili Ravi buffaloes. The score for top line ranging as 8-9 which represents a back bent upwards has not been observed in this breed. The score of 1 and 2 which represents a rear udder deeper than the fore udder has also not been observed in the present study. A higher temperament score indicates that buffaloes tend to be excited especially at the time of milking and handling. This behaviour of buffaloes needs to be improved through selection and breeding. " A highly significant effect of herd was observed on all of the linear type traits. Effect of stage of lactation was found to be highly significant for udder conformation related traits including fore udder attachment, rear udder height, central ligament, udder depth, teat length and rear udder width. Most of the udder related traits were affected by parity such as fore udder attachment, rear udder height, udder depth, teat length, rear udder width and teat thickness. significant effect of parity was observed on chest width, angularity, rump angle, rump width, top line, thurl width, and temperament. " Initiation of conformation recording in public and private sector and use of selective and planned breeding will be helpful for the improvement in milk yield and to bring uniformity in body features of Nili Ravi buffaloes. " Scoring in first parity should be adopted as in later parities adjustment for age and parity will be needed. " Differences among herds for most of the traits suggest that performance can be improved by exploiting genetic potential through selection and breeding. Heritability estimates for most of the linear type traits were found as higher than the reported values available in literature. The reasons might be due to species differences and relatively small data set as well as incomplete pedigree records. Even then the results might be considered for inclusion of some of the linear type traits in selection programs. Keeping in view that this is a preliminary study on genetic aspects of linear type traits in Nili Ravi buffaloes, further studies and research with larger data set is needed to explore linear type traits and to validate the findings of the current study. " A positive genetic correlation of stature with milk yield suggest that taller and heavier buffaloes produced more milk and selection for taller buffaloes may result in improved milk yield but the efficiency of milk yield must be studied before making indirect selection for milk yield through stature. Negative phenotypic correlation of chest width with score day milk yield suggested that buffaloes with wider chest are relatively less efficient in milk production. Further studies are needed with larger data set to verify the results. A considerable positive genetic correlation between body depth and milk yield suggest that body depth may be considered for indirect selection of higher milk yield in Nili Ravi buffaloes. Considerable genetic correlation with milk yield suggest that rump width is important in this breed of buffaloes and can be used for indirect selection for improved milk yield. A considerable negative phenotypic correlation of fore udder attachment with milk yield is important however negligible genetic correlation suggest that fore udder attachment is independent of milk producing genes and separate selection for each trait should be considered keeping in view heritability of the trait in Nili Ravi buffaloes. A positive genetic correlation of rear udder height with milk yield suggested that selection for this trait might be helpful for improved milk yield in Nili Ravi buffaloes. Genetic correlation of teat length with score day milk yield is considerable in the current study but very low with 305 days milk yield. The findings of current study suggested that rear teat placemen has a considerable genetic correlation with milk yield and can be used for indirect selection for better milk yield. The results of current study are not in agreement with most of the reports in the literature regarding correlation of BCS with milk yield. Further research is needed to verify positive genetic correlation of BCS with milk yield before using BCS as selection criterion for milk yield in Nili Ravi buffaloes. Due to negative phenotypic correlation of body condition score with milk yield, an optimal score of below average ranging from 4 to 5 may be recommended. A positive genetic correlation of rear udder width with milk yield suggested that some of the same genes are controlling milk yield and rear udder width and indirect selection for improved milk yield is possible through selection for rear udder width in Nili Ravi buffaloes. This genetic correlation with milk yield is considerable but further studies are needed before the udder balance could be included for selection program in Nili Ravi buffaloes. " Current study indicated that teat thickness is not genetically important with negligible correlation with milk yield in Nili Ravi buffaloes but negative phenotypic correlation is considerable and buffaloes with thinner teats are suitable for more milk production. A low but positive genetic correlation of thurl width with milk yield provides a scope for further studies to explore this trait in Nili Ravi buffaloes. Further studies are needed with relatively larger data set to explore temperament and verify its relationship with milk yield in this breed of buffaloes. Generally, the least squares means for most of the body measurements were found in the normal range and were in agreement with most of the reports in literature. " Comparatively higher body weight was observed than the reports available for Nili Ravi buffaloes. One of the reason for this might be relatively better supply of feed and fodder during the course of study and also the records pertaining to 3rd and latter parities were more in number than the records on younger buffaloes. The top and side wedge area are almost similar with less variation showing that Nili Ravi buffaloes are relatively more wedge shaped. " Most of the body measurements were affected by the herd and age factors but the effect of parity, stage of lactation and season of scoring was variable for different traits and showed not very clear trend. Body weight was affected by all the factors studied in the current investigation. Most of the body measurements have been found to be moderately to highly heritable in the current study. Overall range of heritability estimates for body measurements was found as 0.08±0.09 to 0.92±0.00. " Skin thickness has been found under the genetic control and can be improved through selection and breeding keeping in view its importance and demand in the leather industry and also its correlation with milk yield. " Diagonal body length in the current study has shown a low but positive genetic correlation with milk yield and this trait might be considered in the selection program for Nili Ravi buffaloes. The negative genetic correlation of skin thickness in the neck region with 305 days milk yield is important and advocates the thinking of farmers about the negative correlation of skin thickness with milk yield. Genetic correlation of heart girth with milk yield although not very high but seems to be important and can be considered for indirect selection for milk yield through heart girth measurement. A reasonable genetic correlation of body weight with milk yield suggested that this trait should be considered in the selection program for improved milk yield in Nili Ravi buffaloes. " Udder colour has not been found important. Buffaloes with pendulous udders have produced more milk. The possible reason for this more milk is that such buffaloes were recorded in latter parities and age of those buffaloes was high and the size of their udder was large. The frequency of buffaloes with such type of udder is only 8%. Buffaloes with such type of pendulous udders are more prone to udder and teat injuries and mastitis and their life time production is less. Thick and lengthy teats have been observed in this breed and the reason might be due to hand milking and direct suckling of cows by the calves. " Most of the udder traits were significantly affected by herd, parity, stage of lactation and age of the buffaloes at classification. Most of the udder measurements have been found highly heritable and this provides a good scope for improvement of these traits through selection and breeding. A general decrease in the distance between fore, rear and fore and rear teats on both sides was observed after milking. This indicated that the distance measured after milking was a good indicator of actual distance between teats of this breed irrespective of stage of lactation. Udder length, width, udder circumference and height either recorded before milking or after milking have been found genetically correlated with milk yield and they should be considered for selection decisions in Nili Ravi buffaloes. A reasonable positive genetic correlation of distance between fore and between rear teats suggested that this distance is important for milk yield and should be considered for selection in Nili Ravi buffaloes. The results of present study suggest that teat diameter is not genetically much important for milk yield and the reason of thick teats is due to hand milking and direct suckling by the calves. " Teat distance between front teat, between rear teat, diameter of fore right and rear right teat and teat length of fore right teat have shown low but not negligible genetic correlations with milk yield and should be given some importance in making selection decisions in Nili Ravi buffaloes. " Brown colour buffaloes have not been observed in this study because such animals at Govt. livestock farms are culled at an early age, however farmers think that such type of buffaloes are better milk yielder and they like and demand such animals, development and conservation of these animals is advocated at experimental level to study their potential. " Further research is needed to evaluate visual image analysis system as a tool for quick and more accurate conformation recording. Availability: Items available for loan: UVAS Library [Call number: 1708,T] (1). Place hold
Characterization Of Mycoplasma Gallisepticum Isolates And Their Use In The Production Of Indigenous

by Mushtaq Ahmad | Prof. Dr. Masood Rabbani | Prof. Dr | Prof. Dr. Tahir Yaqub.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2012Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1564,T] (1). Place hold
Chemical Characterizaton And Toxicological Screening Of Auto-Rickshaw Emissions Particulate

by Khaleeq Anwar | Prof. Dr. Muhammad Ashraf | Dr. Aftab | Dr. Aqeel Javeed.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2013Dissertation note: Vehicular air pollution is a mounting health issue of the modern age, particularly in urban populations of the developing nations. Auto rickshaws are not considered eco-friendly as to their inefficient engines producing large amount of particulate matter (PM), which poses a significant environmental threat. Major transformations in the environmental composition are principally attributable to the combustion of fuels by automobiles. Motorized gasoline powered two-stroke auto-rickshaws (TSA) and CNG powered four-stroke auto-rickshaws (FSA)are major sources of air pollution in south Asia and produce toxic amount of PM to the environment. In this study, during the first phase, the PM of TSA and FSA was characterized by using proton induced x-ray emission (PIXE) analysis. The observations of the existing investigation recognized significant increase in Al (P < 0.05), P (P < 0.01), and Zn (P < 0.01) from the PM samples of FSA. In addition, the concentrations of Cu, Fe, K, Mn, Mg, Na, S and Si were also observed exceeding the recommended NIES limits. On the contrary, increased concentration of Sr and V were observed in the PM samples from TSA. It is generally believed that FSA generates smaller amount of PM but the data obtained from this study clearly shows that emissions from FSA are comprised of potentially more toxic substances than TSA. The current research is specific to the metropolitan population and has evidently revealed an inconsistent burden of exposure to air pollutants engendered by FSA in urban communities, which could lead to disruption of several biological activities and may cause severe damage to entire ecological system. The second phase of this study was conducted to ascertain toxic effects on angiogenesis, embryo development, embryonic movement and phytotoxicity of the PM from TSA and CNG powered FSA. Based on high amounts of aluminum quantified during PIXE analysis of PM from TSA and FSA, different concentrations of aluminum sulfate were also tested to determine its eco-toxicological potential. The PM solution from FSA, TSA and Aluminum sulfate exhibited anti-angiogenic potential with reduction in total area of CAM. Morphological evaluation of embryos exhibited varying degrees of hemorrhages in different groups. In case of phytotoxicity screening using Zea mays, the results demonstrated that all three tested materials were equally phytotoxic at higher concentrations in seed germination(p<0.001). Aluminum sulfate proved to be a highly phytotoxic agent even at the lowest concentration examined. During the last phase, of the study, the MTT assay demonstrated a significant (p<0.001) dose dependent cytotoxic effect for TSA, FSA and aluminum sulfate on the BHK-21 cell line, establishing that the PM from FSA is a highly cytotoxic material. Mutagenicity was assessed by fluctuation Salmonella reverse mutation assay adopting TA100 and TA98 mutant strains with (+S9) and without (-S9) metabolic activation. Despite the fact that different concentrations of PM from both sources i.e. TSA and FSA were highly mutagenic (p<0.001) even at lower concentrations, the mutagenic index was higher in TSA. The chronic toxicity study revealed that chronic exposure to PM emitted from FSA and TSA resulted in peribrochiolitis, emphesema and infilteration of leukocytes in lung tissues. On the other hand liver, cardiac and kidney tissues exhibited degeneration and necrosis. The data shows that all tested materials are equally ecotoxicand if the existing trend of atmospheric pollution by auto-rickshaws is continued, air-borne metals/heavy metals will seriously affect the normal growth of local inhabitants and increased contamination of agricultural products, which will amplify the dietary intake of toxic element and could result in genetic mutation or long-term health implications. Availability: Items available for loan: UVAS Library [Call number: 1795,T] (1). Place hold
Chemical Microbiological And Toxicological Evaluation Of Pharmaceutical Effluent Wastewater

by Ali Sharif (2011-VA-266) | Prof. Dr. Muhammad Ashraf | Dr. Aqeel Javeed | Prof. Dr. Aftab Ahmad Anjum .

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Pharmaceutical effluent being a complex mixture of drugs and heavy metals may affect human health exhibiting a strong potential of mutagenicity, carcinogenicity, cytotoxicity and oxidative stress induction along with pathological changes in various organs of the body. The current study was focused to quantify the presence of heavy metals, detection of various drugs, determining the bacterial load along with isolation and identification of different bacteria and assessment of the mutagenic and genotoxic, cytotoxic and oxidative stress induction of pharmaceutical effluent wastewater when exposed to sheep lymphocytes, Salmonella typhimurium strains, cell lines and rats respectively. Atomic absorption spectrophotometer was used to quantify heavy metals and showed the presence of arsenic, chromium, lead and iron in concentrations above the normal limits recommended by WHO and EPA. Gas Chromatograph mass spectrophotometer analysis shown the presence of digitoxin, lignocaine, caffeine and trimethoprim and various other organic pollutants. Microbiological evaluation showed a high bacterial load in the pharmaceutical waste water. Several bacteria were also found in PEW in the presence of different drugs and heavy metals. Aeromonas sobria, Micrococcus varians, Staphyoloccus epidermidis, Staphylococcus aureus, Bacillus megaterium showed tolerance to potassium di chromate and copper sulphate and resistance to various antibiotic discs. Ames assay revealed a strong mutagenic potential with and without the presence of metabolic activation mixtures. A concentration dependent effect was observed when samples were tested with increasing dilution factor. MTT assay and comet assay also showed a concentration dependent effect. The BHK-21 cell line was used to evaluate cytotoxicity and cell viability decreased with increasing concentration of PEW. Sheep lymphocytes used in comet assay exhibited a concentration dependent DNA damage. Different antioxidant enzymes were also evaluated. Rats were exposed to PEW at different concentrations and following 60 days oral exposure, rats were evaluated for the presence of total superoxide dismutase, catalase and hydrogen peroxide in kidney, liver and plasma. Exposure to Pharmaceutical waste water significantly decreased the (TSOD), (CAT) and (H2O2) levels in plasma, liver and kidney. Treatment with Vitamin E significantly ameliorated the levels of enzymes. Exposed rats were also evaluated for any pathological changes. Coagulative necrosis of renal epithelial cells were observed along with severe degeneration and cellular swelling in hepatocytes of hepatic cord. Availability: Items available for loan: UVAS Library [Call number: 2600-T] (1). Place hold
Chemical, Microbiological And Toxicological Evaluation Of Textile Dyeing Industry Wastewater

by Muhammad Furqan Akhtar (2011-VA-265) | Prof. Dr. Muhammad Ashraf | Dr. Aqeel Javeed | Prof. Dr. Aftab Ahmad Anjum.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Exposure to complex mixtures like textile effluent poses risks to animal and human health such as mutations, genotoxicity, pathological lesions and oxidative damage. The aim of the present study was to quantify metals and identify organic pollutants in untreated textile dyeing industry wastewater, to determine the bacterial load of wastewater, isolate and identify heavy metals tolerant bacteria and to determine its mutagenic, genotoxic and cytotoxic potential, influence on normal physiology and effects on oxidative stress biomarkers in effluent exposed rats. Metal analysis through AAS revealed presence of high amounts of zinc, copper, chromium, iron, arsenic and mercury in industrial effluent. Various organic pollutants such as chlorpyrifos, cucurbitacin-b and phthalates were identified by screening through GC-MS. Microbiological evaluation of textile dyeing industry wastewater revealed a high bacterial load. Different bacteria isolated from wastewater such as Staphylococcus aureus, Pseudomonas aeruginosa, Corynebacterium xerosis, Bacillus megaterium, Staphyoloccus epidermidis and Micrococcus varians exhibited resistance to Cr and Cu salts and antibiotics to varying degree. Ames test with/without enzyme activation and MTT assay showed strong association of industrial effluent with mutagenicity and cytotoxicity respectively. Bacterial reverse mutation assay revealed that the mutagenicity of textile dyeing industry wastewater decreased with increase in dilution of wastewater. In-vitro comet assay revealed the evidence of high oxidative DNA damage induced by textile wastewater. Wastewater exhibited concentration dependent genotoxicity in sheep SUMMARY 147 peripheral lymphocytes. When Wistar rats were exposed to industrial effluent in different dilutions for 60 days, then activities of total superoxide dismutase and catalase and hydrogen peroxide concentration were found to be significantly lower in kidney, liver and blood/ plasma of effluent exposed rats than control. Vitamin C at a dose of 50mg/Kg/day significantly reduced oxidative effects of effluent in rats. Industrial effluents may decrease activities of T-SOD and CAT and concentration of H2O2 in liver, kidney and blood/plasma of Wistar rats. Vitamin C may have a possible ameliorating effect on industrial effluent induced oxidative stress in Wistar rats. Wastewater exposed rats exhibited necrosis of epithelial cells of nephron, pulmonary emphysema, and inflammation of the lungs, degradation and infiltration of cardiac myocytes, fibrosis of the liver, damage to the intestinal mucosa and sloughing off epithelial cells from the intestinal lumen. This study concludes that untreated textile dyeing wastewater being a complex mixture of inorganic and organic pollutants may be highly eco-toxic and may contaminate of the environment via continuous release of various organic and inorganic pollutants. Availability: Items available for loan: UVAS Library [Call number: 2580-T] (1). Place hold
Chemical, Microbiological And Toxicological Screening Of Tannery Effluent Wastewater

by Lubna Shakir | Prof. Dr. Muhammad Ashraf | Dr. Aftab | Dr. Aqeel Javeed.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2012Dissertation note: Over the last decade or so the chromium based tanning industry has shown rapid growth in Pakistan. However the rule and regulations promulgated by the government are not strictly followed for the processing of effluent discharged by the tanneries. Consequently tannery effluents have become a great source of water pollution in surrounding area. This project was designed to evaluate the hazardous effects of tannery effluent wastewater (TEW) through various bioassays. During the first phase of the project, composition of the TEW samples was determined by PIXE analysis. Besides this, we have also investigated the impact of TEW on trace element content of ground water in Kasur tannery area. The ground water from shallow tubewells (100 to 300 ft) in the area has shown very high content of chromium while the ground water from the deeper tubewells (upto 600 ft) generally does not contain the toxic elements except for one outlet of the water supplied by the Muncipal Corporation. This could be due to corroded pipes in the tannery area. Microbial load was determined during second phase of this research project by viable count method. The detected viable count was 7.5 X 104 to 3.0 X 107CFU/ml. Various strains of chromium tolerant bacilli were isolated and they were found tolerant up to 2600 µg/ml supplemented chromium sulphate. During the third phase of this research plan, dilutions of TEW were evaluated for their effects on angiogenesis using CAM assay. TEWD1 and potassium dichromate were found highly anti-angiogenic. Moreover, dilutions of TEW and potassium dichromate have demonstrated significant toxicity when assessed through marine shrimps mortality assay and phytotoxiciy assasy. Chronic toxicity study on Wistar rats was conducted in the last phase. Chronic exposure of TEW for three months to rats leads to the development of various lesions in lung, liver, kidney and heart of rats. In short, TEW and contaminated ground water of Kasur is imposing a great threat not only to local inhabitants of the city but also to the population of far distance. Availability: Items available for loan: UVAS Library [Call number: 1531,T] (1). Place hold
Clinico Epidemiology of tick Borne Hemoparasitic Diseases Using Single Round And Multiplex PCR Along With their Phylogenetic Analysis In Bovine

by Shahid Hussain Farooqi (2012-VA-447) | Dr. Muhammad Ijaz | Dr. Muhammad Hassan saleem.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: CD Crupt Availability: Items available for loan: UVAS Library [Call number: 2760-T] (1). Place hold
Clinico-Epidemiological And Experimental Observations On Feline Lower Urinary Tract Disease Among Domesticated Cats

by Abeera Naureen (2007-VA-541) | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr. Muhammad Arif Khan | Prof. Dr. Azhar Maqbool.

Material type: book Book; Literary form: not fiction Publisher: 2015Dissertation note: Idiopathic Feline Lower Urinary Tract Disease (iFLUTD) has been known as a major as well as important problem throughout the world especially the veterinary profession. Nicks of this problem also found in Pakistan, however the veterinarians are usually unable to properly diagnose this disease due to lack of knowledge as well as the ancillary diagnostic equipment availability for this disease. Present study was divided into two phases. Phase – 1 included clinico-epidemiological data. To this end, target of more than 502 domesticated client-owned cats of either sex, age, breed, etc showing signs of feline lower urinary tract disease (FLUTD) as per Buffington (1994) were examined accordingly from 3 different cities (Lahore, Faisalabad, and Islamabad) of Pakistan). All data collected was based on a predesigned proforma by using structured interview of the owners. Diagnosis was solely based on serum-cortisol levels, urinalysis, radiography and ultrasonography. Phase II involved experimental trial. The data obtained from whole of the study was then presented in tabulated form as frequencies and percentages. Treatment and outcome of the disease were also analyzed accordingly. According to the present study conducted it is proved that iFLUTD is present among the cats in Pakistan. Its proper cognizance among the Pakistani veterinarians is still non-existent and is misdiagnosed as colic or constipation issues in cats. The present study was undertaken to bring iFLUTD into the reportive of small animal practitioners working in Pakistan. The present study debunked various previous notions like iFLUTD is associated with commercial diets and canned foods only if we talk about this region majority of cases were noticed that had home-cooked food given by the owner. Moreover, cases in Siamese breed are larger than Persian breed. It has been strongly associated with Indoor housing management. Additional work is still needed to explore untouched areas of epidemiology including factors other than those being studied in the previous literature. Academicians in veterinary pathology and veterinary medicine of Pakistani universities should embrace this malady in the Doctor of Veterinary Medicine (DVM) curricula. According to the present study results it is concluded that two factors like stress and pain accelerate the sympathetic nervous system outflow compared to normal felines leading to the inflammatory response. Thus the stress factor must be reduced in the form of making hiding places for cats at home to reduced down the fear factor along with enhancing the feeling of owes for that particular place. Moreover, some more practices should be performed by the owner to reduce down the stress factor like playing with the pet, giving full attention, placing toys and other attractive things like yarn balls at the feline places (where they live/placed). There was no significant difference found between the groups based on the food with health score along with the therapeutic judgment. Hence, it is recommended that more experiments should be performed on larger scale to assess GAG therapy on increased number of felines and need of hour is to conduct more veterinary studies to get information and authenticity for its use against iFLUTD. From this study conducted, I recommend to the owners that the cats must be provided with the indoor hiding places and play with their pets in order to reduce the stress factor that increases the risk of idiopathic lower urinary tract disease. Moreover, the trend of home-cooked diet should be reduced along with increase in water intake by the cat. Availability: Items available for loan: UVAS Library [Call number: 2420-T] (1). Place hold
Clinico-Epidemiological And Therapeutic Study On Babesiosis In Different Breeds Of Cattle In Balochistan

by Muhammad Essa Kakar (2005-va-229) | Prof. Dr. Muhammad Arif Khan | Prof. Dr. Kamran Ashraf | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr. Muhammad Azam Kakar.

Material type: book Book; Literary form: not fiction Publisher: 2015Dissertation note: Babesiosis which is also called as piroplasmosisis, Texas fever, redwater or tick fever, is an emerging, tick-transmitted (by a vector ixodidea) disease caused by intraerythrocytic parasites of the genus babesia having considerable worldwide economic, medical, and veterinary impact. Keeping in view the importance of babesiosis under local conditions, the present study was designed to evaluate the status babesiosis in Balochistan. For this purpose field and experimental studies were carried in two districts Quetta and Sibi of Balochistan Province to find out the status of babesiosis in Bhag Nari, Holstein Friesian and Crossbred cattle. During field study epidemiological status of babesiosis was highlighted by selecting 600 cattle randomly from each district. The animals were distributed into 2 major groups i.e. Young animals less than 12 months and adult over 12 months of age. These groups were further sub-divided into Young animals (less than 6 months, up to 9 months and up to 12 months) while Adults animals (up to 2 years, 3 years and over 3 years). The vector of babesia was also kept under keen observation for the prevalence/infestation rate, identification and economic losses caused during the course of study. Blood samples were collected from each animal and processed for blood smears examination and PCR for further confirmation of babesia infection. The blood samples were also processed for hematological study to evaluate the effect of babesiosis on different blood parameters. For experimental study 148 animals were selected through clinical signs of babesiosis, blood smear examination and PCR. Out of theses 40 animals were maintained for therapeutic trail to find out the cheapest and easily available drug against bovine babesiosis. For this purpose Neem leaves were used in decoction form while Imidocarb dipopionate was kept as standard control. The Summary 177 results of epidemiological study revealed higher prevalence of babesiosis (20.5%) in district Quetta while 15.16% was recorded in District Sibi. Similarly higher prevalence was recorded in Holstein Friesian than in Crossbred and Bhag Nari cattle respectively in both districts Quetta and Sibi. Furthermore higher prevalence of babesiosis was recorded in adult groups of Holstein Friesian than in Crossbred and Bhag Nari cattle. Similarly season wise higher prevalence of babesia infection was noticed in summer followed by spring, autumn and winter respectively while higher prevalence was noted in female group of animals than male animals. Blood smears examination and PCR confirmed two babesia species i.e. babesia bigemina and babesia bovis. Similarly Boophilus tick species were identified as the vector of babesia parasites. During present study mixed hemoprotozaon infection of babesia mixed with theileria was recorded in both districts. The results of conventional method and modern diagnostic technique (PCR) revealed that PCR identified higher babesia infection during the entire 4 seasons as well as in all age groups whereas blood smears examination was capable to diagnose babesiosis in adult groups during the months of summer and spring season. Breed wise prevalence was also higher in samples treated with PCR than blood smears examination and even samples that were declared negative by blood smears examination were also found positive. The results of complete blood cell count from blood samples of infected experimental animal showed regenerative, macrocytic hypochromic anemia. Blood smear examination showed presence of many babesia with reticulocytes. Abnormalities in erythrocyte structure were seen. The result of blood parameters of total erythrocyte count, total leukocyte count, packed cell volume and hemoglobin showed significant decrease in all three affected Bhag Nari, Holstein Friesian and Cross bred cattle. The values of MCV and MCH were increased and MCHC was slightly less than normal value. No efficacy of neem decoction was noted against bovine babesiosis. Availability: Items available for loan: UVAS Library [Call number: 2367-T] (1). Place hold
Comparative Growth Rate And Body Composittion Of Major Carps (Labio Rohita , Cata Catla And Cirhinus Mrigala )

by Noor Khan | Prof . Dr . Grant William Vandenberg | Prof . Dr . Makhdoom Abdul Jabbar.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2011Dissertation note: Presently fish culture in Pakistan is primarily dependent on natural food produced in pond by the application of organic and inorganic fertilizers. It is supplemented with cheaper agriculture by-products to meet the nutrient deficiencies. Artificial feed which is a blend of various plant and animal by-products is rarely used. Development .of appropriate artificial feed now has become mandatory to transform conventional fish culture practices to advanced fish production systems to improve per unit fish production. The present study was therefore signed to formulate a quality supplementary feed from cheap and easily available feed ingredients that contains at least minimum required nutrients for different age groups (fingerlings and grow-out). The feeds developed during these studies were evaluated in terms of growth, diet utilizalion efficiency and its effect on the body composition and flesh quality of the three Indian majr carps (Catla cat/a, Labeo rohita and Cirrhinus mrigala).The study comprised of three trials. Trial I was conducted on fingerlings of individual species under monoculture system using 42% protein diet. Trials II and III were conducted on Grow-out fish using 35% protein diet under monoculture and polyculture systems. The study was conducted in earthen ponds having an area of 0.03 ha with three replicates and a control. After preliminary preparation of ponds, in trial I, fingerlings were stocked at 80 fish per pond. while in trial II at 70 fish of each species and in trial III ratio of 30%, 50% and 20% of Catla catla, Labeo rohita and Cirrhinus mrigala per pond were maintained. All the ponds received same amount of organic and inorganic fertilizers (cow dung, poultry manure, SSP and urea) thoughout the experimental period. Supplementary feed in trial I was applied at 4% of fish wet body while in trial II and III feed was applied at 3% of fish wet body weight daily. In trial I 42% protein diet was used containing fish meal. soybean meal. maize gluten (60%). rice polish, wheat bran. maize grains. molasses. vitamins and minerals while in trial II and III 3YYo protein diet containing fish meal, soybean meal. canola meal. rice polish. wheat bran, molasses, vitamins and mineral was used. Growth parameters in terms of length and weight gam were regularly monitored fortnightly. Organolept sensory evaluation was done at the termination of each trial. Proximate fish body composition was determined at the start and at the end of the experimental trials. Fatty acid profile of three experiments was performed at the post-trial basis. In addition, specific growth rate (SGR), feed conversion ratio (FeR). protein efficiency ratio (PER). protein utilization (PU). gross nitrogen retention efficiency (G RE %) and gross energy retention efficiency (GERE %) were also determined. Proximate analysis of feed ingredients and formulated diets was also done. Key physico-chemical parameters viz. temperature, dissolved oxygen (DO), free CO2, pH, electrical conductivity, total dissolved solids, light penetration. salinity and nitrates, were regularly monitored during the study period. In trial I the highest net weight gain was observed in treatment group (D 1) (Catla calla 9425.83 g and 171.5 mm) followed by Labeo rohita (374.34 g and 178.7 mm) and Cirrhinus mrigala (288.18 g and 161.9mm). The lowest growth was observed in Cirrhinus mrigala (176.9 g and 116.4 mm) in control (DO). A significant difference was observed regarding net weight gain among three fish species and between different treatments (DO and 0 I). The net weight gain was significantly higher in trial I treated (01) ponds than control (~O). Percent weight gain and specific growth rate (SGR %) were also determined. Labeo rohita exhibited higher values (1762.51 % and 3.03%) followed by Catla calla (1341.58% and 2.95%), while Cirrhinus mrigala showed lowest (976.17% and 2.6%) with experimental diet (DI) Again Cirrhinus mrigala exhibited lowest percent weight gain and SGR (300.85% and '1.54%)in control (DO) ponds. In trial II grow-out under monoculture the net weight gain of fish differed significantly among three fish species and between treatments (DO and D2). Calla catla showed highest net weight gain (37\.88 g and 72.2 mm) followed by Labeo rohita (310.18 g and 72.3 mm) and Cirrhinus mrigala (270.75 g and 57 mm) in experimental unit (02) while a lowest net weight gain of Cirrhinus mrigala (162.15 g and 36.5 mrn ) was observed in control (DO). Percent weight gain and specific growth rate of three fish species Catla catla, Cirrhinus mrigala and Labeo rohita under different treatments were found non-significant. Although Catla catla showed highest percent weight gain and SGR values (109.78% and 0.81 %) followed by Labeo rohita (90.93% and 0.69%) and Cirrhinus mrigala (84.3% and 0.65%), respectively with experimental diet (D2). Lowest values of percent weight gain and SGR (48.54% and 0.43%) were observed for Cirrhinus mrigala in control ponds (DO). In trial III grow-out under poly culture the average final weight of fish was significantly different in control (~O) and experimental diets (02) while species showed non-significant difference regarding final weight and net weight gain. The highest final and net weight gain of Lobeo rohita (679.46 g and 370.5 g) followed by Cirrhinus mrigala (674.52 g and 303.86 g ) and Catla catla (607.2 and 307.06 g), respectively in experimental unit (D2) while Catla catla exhibited lowest final weight and net gain in weight (493 g and 182.3 g) in control (DO). Regarding percent weight gain and specific growth rate of three fish species under polyculture system no significant difference was observed hence, Labeo rohita showed highest percent weight gain and SGR (126.87% and 0.9%) followed by Catla catla (l 02.31 % and 0.76%) and Cirrhinus mrigala (85.15% and 0.63%), respectively with experimental diet, while Cirrhinus mrigala once again showed lowest values (40.12% and 0.37%), respectively in control diet (DO). Feed conversion ratio (FCR), protein efficiency ratio (PER), protein utilization (PU), gross nitrogen retention efficiency (GNRE %) and gross energy retention efficiency (GERE %), in all the three experiments under monoculture as well as in polyculture system, for fingerlings and grow-out fish of three species were found non-significantly different. However, in trial I fingerlings better FCR values (1.63, 1.56 and 1.43) were obtained for Catla catla, Cirrhinus Mrigala and Labeo rohita. Regarding gross nitrogen retention efficiency Catla catla showed highest GNRE % value (10.4) followed by Labeo rohita (9.3) and were found significantly different from Cirrhinus mrigala (6.5) in experimental unit. In trial II grow-out monoculture, FCR values 3.7. 4.57 and 4.56 for Calla calla. Cirrhinus mrigala and Labeo rohita were pbtained while GNRE % varied 9.5,5.8 and 8.0. respectively. In trial III grow-out poIyculture the FCR values of three species varied from 3.99, 4.72 and 3.61, respectively while GNRE % varied from 10.3, 8.2 and 12.5%, respectively among Calla catla, Cirrhinus mrigala and Labeo Rohita. The Labeo rohita for GNRE% differed significantly from other two species. No significant difference among species and between diets (DO, D 1 and D2) was observed in proximate composition in all the three experiments. However, in case of fingerlings Labeo rohita under experimental diet (D 1) showed higher protein contents (16.44<Yo) while Catla catla showed the lowest protein content (12.9%). Crude fat contents were found highest (7.28 %) in Labeo rohita with control diet (DO) followed by Cirrhinus mrigala (6.96 %) and Labeo rohita (6.S2 %) in experimental diet (01) while lowest values were observed for Calla catla (4.17%) in control (DO). The Ash contents showed minor variations among species and treatments ranged from (4.81 % and 3.S6%) for Catla catla, (4.34% and 4.7S%) for Cirrhinus mrigala and (3.98% and 4.49%) for Labeo rohita in control and treated ponds, respectively. Highest gross energy was found (6.S3MJg'l) for Labeo rohita and lowest (S.OMJg'l) for Catla catla with experimental diet (D 1). In trial II grow-out monoculture the highest crude protein contents (1S .16%) were observed in Labeo rohita followed by Cirrhinus mrigala (14.S3%) with control diet (~O) while lowest for Labeo rohita (12.13%) in (02). Higher contents of crude fat (7.31 %) were observed in Cirrhinus mrigala followed by Catla catla (S.38%) in experimental group and lowest amount 3.18% and 3.19% was observed for Cirrhinus mrigala and Catla catla in control group (~O) . . Higher amount 4.11 % was found in Catla catla under control (~O) while lowest amount 3.1 % was observed in Labeo rohita under experimental diet (D2). Highest gross energy percentage 996.13%) was observed for Cirrhinus mrigala under experimental diet (D2) while lowest 4.91 % was observed for Catla catla in control group (DO). In case of experiment III grow-out polyculture the proximate body composition highest crude protein contents (IS.76% and 10.53%) were observed for Cirrhinus mrigala followed by catla catla 911.87% and 13.3S%) and Labeo rohita (12.72% and 6.S6%) in treated (D2) and control (DO) group. respectively. Higher crude fat contents (6.S7%) were observed in Cirrhinus mrigala under (D2) while lowest (3.13%) in Labeo rohita and (2.9S%) in Catla catla. Ash percentage was found higher in Catla catla and lowest (2.14%) in Labeo rohita and Cirrhinus mrigala (2.87%) under (DO). Gross energy contents were found highest (6.84MJg,l) in catlacalla under (DO) and (6.56MJg,l) Cirrhinus mrigala under (D2) while lowest amount (3.24MJg.l) were observed in Labeo rohita under (DO). Mineral composition of three fish species under three dfferent experiments showed non- sign ificant differences. Minor variation regarding mineral composition was observed in pre- treatment and post-treatment level. However. Ca and P contents showed relatively higher percentage than Mg and K contents in all the three experiments. A significant difference was observed in Mg contents in experiment III where Catla catla showed significantly higher (0.045%) percentage than Cirrhinus mrigala and Labeo rohita each containing 0.02%. A significant difference was observed in fatty acid profile among three fish species and between diets (~O, Oland D2). Among fatty acids, palmitic acid (C 16:0) was found a dominating fatty acids in all the three experiments. In trial I highest concentration (40.59 g 100 g-1 was found in Cirrhinus mrigala under (DO) and 37.19 in (D1) while lowest (30.75 and 30.78 g 100 g.l) in Labeo rohita and Catla catla under (D 1). The concentration of total saturated fatty acids were observed higher and ranged from (40.20 to 53.29 g 100 g-I) followed by total monounsaturated fatty acids (29.30 to 37.81 g 100 g-I), w-6 PUFA (7.65 to 14.94 g 100 g') and @-3 PUFA (7.76 to 11.07 g 100 g-I). respectively. In case of trial II significant differences were also found among three fish species and diets (D0 and 02) for different fatty acids composition. Palmitic acid (C 16:0) also showed highest concentration ranged from 28.36 to 29.73 g 100 g-I). Total saturated fatty acids were found higher that varied from (35.90 to 39.41 g 100 g-I) followed by total monounsaturated fatty acids (36.52 to 40.84 g 100 g-I), and l:PUFA (19.02 to 24.40 g 100 g-I), respectively. In trial III once again same pattern of dominance of palmitic acid along with total saturated fatty acids (36.43 to 42.24 g 100 g-I) followed by total monounsaturated fatty acids (36.899 to 43.72 g 100 g-I) and 2:PUFA (14.97 to 23.03 g 100 g-I) were observed. In case of organoleptic evaluation all the species under di Iferent culture system and treatments illustrated non-significant differences. Hence. significant differences were observed among different cooking processes (steamed and fried fish). The physico-chemical parameters of pond water remained within the acceptable limit for Fish gowth. Although comparatively lower values of temperature were found for experiment II and III for grow-out trial that was conducted in fall. The correlation co-efficient studies revealed a positive significant correlation of temperature, TDS, light penetration and salinity with growth of fish species while pH showed positive non-significant correlation with growth of fish. It was concluded from the present study that both the experimental diets D I and 02 for different age groups (fingerlings and grow-out) showed significantly higher growth of all the three species in monoculture system. The diet D2 did not showed any significant higher growth in polyculture system but overall growth performance remained high in polyculture than monoculture treated ponds of grow-out fish. Comparison of species indicated that artificial diets (DI and D2) remained much suitable for Catla catla and Labeo rohita than Cirrhinus mrigala under both the culture systems. Non-significant difference was observed in the body composition and flesh quality irrespective of their economic viability. Information derived from the present research experiments will be useful in future research and formulating supplementary feed for Indian major craps for different age groups. It can also be helpful in understanding the mineral and fatty aeid profiles of the Indian major carps cultured under semi-intensive pond culure system whieh is first study of its kind on these species in Pakistan. Availability: Items available for loan: UVAS Library [Call number: 1290,T] (1). Place hold
Comparative Productive And Reproductive Performance Of Beetal Goats In Accelerated And Annual Kidding Systems

by Nisar Ahmad | Prof. Dr. Khalid Javed | Prof. Dr. Muhammad Abdullah.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2013Dissertation note: Three kiddings in two years or five kiddings in three years refers as accelerated kidding which is helpful to have more kids, helps to fetch higher market prices during off-season. This can also increase life time production in the form of meat, milk and fiber. High reproduction rate is the basiccondition to increase efficiency of production. Most of the goats do not follow seasonal breeding pattern and breed round the year resulting in management problems and high mortality during severe weather conditions. Accelerated kidding strategy is a viable option that affects the health and fertility of the flock. In the present investigation, three experiments were conducted at Small Ruminant Training and Research Centre (SRT&RC) Ravi Campus Pattoki, UVAS, Lahore. The experiment-I was about the initiation of estrus activity in anestrus Beetal goats during low breeding season. Twenty Beetal goats were selected from the existing flock, maintained at SRT&RC. These goats were divided randomly into 4 groups i.e. A, B, C and D having 5 animals in each group. Group A was treated as negative control by offering only green fodder, group B was provided flushing ration along with green fodder (control), group C was kept on green fodder along with hormone therapy of gonadotropin releasing hormone (GnRH) and prostagladin (PGF2?) while group D was provided with green fodder, flushing ration (600 gms/animal) and hormone therapy by providing GnRH and PGF2?. Hundred percent estrus induction was achieved in group B, C and D as compared to group A. The results revealed that fertility rate and kidding rate was high i.e. 80 and 60 percent among animals of B group while animals of control group had less fertility, kidding and gestation rate. The shortest gestation length was found in group B and C while triplet births were observed in goats of group D. The experiment-II was regarding the initiation of estrus through buck effect in Beetal goats. This experiment was conducted in two phases. Phase 1 comprised two groups A and B for which estrus induction was done during pre-breeding (August) and normal breeding (September/October) season. Similarly, Phase 2 comprised two groups C and D in which estrus induction was done during post-breeding (December) and normal breeding (September/October) season. Different reproductive parameters like estrus, fertility percentage, were noted. The data regarding average birth weight (kg) and gestation length (days) were recorded. Estrus signs were maximum in group B while low in group C. However fertility rate was high in group A, instead of group B. Overall kidding percentage was higher in A group but the lowest in group D. The highest gestation length was observed in group D whereas the lowest value was found in group B. Average litter size was higher in group D as compared to A and B group, respectively. The experiment-III was conducted to compare productive and reproductive performance of Beetal goats in accelerated and annual kidding systems. Total of 50 adult Beetal goats were divided into two groups viz. accelerated kidding and annual kidding having 25 animals each. The does were selected on the basis of their age, body size, weight and parity. Different breeding bucks were used for each group having similar size, weight and age. All the animals included in this study were fed according to national research council (NRC) nutrient requirements for goats (NRC, 1981). Flushing rations and estrus inducing hormones both were provided to the does of respective groups for preparation of breeding activity during out of season breeding. The annual kidding group was considered as the control group, while the does were bred every eight months for accelerated kidding. The offsprings produced by the pregnant does of 1st batch of both the groups were reared under similar managemental conditions up to maturity. Three crops were produced in accelerated kidding system as compared to two crops in annual kidding system. It was observed that more number of animals i.e. 17 out of 25 showed estrus signs as compared to annual kidding system where 15 animals showed estrus signs. There were non significant differences for number of services per conceptionin two crops under annual kidding groups. Higher percentage of estrus was observed in accelerated to annual kidding. Total number of kids produced in accelerated kidding system was 42 with an average 14 kids in three crops while 23 kids were produced in annual kidding system in two years. Average cost of concentrate was observed high in accelerated kidding system as compared to annual kidding system. Birth weight of kids produced in 3 different seasons i.e. March-April, October- November and June-July were found as 2.84, 2.91 and 2.98 kg. The overall results in term of reproductive efficiency, oestrus behavior and kidding percentage were better in accelerated group than annual kidding. Availability: Items available for loan: UVAS Library [Call number: 1812,T] (1). Place hold
Comparison Of Diagnostic Approaches For The Detection Of Bovine Viral Diarrhea Persistency In Dairy Herds

by Arfan Ahmad | Prof. Dr. Masood Rabbani | Prof. Dr. Khushi Muhammad.

Material type: book Book; Format: print Publisher: 2012Dissertation note: Bovine viral diarrhea is one of the most important diseases of cattle which are causing continuous economic losses to the cattle industry primarily due to decreased reproductive I performance. Without doubt, direct contact between BVDV persistently infected, and susceptible animals is the most important transmission route of virus. All control programs which are in use in many countries of the world, mainly depend upon the detection of PI animals, eliminating them and preventing their return into the herds. Therefore, in this study diagnostic suitability of ear notch biopsies and serum samples were compared for the detection of PI animals, as well as proficiency of various diagnostic approaches like VI, AC-ELISA, IHC and real time RT-PCR were evaluated using ear notch biopsies. A total of 468 samples were collected from 12 participating dairy cattle farms located at Prince Edward Island, Canada. The samples were divided into two groups on the basis of age, A " 6 months), and B (> 6 months). PI calves remain immunotolerant to the infecting strain but if exposed to a heterogonous strain postnatally, they may develop low level of antibody. Accordingly, serum neutralization was applied for initial screening of samples for further testing. The samples of animals of group B, having SNT (:S 1 :64) were selected, while all samples of younger aged group A were processed without considering the serum neutralizing titres, because unlike older animals, P.1. animals below 6 months of age can have passive colostral antibodies in the course of persistency. Diagnostic suitability of ear notch biopsy and serum sample for confirmation of BVDV A significant discrepancy was observed between ear notch biopsies (51198 positive) and serum samples (71198 positive) during first round of testing by real time RT-PCR. However, on follow up testing, 30 days post first round of testing, a complete agreement between ear notch biopsies and serum samples was observed. On second round of testing, a total of 4 animals out of 197 (one positive animals died before re-sampling) were confirmed with PI, using both ear notch biopsies and serum samples. The decrease in the positivity using RT-PCR on serum samples in the second round of testing reflected the presence of 2 transiently infected animals. Ear notch biopsy (EN) testing did not detect any transiently infected animal indicating the lack of delectability of the virus in EN during transient infection under conditions of this study. After follow up testing, 2 animals in each of group A and B were identified as PI. These findings have led us to conclude, that either serum or ear notch biopsy can be used for the detection of persistent infection. Of 468 collected and 197 tested samples, an overall 0.85% and 2.03% prevalence of PI animals with BVDV was observed respectively. A complete agreement (P value=l) was observed when three diagnostic approaches (Real time RT- PCR, AC-ELISA, and IHC) were compared with standard of VI. A total of 197 ear notch biopsies (145 of group A and 52 of group B) were tested by the four diagnostic tests, four animals (2 from group A and 2 from group B) were found positive by all the tests applied. A complete agreement was observed between the first and the second round of testing. All four assays were found specific but real time RT-PCR was found to be more sensitive. Both, VI and IHC were found labour intensive, as diagnosis may take more than one week to be made. Further PI calves remain immunotolerant tothe infecting strain but if exposed to a heterogonous strain postnatally, they may develop low leved ofantibody. Accordingly, serum neutralization was applied for initial screening of samples for further testing. The samples of animals of group B, having SNT (:S 1 :64) were selected, while all samples of younger aged group A were processed without considering the serum neutralizing titres, because unlike older animals, P.1. animals below 6 months of age can have passive colostral antibodies in the course of persistency. Diagnostic suitability of ear notch biopsy and serum sample for confirmation of BVDV persistent animals were evaluated by real time RT-PCR. TaqMan probes and primers specific for BVDVI and BVDV2 were used. They were found specific and able to detect 10·s and 10-4 TCID50 units ofBVDVI and BVDV2, respectively. Availability: Items available for loan: UVAS Library [Call number: 1407,T] (1). Place hold
Comunity Druven Sustainable Management Of Natural Resources Of Taunsa Barrage Wildlife Sanctuaty,

by Fehmeeda Bibi | Dr. Zulfiqar Ali.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2012Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1496,T] (1). Place hold
Detection Of Falciparum Malaria And Its Control Under Local Climatic Conditions

by Muhammad Oneeb | Prof. Dr. Azhar Maqbool | Dr. Muhammad Lateef | Prof. Dr.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2180,T] (1). Place hold
Detection Of Vivax Malaria And Under Local Climatic Conditions

by Sarwat naz | Prof.Dr. Azhar maqbool | Prof. Dr. Mansur ud din ahmad.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2012Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2060,T] (1). Place hold
Develoopment Of A Reliable Microsatellites Maarkers Panel For Parentage Analysis In Cattle Breeds Of Pakistan and Its Validatio Through Cytochrome B Gene Sequencing

by Tanveer Hussain | Prof. Dr. Masroor Ellahi Babar | Dr. Ahmad Ali | Dr. Muhammad Wasim.

Material type: book Book; Format: print Publisher: 2013Dissertation note: Pakistan posseses enormous Animal Genetic Resource (AnGR) with 36.9 millions of cattle population. The data on genetic fabric of these breed is yet to be documented for their genetic characterization and identification. This work reports first country wide microsatellite markers and cytochrome b gene based genetic characterization of 10 famous cattle breeds of Pakistan. A total of 352 blood samples from unrelated and phenotypically representative of ten native cattle breeds including Bos indicus; Sahiwal, Cholistani, Red Sindhi, Tharparker, Dhanni, Dajal, Lohai, Bhagnari, Achai and Bos indicus x Bos taurus; Nari Master, and an exotic Bos taurus; Holstein Friesian breeds were collected from their respective home tracts, institutional herds and private livestock farms located throughtout the country. These samples were subject to DNA extraction using inorganic method caliberated to same concentration in Molecular Biology and Genomics Laboratory of the Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore Pakistan. A total of 21 microsatellite markers recommended by the programme for the global management of genetic resources (MoDAD) for breed characterization of Food and Agriculture Organization (FAO) of the United Nations and International Society for Animal Genetics (ISAG) were applied. Multiplex PCR were optimized for amplification and were genotyped using ABI Genetic Analyzer 3130 xl using LIZ as size standard. Genotyping results were analyzed using POPGENE and Arlequin ver 3.5 software. The observed and effective number of alleles ranged from 10 (INRA32) to 43 (TGLA126) and 2.3574 (CSSM66) to 15.0019 (BM6526) respectively in all breeds? The observed and expected heterozygosity estimates ranged from 0.0638 (INRA32) to 0.7101 (BM2113) and 0.6510 (INRA32) to 0.9347 (BM6526) respectively in the experimental samples. Mean values for observed and expected heterozygosity was 0.4943 ± 0.1647 and 0.8164 ± 0.0930 respectively. Mean values for Fis, Fit and Fst in all cattle breeds were calculated as 0.2819, 0.3864 and 0.1456 respectively. Average polymorphic information content (PIC) of all microsatellite loci was 0.81 indicating a high degree of informativeness of all microsatellite markers used. It implies that the same set of markers is equally good and could reliably be used for parentage confirmation in Pakistani cattle breeds. The data produced, also showed least degree of genetic difference between Red Sindhi and Tharparker breeds. This may due to mixing of the two breeds for being in close proximity of their home tracts. Fragment mitochondrial cytochrome b gene was also amplified using specific primers through PCR of 130 individuals representing all selected breeds and sequencing was done using ABI Genetic Analyzer 3130 xl. The sequences were aligned and analyzed with CodonCode Alligner 4.0.4 software. The analysis revealed highly degree of sequence conservation in all the Pakistani cattle while documenting changes in only 9 nucleotides from 26 individuals whereas multiple nucleotide changes in 5 locations were shown by more than one individual in the data presented. One polymorphic site was found in nucleotide 318 (T?C) in several breeds of indicine cattle while 2 Lohani and 5 Nari Master individuals showed nucleotide changes specific to taurine cattle. Of all the changes found, only three of them caused changes in the amino acid sequence. The UPGMA tree using MEGA 5.1 showed a clear differentiation between taurine and indicine cattle, except for Nari Master Pakistani cattle showing mitochondrial taurine sequences because it's a cross between Bhagnari (Bos indicus) and Australian Draught Master (Bos taurrus). The estimates of divergence among breeds were also low for most breed pairs, except for Nari Master and Dhanni whereas the overall divergence within Bos indicus or within Bos taurus were also very low (0.002 and 0.003, respectively) but the differences between Bos indicus and Bos taurus were significantly higher (0.014) as should be the case. These results of microsatellite markers have produced a set of information that can be recommended as a reliable marker panel for studies on genetic diversity analysis, parentage confirmation. The cytochrome b data on the other hand not only substantiated genetic diversity analyses but it also proved to be equally good for comparative Phylogenetic analysis of Pakistani cattle breeds and exotic breeds. This work provides most authenticated data and adds a great deal, to already existing information on Pakistani AnGR. This information coupled with prospective data using next generation genetic technologies will assist designing breed improvement focused breeding policies and conservation activities in future. Availability: Items available for loan: UVAS Library [Call number: 1597,T] (1). Place hold
Development And Evaluation Of Vaccines Prepared From Staphylococcus Aureus Isolates Of Camel Mastitis

by Amjad Islam Aqib (2013-VA-947) | Dr. Muhammad Ijaz | Dr. Riaz Hussain | Prof. Dr. Aneela Zameer Durrani | Prof. Dr. Aftab Ahmad Anjum.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Development And Evaluation Of Vaccines Prepared From Staphylococcus Aureus Isolates Of Camel Mastitis Availability: Items available for loan: UVAS Library [Call number: 2750-T] (1). Place hold
Development Of A Suitable Semen Extender For The Cryopreservation Of Nili Ravi Buffalo Bull (Bubalus Bubalis) Semen

by Fazal Wadood (2007-VA-557) | Prof. Dr. Muhammad Aleem | Dr. Muhammad Younas | Prof. Dr. Nasim Ahmad | Prof. Dr. Ijaz Ahmad.

Material type: book Book; Literary form: not fiction Publisher: 2015Dissertation note: Presently, buffalo farmers are dissatisfied with fertility rates of the frozen semen used in the field and tend to use bulls. This study was designed to develop a suitable semen extender for cryopreservation of Nili Ravi buffalo semen that can improve conception rate in buffaloes. Experiment-I, an attempt was made to develop semen extender with optimal osmotic pressure for buffalo semen using tris citric acid (TCAE), skim milk (SME) and coconut water (CWE) extenders (each extender have 260, 270, 280, 290 and 300 mOsm/kg osmotic pressure levels). In Experiment-II, best extender (TCAE: 300 mOsm/kg) of experiment-I was tried to improve post thaw spermatozoa characteristics by supplementing antioxidants [0.0, 1.75, 2.0 and 2.25 mM butylated hydroxy toluene (BHT) and 0.0, 2.0, 5.0 and 8.0 mM L-cysteine]. Post thaw spermatozoa motility, viability, plasma membrane integrity (PMI), DNA damage rate and lipid peroxidation were assessed in first two experiments. In Experiment-III, pregnancy rate assessment of extended semen was carried out by using Trial extender (best of experiment II) or Control extender of Semen Production Unit (SPU), Qadirabad, Pakistan (50 inseminations of each extender). Higher spermatozoa motility at ≥ 270 mOsm/kg was noted in TCAE than both SME and CWE could be due to less intracellular ice formation in zwitterions extender. Higher spermatozoa viability in TCAE and CWE compared to SME may be attributed to extender effectiveness. Higher acrosomal integrity rate at 300 mOsm/kg in TCAE and SME may be because of less intracellular ice formation in isotonic extenders. At 290 mOsm/kg, higher spermatozoa PMI in SME and lesser DNA damage in three extenders might be due to lesser intracellular ice formation at cryopreservation. Decreased spermatozoa DNA damage in SME might be due to the presence of natural antioxidants i.e., casein. Higher lipid peroxidation in CWE than TCAE and SME may be due to presence of natural antioxidants (in SME) and higher cell dehydration potential of TCAE. Higher spermatozoa motility recorded at 2.0 mM BHT compared to other BHT groups including DMSO might be due to fact that BHT protects spermatozoa mitochondria by reducing oxidative stress. Lower spermatozoa viability, PMI rates and higher DNA damage at 2.25 mM of BHT may be due to BHT toxic effects. Lower lipid peroxidation in BHT treated groups compared to DMSO and BHT control groups might be related to BHT strong antioxidant properties. L-cysteine caused higher spermatozoa DNA damage at highest level (i.e., 8 mM) that could also be due to antioxidant’s toxic effect. Pregnancy rate 18 % higher was noted in Trial than Control semen extender; however no significant difference have been noted that might be due to less no of inseminations. In conclusion, TCA extender (300 mOsm/kg) having BHT (2.0 mM) improved post thaw semen quality and yielded numerically better pregnancy rates. Results of study indicated that osmotic stress damaged the spermatozoa internal structures more severely than injury to plasma membrane. Availability: Items available for loan: UVAS Library [Call number: 2360-T] (1). Place hold
Differential Expression And Mutation Analysis Of Heat Shock Proteins (Hsps) And Tumor Suppressor Gene (P53) In Differemt Cancer Types of Pakistani Dogs and Cats

by Rashid Saif | Dr. Muhammad Wasim | Dr. Ali Raza Awan | Dr. Muhammad.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2170,T] (1). Place hold
Documenting Goat Production System In Two Agro-Ecological Regions Of Punjab

by Maqsood shah muhammad | Prof. Dr. Muhammad Abdullah | Prof. Dr | Prof. Dr. Khalid javed.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1920,T] (1). Place hold
Effect Of Bacillus Subtilis And Sodium Butyrate On The Morphometry Of The Small Intestine And Immune System In Healthy And Salmonella-Challenged Broiler Chickens

by Arbab Sikandar (2005-VA-154) | Dr. Hafsa Zaneb | Prof. Dr. muhammad Younus | Dr. Sima Masood | Prof. Dr. Asim Aslam.

Material type: book Book; Literary form: not fiction Publisher: 2017Dissertation note: Supplementation ofBacillus subtilis and microencapsulated sodium butyrate in the feed is being practiced as a substitute for antibiotics growth promoters. An expansive range of encouraging health-related properties exhibited by B. subtilis and SB has been published, but their exact effect on gut and immune system is not completely understood. Consequently, the evaluation of B. subtilis andSB as feed supplements is desired. To achieve this goal, the present study was aimed to investigate the effects of B. subtilis and SB on performance, immune system, gut and lymphoid organs microarchitecture in healthy and Salmonella-challenged broiler chickens. In the first experiment the research was targeted to investigate the effects of B. subtilis on performance, immune system, gut and lymphoid organ microarchitecture in broilers. A total of 120 d-old broiler chicks were randomly distributed into four groups, each group with three replicates containing 10 birds per replicate. The birds were fed a corn-soy-based basal diet (BD, control) or BD supplemented with 10% zinc bacitracin (ZnB), and 0.05g/kg or 0.1g/kg of B. subtilis, respectively. On d 21 and 35, six birds from each group were killed to collect blood and visceral organs (thymus, spleen, bursa of Fabricius, liver and small intestine). Parameters evaluated included growth performance, immune responses, relative organ weights, lymphoid organs and gut mucosal morphometry, intraepithelial lymphocytes (IEL) count and goblet cell histochemistry in mucosa. Results showed that the group fed 0.1g/kg of B. subtilis had superior (P<0.05) mean body weight and weight gain, and lower FCR compared to the non-supplemented or ZnB-fed groups.The BS-0.1 group revealed higher antibody titer against Newcastle disease (ND) virus and the supplemented groups against sheep RBCs (SRBCs) on d 35. Cell-mediated immune response post-phytohemagglutinin-P injection was attained (P<0.05) by birds in the BS-0.1 group at 24h, and by both the BS-0.1 and BS-0.05 groups at 48 and 72h compared to the ZnB and control groups. The BS-0.1 group gained higher (P<0.05) relative bursal weight on d 21 compared to the other groups. Compared to the control group, the liver, spleen and thymus weighed more (P<0.05) in the experimental groups on d 35. The histomorphological study revealed increased (P<0.05) thymus cortical width, and cortex/medulla ratio in the BS-0.1 group compared to the control. The area of the bursal follicles and germinal centers of the spleen also improved (P<0.05) in the BS-0.1 group compared to the control. Compared to the ZnB and control, higher (P<0.05) villus height, villus surface area and villus crypt ratio of the duodenum and jejunum were recorded on d 21, and higher (P<0.05) villus heightof the duodenum and ileum was noted on d 35 in the BS-0.1 and BS-0.05 groups. The number of goblet cells having acid mucin was significantly higher in the ileal mucosae of the BS-0.1 group chickens compared to the ZnB and control. In conclusion, B. subtilis type probiotics effectuated better growth performance, improved immune system and modulated morphology of lymphoid organs and gut mucosa in broilers. The second experiment was carried out to evaluate the effects of sodium butyrate on growth performance, immune status, organ weights and the microarchitecture of lymphoid organs and the small intestine compared to the effects brought about by an antibiotic. The cell-mediated immune response at 48 h post-phytohemagglutinin-P injection, and antibody titer against NDV and sheep RBCs on d 35 was higher (P < 0.05) in SB-1 chicks compared to those in the ZnB and control groups. Higher (P < 0.05) weight gain, and lower (P < 0.05) FCR were attained by the supplemented groups compared to the control. The thymus and spleen weighed more (P < 0.05) in the SB-1 group and bursa registered more (P < 0.05) weight in both SB groups compared to the control. On d 21, areas of the thymus medulla and the spleen germinal centers were larger (P < 0.05) in SB-1 chicks compared to ZnB and control chicks. The VH and VSA increased (P < 0.05) in the duodenum and jejunum in both SB groups on d 21, and in SB-1 on d 35 compared to the ZnB and control groups. The villus to crypt ratio was higher (P < 0.05) in the duodenum in SB-1 chicks compared to ZnB and control chicks. On d 35, VH in all segments and VSA in the duodenum and jejunum increased (P < 0.05) in SB-1 chicks compared to ZnB and control chicks. Statistically, IEL count was not significant among supplemented groups. On d 21, the number of goblet cells containing acidic mucin increased (P < 0.05) in all the segments of the small intestines in the SB-1 group compared to the control group and on d 35 in the ileum compared to the other groups. In conclusion sodium butyrate elicited better growth performance, improved immune system and modulated the morphology of lymphoid organs and the gut mucosa in broiler chickens. The third experiment was focused to assess the effect of B. subtilis and SB on gut development, growth performance and immune system in broilers challenged with S. Gallinarum. Better growth performance was reported in the supplemented groups compared to the NC-S group due to better feed efficiency. The B. subtilis-supplemented group exhibited higher (P < 0.05) cellular immunity and antibody titer against NDV compared to the PC-S and NC-S groups. Furthermore, B. subtilis¬- and SB-supplemented groups reflected higher (P < 0.05) relative thymus and bursa weights, and improved microarchitecture of the lymphoid organs compared to the NC-S group. On d 21, villus surface area in the jejunum and ileum increased (P < 0.05) in sodium butyrate-treated birds. The crypt depth of the jejunum decreased (P < 0.05) in B. subtilis and sodium butyrate groups compared to NC-S and PC-S groups. On d 35, the villus height, villus surface area and VH:CD ratio of the duodenum increased (P < 0.05) in the supplemented groups compared to the NC-S group. The FCR, Salmonella population in ceca and mortality were higher (P < 0.05) in the NC-S group. In conclusion, the prophylactic use of the B. subtilis probiotic and SB alleviated stress associated with SalmonellaGallinarum infection and improved performance, immune function, lymphoid organs and gut mucosal development in infected broilers. Further analyses are needed to reveal the mechanism(s) by which B. subtilis and sodium butyrate produce such effects. Availability: Items available for loan: UVAS Library [Call number: 2790-T] (1). Place hold
Effect Of Colchicine On Cellular And Humoral Immune Responses In Mice

by Shahzada Khurram Syed (2007-VA-444) | Dr. Aqeel Javeed | Prof. Dr. Muhammad Ashraf | Dr. Jawad Nazir | Dr. Shahbaz Yousaf.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Colchicine is a medication that treats gout. It is a natural product and secondary metabolite, originally extracted from plants Colchicum autumnale .It causes modulation of chemokine and prostanoid production and inhibition of neutrophil and endothelial cell adhesion molecules by which it interferes with the initiation and amplification of the joint inflammation. The present study is designed to evaluate the effects of colchicine on cellular and humoral immunity in mice. There were five groups for each assay i.e. group I (negative control), positive control and three colchicine treated group II (40μg/kg), group III (80μg/kg) and group IV (160μg/kg). The number of mice in each group was five to eight. All these groups were administered doses intraperitoneally. To determine the effect of colchicine on cell mediated immunity , delayed type hypersensitivity (DTH) assay, macrophage engulfment assay, cyclophosphamide induced neutropenic test and nitric oxide production was performed .DTH was performed by measuring skin thickness. DTH showed significant difference (P<0.001) of negative control to colchicine treated groups 40μg/kg, 80μg/kg and 160μg/kg. With increasing dose, there was decrease in skin thickness of the mice. Highest reduction of skin was found at 160μg/kg. Macrophage engulfment assay was performed to evaluate the effect of macrophage induced phagocytosis. There was significant ( P <0.001) difference of engulfment of SRBCs by macrophages with negative control to colchicine treated group II (40μg/kg), group III(80μg/kg) and group IV(160μg/kg) groups. There was significant difference of engulfment of macrophages at 45 and 90 minutes. Cyclophosphamide induced neutropenic test was performed to assess the effect of colchicine on total leukocyte count (TLC) and differential leukocyte count (DLC). There was SUMMARY 77 reduction of TLC to about 45.3% in control to 48.3%, 54.68% and 65.42% in group II (40μg/kg), group III (80 μg/ kg) and group IV (160μg/kg) respectively when these were compared with primary values of TLC. There was significant difference of reduction in the neutrophil count of negative control 1057 (±120) to 902 (±67) in group II (40μg/kg), 734(±69) in group III (80 μg/ kg) and 609 (±71) in group IV (160μg/kg) of doses of colchicine. This test showed that with the increasing dose of colchicine, there was significant (P<0.001) difference of TLC count and neutrophil count. Nitric oxide (NO) production by macrophages was performed for measuring different concentrations of nitric oxide produced. There was significant difference (P<0.001) in NO production by macrophages alone and LPS stimulated between negative control to group II (40 μg /kg), group III (80μg/kg), group IV (160μg/kg) of colchicine. With increasing dose, there was significant reduction in production of NO. There was significant P<0.0001 reduction in body weight andspleen weight difference of mice in different groups of colchicine treated 40μg/kg, 80μg/kg and 160μg/kg from negative control after treatment. There was difference of weight of Thymus of group II (40 μg/kg), group III (80μg/kg) and group IV (160μg/kg) but difference was statistically not significant. There were no histopathological changes observed in spleen and Thymus at 40μg/kg and 80μg/kg doses of colchicine. At 160μg/kg dose, increase in thickness of trabecular was seen .due to edema in the spleen. For evaluation of colchicine effect on humoral immunity, haemagglutination assay, mice lethality test and Jerne hemolytic plaque formation were performed. Haemagglutination assay (HA) was performed by using red blood cells injected intraperitoneally in mice to measure antibody titer. There was significant difference of (P >0.001) to colchicine treated group II (40μg/kg), group III (80μg/kg) and group IV (160μg/kg)with group I (negative control).With the increasing dose, there was reduction in the SUMMARY 78 HA titer. Mice lethality test was performed by testing immune response of the mice to the challenge infection of P.multocida. It was performed by comparing mortality ratio of mice after administration of drug. There was no death of mice in the negative control group in which there was administration of PBS and vaccine. At 40μg/kg dose of colchicine, there was 50% mortality ratio. At 80μg/kg dose of colchicine 75% mortality ratio was observed. Maximum mortality ratio was observed at the 160μg/kg colchicine dose i.e. 100%. Jerne plaque formation test was performed and plaques formed was enumerated and recorded as the number of plaque forming cells (PFCs) per million cells. There was significant difference (P<0.001) of reduction in number of plaques from negative control to all doses of colchicine 40 μg/kg, 80 μg/kg and 160μg/kg. Antibody formation was decreased with increasing the dose of colchicine. Therefore, it is concluded that colchicine suppresses the cellular and humoral responses in mice. Availability: Items available for loan: UVAS Library [Call number: 2650-T] (1). Place hold
Effect Of Different Dietary Lysine Levels And Feed Restriction Regimes On Growth Performance And Slaughtering Characteristics In Japanese Quail (Coturnix Coturnix Japonica) Maintained During Hot Season

by Yassar Abbas (2008-VA-753) | Dr. Abdul Waheed Sahota | Prof. Dr. Muhammad Arkam | Prof. Dr. Khalid Javed.

Material type: book Book; Literary form: not fiction Publisher: 2015Dissertation note: High prices, global shortage of feed ingredients and less supply of animal protein against great demand as consequence of ever increasing human population needs to enhance protein supply. One way of enhancing protein supply is to expand poultry production along with increasing production of other micro livestock such as Japanese quail (Coturnix coturnix japonica) having low maintenance cost, short generation intervals, early sexual maturity and better resistance to diseases and its meat being rich in high quality protein having high biological value with low caloric content. Profit can be optimized by minimizing feed cost that accounts for 60-70 % of the total production cost and any improvements in the performance of birds by manipulation of feeding strategies inevitably have a profound effect on profitability. Any effort to improve commercial poultry production and enhance its efficiency needs to emphasize on better utilization of existing resources. Among different feeding management schemes and strategies phase feeding may be employed with the logic seems to feed birds for shorter periods of time to exactly meet but not exceed the amino acids requirements hence improvement in carcass characteristics and reduction of dietary cost. Commercial availability of very vital limiting amino acids (lysine) has set a new tendency of formulation of poultry feeds having low protein level with addition of amino acids. Lysine, being utmost essential amino acid is used as a reference for other essential amino acids. Feed restriction program may be another managemental tool that may elicit compensatory growth, improved feed efficiency, carcass quality and birds are not exposed to sub optimal level of nutrients but the efficiency of utilization of these nutrients may be improved. On the other hand breed, strain, management and sex differences for carcass traits have also been reported. Very little research focus on the subject has necessitated conducting the ABSTRACT vii present study undertaken in Japanese quails on the similar pattern as adopted in broiler industry to make quail production more cost-effective and commercially viable at Avian Research and Training (ART) Centre, University of Veterinary and Animal Sciences, Lahore, Pakistan. A series of experiments at Avian Research and Training (ART) Centre, University of Veterinary and Animal Sciences, Lahore, Pakistan was run to assess the effect of different management interventions on growth performance, carcass characteristics and blood biochemical profile in Japanese quail. The first experiment was aimed to examine the growth performance and economic efficiency involving 1440 day-old Japanese quail (Coturnix coturnix japonica) chicks. Three dietary lysine levels (1.3, 1.4-1.2 & 1.5-1.3-1.1 %) in 3 different phases were allocated to four different close-bred stocks (Imported, Local-1, Local-2 and Local-3) of Japanese quails to assess their comparative growth performance by replicating each treatment for three times. The experimental day-old quail chicks were randomly divided into 36 experimental units of 40 chicks each. Quails under 1st treatment were fed a diet with 1.3 percent lysine throughout the grow-out period of 28 days, while, those under 2nd treatment were allotted diet with 1.4 percent lysine up to14 days of age and then subsequently reduced to 1.2 percent lysine up to 28 days. The 3rd treatment was split into 03 different phases. The first phase was up to 9th, 2nd up to 19th and 3rd up to 28th day by allotting diet containing 1.5, 1.3 and 1.1 % lysine, respectively. Weekly data on growth performance were recorded and analyzed through ANOVA technique in CRD under factorial arrangement and the comparison of means was worked out using DMR test by the help of SAS 9.1. Maximum (P≤0.05) feed intake; body weight gain and improved FCR were observed in three phase dietary lysine regimen leading to maximum profit margins. viii In the 2nd experiment same experimental design and phase feeding was practiced to observe organ development. Sexing with in treatment was done at the age of three weeks and quails were maintained separately for one week. At 4 week of age, 3 birds/ replicate from either sex were slaughtered through Halal Muslim method for studying carcass characteristics. Two birds per replicate from either sex were used for serum analysis of glucose, cholesterol, urea, albumen and total protein using standard procedures. The analysis showed three phase dietary lysine regimen than other dietary lysine regimens improved (P≤0.05) slaughter characteristics i.e. post slaughter weight (g), dressing percentage with and without giblets, breast yield (g), thigh yield (g), giblet weight (g), liver weight (g), keel length (cm), shank length (cm), weight of visceral organs including intestinal weight (g) and intestinal length (cm). However, heart weight (g), gizzard (empty) weight (g), serum glucose, cholesterol, urea, albumin and total protein were not significantly affected by dietary lysine regimen. While, different close bred stocks did not show any significant differences. Third experiment was executed to examine the growth performance and economic efficiency of Japanese quail (Coturnix coturnix japonica) subjected to different feed restriction regimes at ART Centre, UVAS, Lahore. For this purpose a total of 3200 quail chicks from four different close-bred stocks were allocated to four different feed restriction regimes comprising four close-bred stocks (Imported, Local-1, Local -2 and Local-3) at the age of 10 days. The experimental quails in group 1 were fed ad-libitum (20.30% CP, 1.3% Lysine, as recommended by NRC) throughout the experimental period to serve as control while groups 2, 3 and 4 were provided with 1 hour feed- 3-hour off, 2-hour feed- 2hour off and 3-hour feed-1hour off feeding regimes, respectively. The analysis of data showed that the maximum feed intake was observed in ad-libitum fed group whereas the highest body weight gain was observed in ad-libitum and 3 hour ix fed quails. The best FCR leading to maximum profit margin was observed in 3 hour-fed group. Different close-bred stocks could not express any significant difference in growth parameters. In the 4th experiment same dietary plan of time restriction as in 3rd experiment was adopted to observe organ development. At the termination of the experiment (at the age of 38 days), 6 birds (3 male and 3 female) from each replicate were randomly picked up and slaughtered (by Halal method) to study different slaughter parameters. Significantly higher (P≤0.05) carcass weight, mean dressing % with and without giblet, mean thigh weight was observed in ad-libitum and 3 hours fed quails while significantly lower mean dressing %, liver weight, gizzard weight, giblet weight, breast weight and mean intestinal length and weight in one hour fed quail. Blood profile showed significantly higher (P≤0.05) serum glucose, urea, albumin and total protein level in ad-libitum and 3-hours fed quails while significantly higher (P≤0.05) serum cholesterol level was observed in one hour fed quails. Heart weights (g), keel length (cm), shank length (cm) were not affected significantly among different treatments and close-bred stocks. Conclusion Based upon the findings of the present study it may be stated that 1. Maximum (P≤0.05) feed intake; body weight gain and improved FCR were observed in three phase dietary lysine regimen leading to maximum profit margins. 2. Significant improvement in carcass characteristics was recorded in three phase dietary lysine regimen. 3. The best FCR leading to maximum profit margin was observed in 3 hour-fed group in Japanese quails when subjected to different feed restriction regimens. x 4. Three hour fed quails showed superior carcass characteristics at par with ad-libitum fed groups especially in terms of carcass weight, dressing percentage and thigh weight. 5. Significantly higher (P≤0.05) serum glucose, urea, albumin and total protein level were recorded in ad-libitum and 3-hours fed quails while significantly higher (P≤0.05) serum cholesterol level was observed in one hour fed quails. Suggestions and Recommendations Four lysine dietary regimens having 1 week each may successfully be employed in Japanese quails in order to get maximum profit. It may further be recommended that Japanese quails may be subjected to feed restriction of 1-hour after 2nd week. The present series of experimentation is a step towards optimizing the nutritional and managemental strategies in Japanese quails, however, a lot more is still needed to be worked out in this direction. Availability: Items available for loan: UVAS Library [Call number: 2340-T] (1). Place hold
Effect Of Different Feed Ingredients On Growth, Hematology And Vital Organs In Juvenile Labeo Rohita

by Khalid Javed Iqbal | Prof. Dr. Muhammad Ashraf | Dr. Arshad | Dr. Aumaira Abbas.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2013Dissertation note: This 9-month study extending from March 1, to November, 30, 2012 was conducted to find out the effect of different feed ingredients on growth, haematology and vital organs in juvenile Labeo rohita. The experiment was performed to find out the cost-effective substitutes of fishmeal and their effect on growth, digestive enzymes activity, blood profile, histology of intestine and flesh quality was monitored. To obtain the said objectives the experimental fish, Labeo rohita was subjected through three different research trials. i. A 3-month research trial was conducted to evaluate the effect of different plant/animal origin feed ingredients on growth, feed conversion ratio (FCR) and survival of fingerling Labeo rohita. Fish was fed on fish meal, guar meal, corn gluten meal (30%), soybean meal, sunflower meal, rice polish, cotton seed meal, canola meal and rape seed meal individually. Statistical analysis revealed significant differences (P?0.05) in growth, average weight gain, average length increase and specific growth rate among various ingredients. The highest average weight gain 27.162±6.950g and average length increase 6.153±0.833cm was observed in fish fed on guar meal while same was lowest 5.327±1.067g and 1.858±0.137cm, respectively in fish fed on corn gluten. However, fish showed better FCR values (2.01±0.08) when fed on guar meal while the FCR was very poor (9.57±48) for corn gluten (30%) fed group. The survival rate was highest (100%) for soybean meal fed group and lowest (70%) in canola and rapeseed meal fed group. ii. During second 3-month feeding trial, the effectiveness of individual feed ingredient from either plant or animal origin on growth, body composition, enzymes activity, haematology, histology and flesh quality of Labeo rohita was observed. The experiment was conducted in ten fiber glass tanks having size 12 ft x 4ft x 3 ft (length x width x depth). Single ingredient was considered as an independent treatment, hence guar meal, soybean meal, cotton seed meal and canola meal were considered as an independent treatment and fishmeal which was considered as a superior ingredient due to its ideal nutrient balance served as control. Ten juvenile Labeo rohita having an average weight of 200±2.33 g were harvested indiscriminately from the bulk and stocked in each fiberglass tank. Two tanks were randomly allotted to each treatment and control. Each group received uniform ration @ 4% of total fish biomass twice a day. Results revealed significant differences (P?0.05) in growth, FCR and specific growth rates among treatments. Weight gain was the highest in guar meal fed fish while the lowest on fish meal. Body composition of fish showed slight variations in fat contents with no differences in other nutrients though chemical composition of individual ingredient varies a lot. Minerals specifically Na, Ca, Fe, Zn, and Cu significantly differed (P?0.05) among treatments which might be linked with their variable release in digestive system of fish in the presence of various anti-nutritional factors. For different feed ingredients protease activity varied significantly (P<0.05) between anterior and posterior part of the intestine and also that of whole intestine when compared among various treatment groups. While amylase activity differed significantly when enzyme activity compared from the homogenate of whole intestine but not when compared partly. WBC, RBC, Hct, HB, PROT, ALB and GLOB showed significant (P<0.05) differences for blood samples of the fish fed with different feed ingredients while values of MCV, MCH, MCHC and ESR remained uniform. The feed ingredients differently affected the liver and intestinal cells. No difference was observed when fried fish fed on different ingredients were compared among each other indicating that ingredients with nominal variations in chemical composition do not leave much after effects on fish flesh. iii. Third 3-month trial was conducted to evaluate the effect of plant-animal feed and/or plant by-product based feed on growth, body composition, enzymes activity, haematology, histology and flesh quality of Labeo rohita. Fish fed on rice polish alone served as control (T0). Previously selected potential fish feed ingredients were grouped together with two ingredients in each isocaloric test diet which served as an independent trial during these studies. Group 1(T1) contained guar meal and canola meal, group 2(T2) soybean meal and cotton seed meal, group 3(T3) guar meal and cotton seed meal, group 4(T4) soybean meal and canola meal and group 5(T5) fishmeal and canola meal. Each group including control had two replicates. 12 earthen ponds with uniform area of 0.03 ha each, were randomly stocked with 100 fish (average weight 200±4.43g) in each following standard stocking protocols. All the 12 ponds were then randomly allotted to individual treatment including control group. Experimental fish were fed @ 4% of their wet biomass twice a day except Sundays which was kept open providing fish an opportunity to clean left over feed from the previous day. Better growth rate, food conversion ratio (FCR) and specific growth rate (SGR) in T3 than rest of the treatments including control suggest that guar meal and cotton seed meal is much better option to include in future feed formulations for maximum performance and minimum feed wastage. This preposition will minimize feed providing cleaner and healthy environment to fish ultimately enhancing stocking rate and fish production. Proximate analysis of dried and ground fish samples showed higher protein values in T4, fat in T2, moisture contents in control, dry matter in T1 and ash in T5. Mineral composition of Labeo rohita showed statistically significant (P ? 0.05) differences in Na, Ca, Fe, Zn and Cu content. Amylase concentration showed non-significant differences in anterior, posterior parts and the whole intestine in all the treatment and control ponds except T5 while protease concentrations were statistically significant (?0.05) in anterior and posterior part within the same group as well as among various groups. Enzymatic activity in whole intestine also varied significantly when compared among groups. Haematological parameters viz. WBC, RBC, ALB, GLOB and PROT differed significantly (?0.05) among all the treatments. Disrupted hepatic cords and hepatocytes showing pyknotic nucleus were observed in T1, moderate infiltration of fat vacuoles in T2 and, T4 caused vacuolar and hepatic cord degeneration while fish from T0 were subjected to severe vacuolation in hepatocytes. Non-significant differences in flavor, juiciness, and oiliness of fried fish from all the treatments and control ponds indicated that the sensory attributes of fish flesh were not affected by feeding fish with blend of various ingredients. It is concluded that the response of body organs varies with varying feed stuffs and the feed items have pronounced effect on enzymatic activities, hematological and histological parameters in juvenile Labeo rohita. During present study fish showed comparatively better growth when fed with guar meal as a single feed ingredient or combined with cotton seed meal than the rest of feed ingredients either offered individually or in combinations. The study provides base line information and will help aquaculture nutritionists to formulate cost-effective feeds. Availability: Items available for loan: UVAS Library [Call number: 1819,T] (1). Place hold
Effect Of Different Management Strategies On Growth Performance, Biochemical Profile And Immune

by Shahid Mehmood | Dr.Abdul Waheed Sahota | Dr. Khalid Javed | Dr. Muhammad Akram.

Material type: book Book; Format: print Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1768,T] (1). Place hold
Effect Of Feeding Milk Replacer And Diet With Varying Levels Of Concention On Growth Puberty And First Lactation

by Zeeshan Iqbal | Prof Dr. Muhammad Abdullah | Prof. Dr | Prof. Dr. Khalid Javed.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2160,T] (1). Place hold
Effect Of Long Term Use Of Bovine Somatotropic Hormone On Milk Production ,Production Nutrient

by Iftikhar Ahmad | Makdoom Abdul Jabbar | Dr. Talat Naseer Pasha.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2009Dissertation note: Use of bovine somatotropic hormone (bST) for increased milk production has been widely investigated in dairy cattle, whereas very little work has been done in buffaloes. To observe the effect of bST on buffalo for long term duration study was planned with the objectives to investigate the effects of long term use of bST on milk production, milk composition, reproduction, hematological and biochemical parameters in Nili-Ravi buffaloes. For this study 30 lactating Nili-Ravi buffaloes with similar milk production and stage of lactation were selected and randomly divided in to two groups A and B with 15 animals in each group. The group A (0 bST) served as control while animals in group B (+bST) were given injection of bST (250 mg Boostin-250/animal) at 14d interval. Nutritional requirements of experimental animals were met through available green fodder (45-50kg/day) supplemented with concentrate ration @ half of milk production. The milk production was significantly (P<0.05) increased by 18.04 % in treated group compared with control. The results showed that there was no significantly variations in parameters like milk composition, dry period and lactation length, calving interval in both the groups. The postpartum estrous period and service period were significantly (P< 0.05) improved which reflected positive effect of bST on reproductive parameters. However, the difference in services per conception was non-significant. Small variations were found in the prevalence of contagious and non contagious diseases in both experimental groups during the study period. The differences among body weights, hematological and biochemical parameters were also non-significant expect blood urea nitrogen (p< 0.05). The proceeds over a lactation period of 305 days was PKR. 4227.0 with the use of bST. Second trial was conducted to study the effect of dose interval of bST in Nili-Ravi buffaloes. For the proposed study 21 Nili-Ravi lactating buffaloes with similar milk production and stage of lactation were randomly divided into three groups A, B and C with 7 animals in each group. The group A was injected with full dose of bST hormone (250 mg/animal) with trade name of Boostin-250 at an interval of 14 days, while animals in group B were given injection on alternate days with divided dose of 36 mg/animal. Group C was kept as control. Duration of study was 5 months and the animals were kept on green fodder supplemented with concentrate ration half of milk production. The concentrate ration had 17.2% CP and 72.0% TDN. The milk production increased by 18.35% and 15.27% in-group A and B compared with group C (control) but increase was non-significant (P>0.05) . Similarly data revealed that dose interval had no affect on milk contents, reproductive and hematological parameters in all the experimental groups. In a third trial feed digestibility and efficiency for milk production was studied. For the study fourteen Nili-Ravi buffaloes at their mid lactation with almost same level of milk production were randomly divided into two groups A and B with seven animals in each group. The group A was kept as control, while group B was injected bST hormone (250 mg/animal) at an interval of 14 days and continued for 60 days. The nutritional requirements of animals in both the groups were met through TMR according to NRC recommendations. The milk production was increased by 7.0% in. treated group (B) as compared with control group (A) and the increase was statistically non-significant (P>0.05). However, the feed efficiency for milk production was significantly improved (P< 0.05) in treated group. The differences in milk composition (Fat, SNF, TS and Protein percent) body weight gain digestibility of dry matter and other nutrients in treated and control groups were found non-significant (P>0.05). The fourth trial was conducted to determine the effect of energy on milk production and its quality under the influence of bST hormone in Nili-Ravi buffaloes. Multiparous (n12) buffaloes with mid lactation and similar level of milk yield were selected and randomly divided in to three groups i.e. A, B and C with four animals in each group. All the experimental animals were injected bST with trade name of Boostin - 250. The dose level was 250 mg per animal and injection was given at fortnightly interval during study period. The nutritional requirements of three groups animals were met through TMR with varying levels of energy (15% low and 15% above the recommendations of NRC). The milk yield was significantly higher (p<O.O5) on medium and high energy ration but the difference of milk yield was non significant (p>O.O5) between medium and low energy diets. The milk components and body weight gain were similar on all rations, while feed efficiency and nutrient intake (except ether extract) in low energy diet was significantly higher (p<O.O5) from two other rations. It may be concluded that 15% higher energy than recommended by NRC favoured milk production in Nih Ravi buffaloes when they were injected bST hormone. Conclusion On the over all there was consistency of results for milk production and milk composition with reference to available literature. However, some reproductive parameters including postpartum estrus and service period were significantly improved with the use of bST hormone. This effect has not been reported in the previous literature which needs to be further investigated and verified. Similarly the dose level in buffaloes needs to be further studied. Availability: Items available for loan: UVAS Library [Call number: 0999,T] (1). Place hold
Effect Of Pre-Weaning Diets And Varying Levels Of Concentrate During Post-Weaning Period On The Performacne Of Female Nili-Ravi Buffalo Calves Up To One Year Of Age

by Zeeshan Muhammad Iqbal (2002-VA-55) | Prof. Dr. Muhammad Abdullah | Prof. Dr. Khalid Javed | Prof. Dr. Makhdoom Abdul Jabbar.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Nili-Ravi buffalo is a well-known buffalo breed in subcontinent Indo-Pakistan region and famous for its high milk production ability. Currently, buffalo calves and growing heifers are fed on deprived quality and quantity roughages with poor nutritive values resulting in reduced growth rate, reproduction with delayed attainment of puberty and high mortality. These constraints can be overcome through nutritional management of buffaloes. There is a need for the development of standards for adequate, cost effective provision of colostrum, whole milk/milk replacer and calf starter ration to neonatal calves up to weaning, establishment of nutrient requirements for growing buffalo heifer with aim of more average daily gain to reduce age at puberty and nutrients requirements for lactating buffalo according to their status and stage of milk production. The current study comprises of two experiments and was conducted at Livestock Experiment Station, Bhunikey, Pattoki, District Kasur, Punjab, Pakistan. The first experiment was performed with an aim to check the growth performance of female buffalo calves on whole milk & milk replacer and find out the cost effective and growth rate friendly alternate source of liquid diet. The duration of this experiment was 120 days. Thirty six female calves were selected and randomly divided into three (n=12) different treatments A (whole milk), B (50% whole milk & 50% milk replacer) and C (milk replacer). All the calves were given colostrum for first three days, then whole milk up to 15 days of age and transferred into three treatments. In addition to this all the calves were provided calf starter and fresh water ad-libitum. The calves were given SUMMARY 133 liquid diet @ 10% of their body weight for first two months and then gradually decline of 1% on weekly basis for the subsequent two months. Green fodder was started on three month of age. The average daily total dry matter intake was remained same for all the three treatments but the average daily gain was higher in treatment A (457.38±110.13a) compare to treatment C (362.22±107.83b) but it was same for treatment A&B and B&C, respectively. The mean FCR value was also better for treatment A (3.49±0.56b) compare to treatment C (4.30±1.24a) and it was same for treatment A&B and treatment B&C, respectively. The mean cost/kg gain was higher in treatment A (422.72±70.66a) compare to treatment C (352.97±97.49b) and it was same for treatment A&B and B&C, respectively. Animals had performed well on mix liquid (50 % whole milk: 50% milk replacer) diet and it was more cost effective than other two treatments. The aim in second experiment was to set the standard and cost effective level of concentrate ration for growing female buffalo heifer calves. For second experiment thirty (30) calves were selected from first experiment and were randomly dived into three treatments A, B and C. Treatment A was fed on concentrate ration according to 0.5 % of their body weight, treatment B 1.0 % and treatment C 1.5 % of their body weight. In addition to this all the calves were given ad-libitum green fodder and fresh clean water. All the calves were fed on similar concentrate ration having CP: 17 % and ME: 2.6 Mcal/kg. The duration of this experiment was 8 months. There was significant difference (P<0.05) in mean dry matter intake, protein intake, energy intake and protein per kg gain across all the three treatments and were higher (P<0.05) for treatment C then treatment B and lower (P<0.05) in treatment A, respectively. The average daily gain was remained same (P>0.05) for all the three treatments (497.32±17.92, 503.63±19.09 and 532.77±20.67). The higher feed efficiency was observed in treatment A (0.135±.004a) while it was same for treatment B & C (0.113±.003b & 0.108±.004b), respectively. The average body SUMMARY 134 condition & score, body mass index and blood constituents (RBCs, WBCs, heamoglobin, packed cell volume, mean corpuscular volume, platelets count, lymphocytes, monocytes and granulocytes) were unaffected (P>0.05) by different concentrate levels. Concentrate levels had significantly affected some of serum components (total protein and urea) but some components (glucose & cholesterol) were unaffected by dietary treatments. The values of mean serum total protein and serum urea were found lower in treatment A (6.12±0.17b & 42.34±1.59b) compare to treatment B (6.65±0.23a & 50.08±2.05a) and C (6.79±0.23a & 51.41±2.29a), respectively. The higher values of serum total protein and cholesterol in treatment B & C may be attributed to higher concentrate level in these two treatments. Concentrate levels had significantly (P<0.05) affected some of the digestibility parameters (DM %, CP% and NDF%) while other parameters (organic matter, fat, ash, ADF and urine pH) were remained same (P>0.05) on varying concentrate level diet. The mean body measurements (height at wither, body length and heart girth) were also not affected (P>0.05) by dietary treatments. There was significant difference across all the three treatments in total average daily dry matter intake cost and cost per kg gain. These were lower in treatment A compared to other two treatments B & C. It was observed that mean dry matter, protein and energy intake was lower in treatment A (0.5% of body weight) and weight gain was remained same on all the three dietary treatments. The mean feed efficiency was greater and mean cost per/kg gain was lower in treatment A. So, treatment A was remained more cost effective than other two treatments. Both experiments were planned by keeping in mind the problems of buffalo farmer. Rearing of calves with improved growth rate on least cost feeding regime is important in dairy farming. Milk replacer is an alternate source of whole milk. Most of the buffalo farmers don’t use milk replacer for rearing of calves because of slower growth rate. Mixing of milk replacer SUMMARY 135 with whole milk in 50:50 ratio make the consistency of liquid diet near to whole milk. Feeding of whole milk with milk replacer along with calf starter reduces the cost without affecting growth rate. At this stage farmers should keep in mid the cleaning of feeding pans to avoid the risk of diarrhea. In post weaning period calves’ rumen is fully develop and is completely shifted to solid diet. During this transition phase farmers don’t follow the nutritional requirements of calves, which slow down the growth rate and ultimately increase the age at puberty. As buffalo are efficient converter of low quality diet. If farmers offer concentrate ratio (16-18% CP) to buffalo heifers at the rate of 0.5% of body weight along with ad-libitum green fodder, growth rate can be improved cost effectively. 5.1. Conclusion: The findings of first experiment shows that 50% whole milk & 50% milk replacer @ of 10 of body weight along with adlibitum calf starter ration help in early rumen development, improved growth rate and better FCR on economical basis. So, it is recommended that whole milk and milk replacer in 50:50 ratio is growth rate friendly and cost effective for rearing of female buffalo calves up to weaning. The results of second experiment shows that growth rate, body measurements and body condition & score remained the same on all the three dietary concentrate levels but the feed efficiency was improved on lower concentrate level. So, it is recommended that it is cost effective to raise buffalo growing heifers on small amount of concentrate ration (0.5% of body weight) along with ad-libitum green fodder. Availability: Items available for loan: UVAS Library [Call number: 2720-T] (1). Place hold
Effect Of Protein Supplements Of Varying Ruminal Degradability On Milk Production, Composition And Nutrients

by Illahi Bakhsh Marghazani | Prof. Dr. Makhdoom Abdul Jabbar | Prof. Dr | Prof. Dr. talat Naseer Pasha.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2012Dissertation note: The study on "Effect of protein supplements of varying ruminal degradability on milk production, composition and nutrients utilization in early lactating Sahiwal cows and Nili-Ravi buffaloes" was carried out in three phases at three different experimental locations. The in situ study of animal and vegetable protein sources was conducted at the Department of Food and Nutrition, University of Veterinary and Animals Sciences, Lahore while the feeding trials with early lactating Sahiwal cows and Nili-Ravi buffaloes were carried out Government Livestock Farm, Kalurkot, Bukkar and Livestock Experimental Station, Khushab, respectively. Different animal (n = 6) and vegetable origin (n = 15) protein sources were subjected to ruminal protein degradability analyses using the in situ technique. All these test feeds collected from ten different locations were subjected to ruminal incubation (in triplicate) for 0, 3, 6, 12, 24 and 48 h to determine the quickly soluble fraction (a), potentially degradable fraction (b), degradation rate (c) and effective degradability at different (2, 5, 8 %) ruminal passage rates. The degradability characteristics in animal protein sources (part 1, phase 1) showed significant differences in degradation kinetics and effective degradability (ED). In crude protein (CP) degradability, the quickly soluble fraction (a) was higher (P<0.05) in fish meal, PBM and meat meal and lower (P<0.05) in blood meal, feather meal and bone and meat meal. Potentially degradable fraction (b) among test feeds was maximum (P<0.05) in bone and meat meal and PBM and minimum (P<0.05) in blood meal and feather meal. The degradation rate (c) did not differ among the test feeds. Of all the animal protein sources investigated, meat meal showed maximum CP degradability at 0.05 rumen passage rate whilst, minimum (P<0.05) ED of CP was exhibited by blood meal. Ruminal degradability characteristics in vegetable protein sources (part-2 of phase-1) showed variation in degradation kinetics and ED of CP. The quickly soluble fraction (a) was highest (P<0.05) in sesame cake and lowest (P<0.05) in CGM 60%, coconut meal and PKC. Potentially degradable fraction (b) was maximum (P<0.05) in CGM 60%, PKC, SBM and guar meal while minimum (P<0.05) in sesame cake and CGM 30%. Protein degradation rate (c) was highest (P<0.05) in CSC while lowest (P<0.05) in coconut meal, coconut cake and CGM 60%. Effective degradability of CP at 0.05 rumen passage rate was highest in sesame cake and lowest (P<0.05) in coconut meal. All vegetable protein sources were treated (part-3 of phase-1) with formaldehyde (1 g/100 g CP) and heat treatment (1 h at 15 lb/100 g CP) to determine their effectiveness in reducing ruminal protein degradability. Both of these treatments decreased (P<0.05) rumen degradability of the vegetable protein sources investigated. Of the formaldehyde treated test feeds, quickly soluble fraction (a) was higher (P<0.05) in sesame cake and lower (P<0.05) in CGM 60%, SBM, CGM 30%, guar meal, canola meal and coconut meal. The highest value of potentially degradable fraction (b) was recorded (P<0.05) in CSC and RSC while CGM 60% had the lowest value (P<0.05). Degradation rate (c) was highest (P<0.05) in RSM, RSC, CSC, CSM coconut cake, PKC, sesame cake, SFM and CGM 60% and lowest (P<0.05) in CGM 30%, guar meal and canola meal. Effective degradability of CP was maximum in sesame cake at all the rumen passage rates. In contrast, CGM 60% had the lowest (P<0.05) ED at all of the rumen passage rates. Among the heat treated vegetable protein sources, quickly soluble fraction (a) was highest (P<0.05) in sesame cake and lowest (P<0.05) in CGM 60% and SBM. Potentially degradable fraction (b) had the highest (P<0.05) value in almond cake, RSM, RSC, CSC and SFM while CGM 60% had the lowest value (P<0.05). Effective CP degradability of the heat treated test feeds showed that almond cake and sesame cake had the highest (P<0.05) ED whilst CGM 60% had the lowest values (P<0.05). In comparing both treatments, similar influence (P>0.05) of increasing RUP level was recorded in CGM 30%, SFM, RSM, CSM, PKC and coconut meal. Formaldehyde treatment was found more effective (P<0.05) in increasing RUP level in guar meal, canola meal, RSC, CSC, coconut cake, almond cake and sesame cake whilst heat treatment increased (P<0.05) RUP level in SBM and CGM 60% at applied rates in this study. In phase-2, a feeding trial with early lactating Sahiwal cows was conducted to investigate the effect of protein supplements of varying ruminal degradability on milk production, composition and nutrients utilization. Twenty four early lactating Sahiwal cows were selected and randomly divided into four groups. Four iso- caloric and iso- nitrogenous diets i.e., ration A (30% RUP), ration B (40% RUP), ration C (50% RUP) and ration D (60% RUP) were fed in a completely randomized design. Dry matter and CP intakes were significantly affected by ration composition (P<0.01), whereas NDF and ADF intakes did not vary among the four treatment groups (P>0.05). DM intake was higher (P<0.05) in cows receiving rations B and A than the cows fed rations C and D. There were significant differences in DM (P<0.05), CP (P<0.001) and NDF (P<0.05) digestibility due to the ration; however, ADF digestibility did not differ (P>0.05) between the rations. DM digestibility was higher (P<0.05) on ration B than rations C and D, but similar to that for ration A. Crude protein was higher (P<0.05) on rations B and A and lower (P<0.05) on rations C and D. Daily yields of uncorrected milk and protein were highest in early lactating Sahiwal cows fed ration B and lowest when fed ration D. Daily yields of 4% FCM and milk fat were higher (P<0.05) on rations B and A and lower (P<0.05) on ration D. In milk composition, fat, protein and total solids contents were the same across all diets. Nitrogen intake was highest (P<0.01) for rations B and A and lowest for ration D and C. Nitrogen balance (g/d) and as a percentage of N intake varied; with the cows consuming ration B retaining maximum (P<0.001) N. However, N balance did not vary between rations A, C and D. Nitrogen utilization was highest (P<0.001) in cows fed ration B, but there was no difference among cows fed rations A, C and D. Live weight and body condition score in cows were unaffected by the rations. Cost of milk production was least on ration B and highest on ration D. In phase-3 a feeding trial using early lactating Nili-Ravi buffaloes was conducted. Twenty four buffaloes were selected and randomly divided into four groups. These groups were fed four experimental diets i.e., rations A, B, C and D having 30, 40, 50 and 60% RUP proportions, respectively in a completely randomized design. Results showed no differences (P>0.05) in the intakes of DM, CP, NDF and ADF intake between the rations. Likewise, DM, CP and ADF digestibility were the same (P>0.05) in buffaloes fed rations A, B, C and D; however, NDF digestibility was higher (P<0.01) on ration C and B while lowest on rations A and D. Milk yield was highest (P<0.001) on ration C while lowest (P<0.001) on rations D and A. Buffaloes given ration C produced more (P<0.05) FCM than those receiving rations A, B and D. Daily yield of milk fat was greater (P<0.001) on ration C compared to the other three rations. Milk protein yield was highest (P<0.001) on ration C and lowest (P<0.001) on rations A and C. Diet had no effect (P>0.05) on milk fat, SNF, lactose, salts and total solids percentages; whilst milk protein percentage varied among all four diets, viz ration C>ration B>ration D>ration A. Nitrogen, intake, nitrogen balance and nitrogen utilization were similar across all the diets. Live weight and body condition score in buffaloes were unaffected by the diet fed. The cost of milk production was highest (P<0.05) with rations D and B whilst lowest (P<0.05) on ration C. It is concluded that among animal protein sources rumen CP degradability was least in blood meal and maximum in meat meal. In vegetable protein sources, coconut meal showed least ruminal CP degradability while sesame cake recorded with highest ruminal CP degradability. Both formaldehyde and heat treatments protected protein from ruminal degradability with varied levels of effectiveness in different feeds. Production performance improved with the use of RUP sources in early lactating cows and buffaloes. Sahiwal cows showed better yield performance in diets having 40% un-degradable protein in the diet, while Nili-Ravi buffaloes showed high yield performance in diets with 50% un-degradable protein sources. The use of latest technology and methods needs to be applied for minimizing variations involved in evaluating CP degradability of feeds through in situ procedure. Influence of RDP and RUP based rations in mid and late lactation of Sahiwal cows and Nili-Ravi buffaloes are also fertile areas of research. The studies on degradability of amino acids for compiling 'internal standards' of feed resources and production performance of lactating cows/buffaloes based on ruminal degradability of amino acids rather than protein degradability would be better approach for future studies. Availability: Items available for loan: UVAS Library [Call number: 1470,T] (1). Place hold
Effect Of Various Stress Factors On The Immune Response(Ph.D)

by Muhammad Yasser Mustafa Butt | Prof.Dr.Muhammad Akram Muneer | Prof.Dr.Khushi Muhammad | Faculty of Veterinary Sciences.

Material type: book Book; Format: print ; Nature of contents: biography; Literary form: Publisher: 2009Dissertation note: Pakistan has vast population of dogs belonging to different breeds. Most of the dogs have no pedigree record which is a great threat to conservation of different breeds. No study on DNA fingerprinting of dogs has been conducted in Pakistan. DNA fingerprinting of dogs is necessary to overcome the problems like forensic cases, sale & purchase, individual identity in case of fertilization by more than one male and ownership disputes. Microsatellite markers have been proved as an efficient and powerful tool for parentage testing and breed characterization of dogs. In this study, a panel of microsatellite markers, having high polymorphism information content (PlC) values, was developed. Blood samples were taken from cephalic vein of two breeds of dogs (German shepherd and Labrador retriever). DNA was extracted by Inorganic method. Primers of microsatellite markers were optimized for successful amplification conditions in the Bio-Rad thermocycler. Multiplex PCR was performed, for amplification of these microsatellite markers on 46 samples belonging to 20 families. Genotyping analysis was performed for the PCR products of microsatellite markers on non denaturing polyacrylamide gel. These results were analyzed statistically software "POPGENE 3.3 and POWER STAT". Allele frequency, heterozygosity, homozygosity, polymorphism information content (PlC), power of discrimination and power of exclusion of all microsatellite markers were calculated. Average power of discrimination among non parents, average hetrozygosity, average observed homozygosity and average polymorphism information content (PlC) value for all alleles was 0.809, 0.6345, 0.29 13 and 0.724 respectively. Moreover combined power of exclusion reached a significant value of 0.9998. Almost all of the microsatellite markers showed significant variations in both German shepherd and Labrador retriever breeds. Microsatellite "REN41D2Ob" showed maximum variation i.e. 17 alleles and microsatellite"REN49F22b" showed the least variation among all microsatellite markers i.e. 4 alleles. Genotyping results of microsatellite markers were clearly different for two different breeds showing a distinct genetic distance between German shepherd and Labrador retriever breeds. Results of this study lead to development of a panel of microsatellite markers which can be used for parentage analysis and breed characterization of dogs. This was a preliminary study on dogs in Pakistan. This facility can be provided on commercial basis to pet owners and kennel clubs. Moreover this study can become the basis for further research investigations in canines in Pakistan. To evaluate effects of various stress factors on immune response and growth performance of broiler chicks, a total of five experiments using 2000 broiler chicks were conducted. In each experiment, chicks were divided into five groups (A, B, C, D and E), and each group consisted of 80 day-old-chicks. In each experiment, the chicks were exposed to stress factors, such as temperature, stocking density, feed deprivation, water restriction and light. Each chick in groups A, B, C, and E was vaccinated against IBV, NDV, IBDV and HPSV, but chicks in group D were kept as unvaccinated controls. Blood samples from each group were collected on 36 day of age, at 18 hrs for determining TLC, DLC and H/L ratio. The antibody titers of chicks in different groups were analyzed using HI test at days 36th and 56. The cellular response was analyzed by injecting PHA-P in the wattles of bird during post stress period. The effects of each stress on lymphoid organs were determined. The potential to resist virulent NDV challenge and effect of stress factors on body weight gains and FCR of chicks was also determined. In experiment 1, conducted to determine the effect of various temperature ranges on broiler chicks, it was observed that the heat stressed (HS) birds showed non-signilicant dilYerence in TLC values. The HS effect on lymphoid organs indicated that the mean weight of thymus of chicks in group B (0.29±0.02) and C (0.59±0.13) was significantly (P<0.05). lower than those in groups A (4.11±3.26), D (4.50±0.77) and E (4.35±0.21). The mean bursa weight of heat stressed chicks in goups A (0.94±0.59) and B (0.20±0.01) were significantly (P0.05) lower as compared to non- heat stressed chicks in groups D (1.42±0.22) and E (1.33±0.18). The mean spleen weight of groups A (1.21±0.13) and B (1.30±0.11) was significantly (P0.05) lower than groups D (L93±0.16) and E (1.52±0.10) indicating the adverse effect of increased temperature. The FCR valueswere significantly (P0.05) different among groups in 6th1 week and effect of Vitamin C was found significantly (P<0.05) improved than Vitamin E and glucose treatment. At 36 day of age the HI titer was recorded significantly (P<0.05) lower in group A (GMT 61) than B (GMT 144) and C (GMT 109) groups while group E (GMT 186) showed significantly (P<0.05) higher HI titer. At the age day 56 (06 days post challenge) the HI antibody titers in all groups registered a rise except in group D. All the chicks in group D died indicating clinical signs of Newcastle disease. The post challenge GM HI titers recorded in groups A, B, C and E at the age of 56 days was 79, 156, 122 and 216, respectively. There was nonsignificant (P>0.05) differences in wattle thickness (cm) among groups A (1.51+0.06), B (1.77±0.26), C (1.2±0.25) and D (1.52±0.22) but increased in group E (1.83+0.08). The mortality was found significantly (P<0.05) higher in groups A (14) and D (40) on challenge with NDV virulent virus. In experiment 2, conducted to determine the effect of various levels of stocking densities on broiler chicks, it was observed that stressed birds had showed non-signilicant (P>0.05) difference in TLC values. The effect on lymphoid organs found that the mean thymLls weight (grn) of chicks in groups A (0.37±0.04) and B (0.74±0.17) were significantly (P<0.05) lower than groups C (1.50±0.35), D (4.43±0.72) and E (4.40±0.23). The mean bursa weight (gm) of groups A (0.33+0.03) and B (0.57+0. 1 7) were significantly (P0.05) lower than those of groups D (1.76±0.05) and 13(1.33±0.08) indicating that less space effect the bursa development in the chicks. The mean spleen weight (gm) of groups A (1.18±0.07) and B (1.52±0.20) was significantly (P<0.05) lower than group D (2.37±0.28). The FCR values were sign ilicantly (P<0.05) different among groups in 6thi week and there was non-signiflcant (P>0.05) difference among groups with treatment of Vitamin C, Vitamin E and glucose. At 36th day of age the I-Il titer was recorded significantly (P<0.05) lower in group A (GMT 67) than groups B (GMT 9.6) and C (GMT 102). The chicks in group D (GMT 07) showed negligible HI titer while group E (GMT 185) showed significantly (P<0.05) higher HI titer. At the age day 56 (06 days post challenge) the 1-Il antibody titers in all groups registered a rise except in group D. All the chicks in group D died indicating clinical signs of Newcastle disease indicating that the titers in the birds were not enough to resist the virulent challenge. The postNDV-challenge GM HI titers recorded in groups A, B, C and Eat the age of 56 days were 86, 121, 132 and 210. There wa non-significant (P0.05) differences in wattle thickness (cm) in groups A (1.44±0.07) and C (1.43±0.10) while group E (1.64±0.31) showed significantly (P0.05) increased wattle thickness. The mortality was found significantly (P0.05) higher in groups A (25) and D (40) on challenge with NDV virulent virus. This indicated that less floor space decreased the immune response of the birds which leads to the infection/death. In experiment 3, effect of feed deprivation at different time intervals on broiler chicks was studied, it was observed that feed deprivation stressed birds had showed non-significant (P>0.05) differences in blood cells population. The effect of feed deprivation on the mean thymus weight (gm) of chicks in group C (0.96±0.29) was adversely affected as the chicks in this group had significantly (P<0.05) lower weight than groups B, 1) and E. The bursa mean weight (gm) of groups A (0.48±0.11) and C (0.52±0.06) was significantly (P0.05) lower than those of groups D (1.40±0.18) and E (1.28±0.11) indicating, that 24 hrs and morning off-feed effect the bursa development in the chicks. The mean splen weight(gm) of groups A (I. 19±0.07) and C (1.21±0.06) vcre significantly (P0.05) lower than groups D and E indicating adverse effect ol24hrs and day off feed on chicks lead to infection. The FCR values were significantly (P0.05) different among groups in 6hhl week and there was significant (P<0.05) differences among groups with treatment of glucose than Vitamin C and Vitamin E treated. groups. At 36th day of age, the HI titer was recorded significantly (P<0.05) lower in group B (GMT 15) than C (GMT 74) and group D (GMT 07) showed negligible HI titer while group E (GMT 140) showed significantly (P<0.05) higher HI titer. At the age day 56 (06 days post challenge) the HI antibody titers in all groups registered a rise except in group D. All the chicks in group D died indicating clinical signs of Newcastle disease. The post challenge GM HI titers recorded in groups A, B, C and Eat the age of 56 days were 68, 54, 115 and 165. There was non-significant (P0.05) difference in wattle thickness (cm) among groups while group E (I .78±0.06) showed significantly (P<0.05) increased wattle thickness. The mortality was Found significantly (P<0.05) higher in Groups C (12) and D (40) on challenge with NDV virulent virus. This indicated that 24 hrs off feed decreased the immune response of the birds which leads to the infection. In experiment 4, studied the effect of water restriction at different time intervals on broiler chicks, it was observed that water restricted birds had nonsignificant (P0.05) differences in blood cells population except lymphocytes percentage was found higher in groups A (43.7±2.47), C (43.7±1.16) and D (53 .3±1 .30) than group B (39.1±1.06). The effect of water restriction on the mean thymus weight (gm) of chicks in group C (0.60±0.07) was adversely effected as the chicks in this group had significantly (PO.O5) lower weight than group D (4.09±0.70) indicating that increased in the period of water restriction in chicks adversely affected the mean thymus weight and chicks reared on ad-flbituni water had higher mean thymus weight. The mean bursa weight (gui) of group C (0.07±0.02) was significantly (P<0.05) lower as compared to group D (1.37±0.88) indicating that water restriction of 24 hr had affected the bursa development in the chicks. The mean spleen weight (gm) of group C (2.64±1.49) was significantly (P0.05) higher than groups A, B and E. The FCR values were significantly (P<0.05) different among groups in 6th week and there was non-significant (P0.05) difference among groups with treatment of Vitamin C, Vitamin E and glucose treated groups. At 36th day of age the HI titer was recorded significantly (P<0.05) lower in group D (GMT 09) than A (GMT 54) and group E (GMT 109) showed significantly (P0.05) higher HI titer. At the age day 56 (06 days post challenge) the HI antibody titers in all groups registered a rise except in group D. All the chicks in group D died indicating clinical signs of Newcastle disease. The post challenge GM HI titers recorded in groups A, B, C and E at the age of 56 clay was 78, 63, 48 and 134. There was non-significant (P0.05) difference in wattle thickness (cm) among groups B and E and group A (1.28±0.08) showed significantly (P0.05) lower wattle thickness. The mortality was found significantly (P<0.05) higher in groups B (14) and C (21) on challenge with NDV virulent virus. This indicated that 18 and 24 hrs water restriction decreased the immune response of the birds. In experiment 5, effect of light stress at various time intervals on broiler chicks was studied. It was observed that light stressed birds had showed non-significant (P>0.05) difference on blood cells population except lymphocytes percentage was found higher in groups D (6 1.4±1.16) than group C. The effect on lymphoid organs studied and the mean thymus weight (gin) old chicks in group B (I .90±0.53) was adversely effected as the chicks in this group had significantly (P0.05) lower mean thymus weight than groups D (4.64±0.74) and E (4.34±0.25) indicating that increase in the period of oil-light in chicks adversely effected the mean thymus weight and chicks reared on 24hr light had higher mean thymus weight. The bursa mean weight (gm) 01' group 13(0.43±0.05) was significantly (P0.05) lower as compared to group D (1.59±0.17). The spleen mean weight (gun) of group D (1.88±0.15) was significantly (P<O.05) higher than group B (1.18±0.08). The FCR values were significantly (P().O5) different among groups in 6th week and there was non significant (P0.O5) difference among groups with treatment of Vitamin C, Vitamin E and glucose. At 36° day of age the HI titer was recorded significantly (P<0.05 lower in group C (GMJ 83) and group D (GMT 06) showed negligible HI titer while group E (GMT 128) showed significantly (P0.05) higher HI titer. At the age day 56 (06 days post challenge) in HI antibody titers in all groups registered a rise except in group D. All the chicks in group D died indicating clinical signs of Newcastle disease. The post challenge GM HI titers recorded in groups A, B, C and B at the age of 56 days was 122, 116. 108 and 133. There was non-significant (P>0.05) difference in wattle thickness (cm) among groups while group B (1.53±0.15) showed significantly (P<0.05) increased wattle thickness. The mortality was found significantly (PO.05) higher in groups A (18) and D (40) on challenge with NDV virulent virus. This indicated that 24 hr off-light decreased the immune response of the birds. Availability: Items available for loan: UVAS Library [Call number: 1080,T] (1). Place hold
Effect Of Water Restriction On The Conmsistency Of Droppings And On Subsequesnt Performance Of Broilers

by Afzal Sher, M | Dr. Muhammad Saleem Chaudhary | Prof. Dr. Muhammad Aslam Bhatti.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 1997Dissertation note: Spoilage of water and watery droppings are major factors responsible for the accumulation of excessive moisture in the poultry houses. This moisture will be deposited into the litter. Resultantly the litter becomes too wet, which in turn creates managemental problems and economic losses to the industry. Watery droppings are produced, when birds consume water beyond their metabolic requirements, because excretion of water with the faeces is almost directly proportional to the intake of water. The present study was designed to overcome this problem by restricting the water to the birds and to investigate its effects on the consistency of droppings, weight, gain, feed consumption, FCR, water intake, water: feed ratio, mortality and haematologi cal parameters. The experiment was carried out at Poultry Experimental Station, College of Veterinary Sciences, Lahore for a period of 6 weeks i.e. from 30-10-1996 to 10-12-1996. One hundred and eighty, one day old "Hubbard" broiler chicks were randomly divided into 6 groups i.e. A, B, C, D, E and F, comprising 30 chicks in each. Each group was further sub-divided into 3 replicates. These groups were given water in such a way that group NA" was offered full water and the rest of the groups were given 95, 90, 85, 80 and 75% respectively of the requirement. All the groups were reared in battery brooders under optimum environmental and managemental conditions. Same rations (starter and finisher) were fed to them. The source of water was also the same throughout the trial. They were vaccinated according to the recommended standard schedule. From second week, onwards, moisture contents of the faeces were estimated on weekly basis. It was examined that each increment of water deprivation resulted in drier faeces and lower Water: feed ratio than the control. Statistically differences (P<0.01) of weight gain, moisture contents of the excreta, FCR, water: feed ratio and blood values were recorded among the groups. The best performance was evaluated in group C and the poorest in group F. Waler stresses did not affect mortality, only 3 birds died during the whole study. Feed consumptions was found to be non-significant. Commercially these results will be helpful in controlling watery dropping, without lowering meat production, saving of water, labour and sewerage cost in poultry operations. CONCLUSION Excreta moisture can be minimized from 1.6 to 5.2% without affecting production and economics. RECOMMENDATIONS It is recornmenj, that water consumption can be reduced from 5% to 10% in a relatively cooler environment during starter and finisher phase. Reducting the water intake 15% or more had deleterious effect on the performance of broilers. Availability: Items available for loan: UVAS Library [Call number: 0530,T] (1). Place hold
Effects And Remedial Measures Of Aflatoxin B1 On Bovine Calves In Punjab

by Omer Naseer (2002-VA-65) | Dr. Jawairia Ali Khan | Prof. Dr. Muhammad Sarwar Khan | Dr. Muhammad Ovais Omer.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Aflatoxins B1 are most toxic metabolites produced by Aspergillus fungi in/on foods and feeds, probably best known and most intensively researched aflatoxins globally. AFB1 have been associated with several diseases, e.g. aflatoxicosis in livestock, pets including humans throughout the world. Occurrence of AFB1 is influenced by certain environmental factors like geographic location, agro-economic practices and susceptibility of feed commodities to fungal invasion during pre-harvest, storage, and processing periods. AFB1 has grabbed greater attention than any other mycotoxins due to their demonstrated potent carcinogenic effect in susceptible animals and their acute toxicological effects in humans. As the absolute safety will be never achieved, most of the world struggled to limit aflatoxin exposure by imposing regulations on feed commodities. So, in this study, we had collected 67 concentrated samples, thirty six samples from Gujranwala and thirty one from Kasur to examine the occurrence of aflatoxin B1. The aims of this study were to investigate the aflatoxin B1 in calf feed, effect of different concentrations of aflatoxin B1 on productive performance of calves and determine the comparative efficacy of commercially available mycotoxin binders and liver tonics against AFB1 in bovine calves. Feed samples were obtained from different livestock farms and cattle feed mills, toxin levels in each feed sample were determined by HPLC. AFB1 level was higher at feed mills (40.33±2.21 ppb and 49.0±1.95 ppb) than farms (34.96±2.65 ppb and 44.95±2.41 ppb) both in Gujranwala and Kasur respectively. Fungus was isolated and grown on Sabouraud’s dextrose agar on the basis of microscopic characters and species within genus characterized by colony characters/macroscopic characters, mostly Aspergillus species was present in the feed samples which produce mycotoxins. The second most prevalent species were the Fusarium. Mucor and the Pencillium were respectively third and fourth in number. Our results have shown that Alternaria was not present in Gujranwala and Rhizopus was absent in the feed samples collected from the Kasur. Out of mycotoxin contaminated concentrate feed samples, the highest frequency of Aspergillus (43.3%) was observed, followed by Fusaram (38.8%), Mucor (8.9%), Penicillium(5.9%), Rhizopus (1.5%) and Alternaria species (1.5%). Our results also indicated that growth of Aspergillus spp. can be minimized by controlling the different factors like pH, temperature, light and humidity, which are essential for the proper growth and development. The antifungal activity of methanolic extract of clove, neem and garlic was also determined in which maximum MIC showed by garlic. Thirty six bovine calves of 6 to 12 months of age were kept in UVAS, Pattoki campus (Ravi Campus) .in four different replicates having 9 animals each. Different concentrations, i.e. 0.6 mg/kg, 0.8 mg/kg and 1.0 mg/kg was administered along with concentrated feed and check out productive performance along with physiological profile. The most pathological concentration of aflatoxin B1 in experiment number 3 was given to the two groups of bovine calves along with two different commercially available mycotoxin binders i.e. Yeast based and second one was clay based HSCAS mycotoxin binder at recommended doses. Efficacy of mycotoxin binders on feed samples was analyzed by using HPLC and also evaluates the productive performance of the animals.Efficacy of two liver tonics i.e.silymarin and choline chloride was observed on CBC, LFT and RFT of bovine calves. Present study has clearly displayed the adverse effect of aflatoxin B1 on feed consumption, hematological and serum biochemical parameters related to liver and kidney in bovine calf. Results indicated that HSCAS mycotoxin adsorbent was able to fully detoxify aflatoxin B1. Silymarin had great impact on the liver to cope the adverse effects of the AFB1 as compared to the choline chloride, which was proved with the help of CBC, LFT and RFT. Availability: Items available for loan: UVAS Library [Call number: 2630-T] (1). Place hold
Effects Of Aflatoxin In Poultry

by Ata-ur-Rehman Rizvi, Syed | Not Available | Not Available.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 1988Dissertation note: A total number of 300 samples of finished commercial poultry feeds, obtained from poultry feed mills (75 samples), wholesale poultry feed dealers (70 samples) and poultry farms (155 samples) were examined for aflatoxin contamination.It was found that 126 (42%) samples, including 18 (24%) from mills, 19 (27.1%) from dealers and 89 (57.42%) from farms were samples was carried out both by the aqueous acetone method, and the chloroform extraction method. The extracts were qualitatively examined by quick screening method, minicolumn chromatography method and thin layer chromatography method. All of three methods gave comparable results. The quantity of aflatoxin in contaminated samples ranged from 20 microgram/kg to 2000 microgram/kg. The levels of aflatoxin in majorityofthe contaminated samples (90.5%) ranged from 20 microgram/kg to 150 microgram/kg feed and only 9.5% of samples contained higher levels of aflatoxin. Most of the samples containing higher levels of aflatoxin came from commercial poultry farms. These farms had complaints of high mortalities and poor performance in broilers and low production and low mortalities in breeder flocks. The experimental production of aflatoxin was carried out on long grain rice using a toxigenic strain of Aspergillus parasiticus (FRR-2752). The rice cultures were incubated at 28 degree centigrade in an atmosphere of high humidity. In the present study a maximum yield of 803 microgram aflatoxing rice was obtained. The determination of LD50 of aflatoxin was carried out in 210 one day old Hy-Bred broiler chicks with an average weight of 38 gram each. The chicks were divided into 21 groups labeled from 1 to 21 with 10 birds in each. A single dose of aflatoxin, ranging from 32.82 mg/kg body weight to 0.33 mg/kg body weight, was inoculated into the crops of chicks in groups 1 to 19, the group 20 acted as solvent control and the group 21 as aflatoxin free control. The birds were observed for 7 days post inoculation. The physical state and mortalities were recorded. The birds which had received higher levels of aflatoxin died within few hours of inoculation showing symptoms and lesions of per acute aflatoxicosis. The LD50 was calculated by Abbot's probit method and was found to be 9.278 mg/kg body weight. The pathological effect of a single dose of aflatoxin B1 on the immunocompetent organs was studied in a group of broiler chickens. Day-old 60 Hy-Bred broiler chicks were raised on aflatoxin free feed for 3 weeks and then divided into six groups labeled 1 to 6 with 10 birds in each. A single dose of pure aflatoxin B1 at dose rates of 8, 16, 26, 50 and 100 microgram/birds was given to the birds in groups of 1 to 5 respectively, the sixth group acted as toxin free control. The birds were maintained on aflatoxin free feed and water ad lib and observed for 3 weeks post inoculation. The bursa of Fabricius, thymus and spleen of each bird was removed and histologically examined, No appreciable histological changes were seen in the organs of birds which had received 8, 16 and 26 microgram AFB1/bird while reductions in size accompanied with other degenerative changes were seen in the thymus glands, bursa and spleens of birds, which had been injected 50 and 100 microgram AFB1/birds respectively. The normal tissues of these organs were replaced by the inflammatory and fibrous tissues. No changes, gross pathological or histological, were seen in the thymus glands, bursa and spleen of control group birds. The Immunomodulatory effects of a single dose of 100 microgram aflatoxin B1/bird on the development of immunity against Newcastle disease virus vaccine was studied in broiler and layer chickens. A group of 120 one day-old Hy-Bred broiler chicks were divided ito two groups with 60 birds in each and raised for 3 weeks on an aflatoxin free feed.Three randomly selected chicks were bled on the first 7th, 14th and 21st days of age for the determination of maternal haemagglutinin inhibiting (HI) antibody titers. At 3 weeks of age the broilers of each batch were further subdivided into groups labeled as T, T1,T2, K1 and K2 with 10 birds in each. A batch of layer chicks was raised for 8 weeks on aflatoxin free feed and then divided into groups T, T1, T2, K1 and K2 with 10 birds in each. Three randomly selected chicks were bled on day one and thereafter weekly for determination of maternal H1 antibody titers till the 7th week of age. The birds in groups T received vaccine and aflatoxin simultaneously, the birds in groups T1 received vaccine 72 hours before toxin and the birds in groups T2 received toxin followed 72 hours later by vaccine. The birds in group K1 acted as toxin free vaccinated control and the bird in groups k2 acted as toxin free unvaccinated control. The birds were maintained on aflatoxin free feed for further 4 weeks. Three randomly selected birds of each group were bled weekly for the determination of serum H1 antibody titers. At the end of 3rd week post inoculation one batch of broilers and the layer groups were challenged with a virulent strain of Newcastle Disease Virus while the other batch of broilers was given a booster dose of vaccine. All of the birds in unvaccinated aflatoxin free control groups (k2) died within 72 hours of challenge, while the rest o the birds survived. The survivors were bled and sacrificed one week after challenge/booster vaccination. The Sera of birds were examined for H1 antibody titers. The results showed that the administration of aflatoxin alongwith, immediately before or after vaccination depressed the development of H1 antibodies significantly. Immunomodulation caused by continued feeding of aflatoxin on the development of immunity against Pasteurella multocida vaccine were studied in layer and broiler chickens. Seventy two one-day old hyline layer chicks were raised for 6 weeks on aflatoxin feed and then divided into groups T, T1, T2, T3, K1 and K2 with 12 birds in the Seventy two Hy-Bred broiler chicks, one-day old were divided into 6 groups T, T1, T2, T3, K1 and K2 with 12 birds in each. A toxic feed containing 2.1 microgram of aflatoxin/gram was prepared. The Birds in groups T were given toxic feed for 42 days (21 days before and 21 days after vaccination). The birds in groups T1 were fed toxic meal for 21 days before vaccination and those in groups T2 were fed toxic meal for 21 days after vaccination. The birds in groups T3 received a single dose of 9.278 mg Aflatoxin/kg body weight on the day of vaccination. The birds in the groups K2 as toxin free vaccine free control. All of the birds, except those in the groups K2, were vaccinated with Pasteurella multocida vaccine at the end of 3rd week of age in the broilers and 9th week of age in the layers and challeneged with a virulent Pasteurella multocida organisms 3 weeks post vaccination. After challenge the birds were shifted to aflatoxin free feed till the termination of the experiment. In layers one bird each of group T and T3 died. In unvaccinated toxin free control group of layers as well as broilers (K2) 11 out of 12 birds died. Six broilers of group T and 5 broilers of group T3 died after challenge. The experiment was terminated on the 7th post challenge. The survivors were bled and sacrificed. Serum was collected from 4 randomly selected birds on the day of vaccination and thereafter weekly till the termination of the experiment. The antibody titer were determined by IHA and ELISA tests. Continued feeding of aflatoxin depressed the development of humoral immunity against Pasteurella multocida vaccine, the depression being more pronounced in broilers. The pathological effects of aflatoxin were studied in 3 weeks old broiler chicks. A batch of 36 one day-old broiler chicks was raised on aflatoxin free feed for 3 weeks. On 21 days of age the chicks were divided into 3 groups T, T1 and C with 12 birds in each. A single dose of 9.278 mg/kg body weight was injected into the crop of birds in group T. The birds in group T1 were maintained on a feed containing 9.278 mg aflatoxin/bird (2.1 ug/g feed) for 4 weeks. The third group (k) acted as control. The experiment was terminated on the 49th day of age by sacrificing the survivors. The liver of birds in group T1 were enlarged, and the heart were atrophied. Regenerative changes, some bile duct hyperplasia and fatty changes were seen in liver of birds in group T. in Birds of group T2 the liver was enlarged and showed nodular hyperplasia. Histologically the liver tissue showed acute necrosis, pericellular fibrosis, nuclear dissolution, bile duct proliferation and lymphoid hyperplasia. Degenerative changes were also seen in the heart and kidneys and other organs. No gross or histological changes were present in the organs of the control group (K) birds. The effects of aflatoxin on the live weight, dressed weight, the weight of liver, heart and gizzard, some seral enzymes and bilirubin were studied in a group of 165 broiler chicks. Day old Hy-Bred broiler chicks were raised on aflatoxin free feed for 3 weeks and then divided into 3 groups T, T1 and K with 55 birds in each. The birds in group T received a single dose of 9.278 aflatoxin/kg body weight while the birds in the group T1 received 9.278 mg aflatoxin/bird which was mixed in feed and offered ad. Lib. To these birds over the next 4 weeks. The birds in group K acted as the toxin free control. The experiment was terminated on the 28th day post inoculation by sacrificing the survivors. Five chicks from each group were bled through cardiac puncture and sacrificed, daily from day one (21st day age) to the 7th day post inoculation (28th day age) and thereafter weekly till the end of the experiment. Serum of these birds was examined for SGOT, SGPT, LDH, SAP and Bilirubin. Continued feeding of aflatoxin or administration of a single dose of aflatoxin significantly depressed the live weight, dressed weight and weight of heart, while it significantly increased the weight of liver and gizzard. Administration of a single dose of aflatoxin produced dramatic increase in the volume activity of SGOT, SGPT, LDH,SAP bilirubin within 24 hours of toxin administration, the values remained higher during the first week and thereafter slowly came down. In birds fed on contaminated meals the enzymic activity and bilirubin gradually increased during the first week and remained high till the termination of the experiment. In the birds of control group the activity of these parameters remained on baseline levels. No Carcinogenicity was seen in any of the internal organs of layer chickens which had been raised for 1 year on feed containing 2 ug aflatoxing. No aflatoxin or aflatoxin residue could be detected in the liver, kidneys and breast muscles of broilers, which had been fed contaminated meals for various lengths of time, and were shifted to aflatoxin free feed 7 days before slaughter. Aflatoxin was recovered from the liver and kidneys of layers which were feeding a contaminated meals at the time of sacrifice, the rate of recovery being 1 microgram/100 grams liver tissue and less than 1 microgram/100 gram kidney tissue. No aflatoxin could be detected in the breast muscles of these chickens. Availability: Items available for loan: UVAS Library [Call number: 0014,T] (1). Place hold
Effects Of Ginkgo Biloba And Panax Ginseng On Metabolism Of Carbohydrate, Lipids And Insulin Receptor Genes In Diabetic Rats

by Mahrukh Naseem (2011-VA-531) | Dr. Muhammad Quaid Zaman | Dr. Imtiaz Rabbani | Dr. Hafsa Zaneb.

Material type: book Book; Literary form: not fiction Publisher: 2014Dissertation note: Diabetes is a major public health issue. As conventional pharmaceutical agents have greater incidences of adverse effects so the interest in the natural remedies has increased greatly in the last few decades. Ginkgo biloba leaf extract (GBE) and Panax ginseng root extract (PGE) are ancient Chinese herbal drugs that have prominent position in the list of the best-selling natural remedies and are increasingly being used for the treatment of diabetes. The anti-diabetic effect of GBE is attributed to flavonoides while that of PGE is attributed to ginsenosides. In this study, GBE and PGE in combination showed significantly higher anti-diabetic effects than individual extracts in diabetic rats. Adult Wistar rats were allowed to feed on a high fat diet (HFD: 12.7% maize starch, 6.5% dextrose, 3.9% sunflower oil, 31.3% beef tallow and 28.6% casein by weight) for two weeks. The rats were divided into seven groups (08 rats in each group): Non-diabetic control group, Diabetic group, Diabetic + 100 mg/kg G. biloba leaf extract treated group (GBE), Diabetic + 300 mg/kg, P. ginseng root extract treated group (PGE), mixed 1 group : Diabetic + combination of both GBE and PGE at dose of 200 mg/kg/day (50mg/kg/day of GBE and 150mg/kg/day of PGE), mixed 2 group : Diabetic + combination of both GBE and PGE at dose of 400mg/kg/day (100mg/kg/day of GBE and 300mg/kg/day of PGE), mixed 3 group : Diabetic + combination of both GBE and PGE at dose of 600mg/kg/day (150mg/kg/day of GBE and 450mg/kg/day of PGE). At the end of the 14th day, the rats were kept in fasting condition overnight and then a single intra-peritoneal injection of alloxan monohydrate (Sigma, USA) dissolved in 0.5 ml of saline solution at a dose of 120-130 mg/Kg body weight was injected in all rats except for the non-diabetic group which were injected with an equal volume of normal Summary 79 saline. Body weight (BW) and blood glucose were measured at week 1 and week 14. At the end of the experimental period, blood samples in fasting/ basal state were collected from heart puncture for the biochemical parameters. Liver, muscles and adipose tissue were also collected for mRNA expression of genes involved in carbohydrate and fat metabolism. Results were expressed as Means ± S.E.M. Statistical analyses was performed using Statview software (SAS Institute Inc., SAS Campus Drive, Cary, NC, USA). Two-ways repeated measure ANOVA followed by PLSD Fisher's test was performed for BW and blood glucose to assess the effects of time and herbal drugs. For the rest of the parameters, one-way ANOVA followed by PLSD Fisher's test was performed to assess the effect of herbal drugs. Differences were considered significant at P < 0.05. A significant (P < 0.0001) reduction in the BW of the diabetic group was recorded compared to non-diabetic rats and a significant reduction in BW was observed after treatment in all the five treated groups compared to diabetic group. Glycemia was significantly higher in the diabetic rats (P < 0.0001) compared to non-diabetic rats and a significant reduction in the blood glucose level was recorded in all the five treated groups (P < 0.0001) group in comparison to the diabetic group. A significant reduction for fasting serum glucose (FSG) (P < 0.0001) was recorded for all the five treated groups compared to the non-treated diabetic rats. We linked the reduction in hyperglycemia to the mRNA expression of genes involved in glucose metabolism. In particular, we studied the gene expressions of GLUT-4, insulin receptor (IR), insulin receptor substrate-1 (IRS-1) and phosphoenolpyrovate carboxykinase (PEPCK) in liver, muscle and adipose tissue. A significant up-regulation for the mRNA expression of GLUT-4 was observed only in muscle in all the five treated groups, i.e. GBE (P < 0.001), PGE (P < 0.001), mixed 1 (P < 0.0001), mixed 2 (P < 0.0001) and mixed 3 (P < 0.0001). We found a significant down- Summary 80 regulation in the mRNA expression of IR in muscle (P < 0.0001) and adipose tissue (P < 0.05) in the diabetic group compared to non-diabetic rats, however, a significant up-regulation was found in mixed 3 group in muscle (P < 0.001) and adipose tissue (P < 0.05). We found a significant down-regulation (P < 0.001) for IRS-1 in liver in diabetic state and a significant up-regulation was recorded in GBE (P < 0.05) and mixed 3 (P < 0.05) groups only. We found a significant down-regulation of IRS-1 in muscle (P < 0.0001) and adipose tissues (P < 0.0001) in the diabetic group. None of the treated group showed significant results in muscles however, a significant up-regulation was found only in PGE (P < 0.001) and in the mixed 3 group (P < 0.0001) in adipose tissue. A significant up-regulation was recorded for PEPCK in GBE (P < 0.05), mixed 1 (P < 0.05), mixed 2 (P < 0.05) and mixed 3 (P < 0.05) groups in liver. A significant increase of blood cholesterol was found in rats in the diabetic state (P < 0.0001) and a significant reduction was found only in the mixed 3 (P < 0.001) treated group. A significant decrease was found for VLDL-C in mixed 1 (P < 0.05), mixed 2 (P < 0.0001) and mixed 3 (P < 0.0001) groups. A significant decreased was observed for LDL-C in mixed 1, mixed 2 and mixed 3 (P < 0.0001) groups which previously found to be enhanced in diabetic condition. In case of HDL-c a significant decreased was found for GBE (P < 0.001), PGE (P < 0.05), mixed 1 (P < 0.001), mixed 2 (P < 0.0001) and mixed 3 (P < 0.0001) which was previously found to be increased in the diabetic group (P < 0.0001). Conversely, a significant increase was seen for TG (P < 0.0001) in the diabetic state and a significant reduction was found in all the five treated groups (P < 0.0001). We further studied genes involved in lipid metabolism. A significant up-regulation was found for SREBP-1c in diabetic group (P < 0.0001) and a significant down-regulation was found to occur in mixed 2 (P < 0.05) and mixed 3 (P < 0.001) treated groups compared to untreated diabetic rats. In the liver, a significant up-regulation Summary 81 in the mRNA expression of FAS was found only in mixed 2 (P < 0.05) and mixed 3 (P < 0.05) treated groups which found to be down regulated in the untreated diabetic group (P < 0.001). A significant down-regulation in the mRNA expression of PPAR-α was found in diabetic rats skeletal muscle (P < 0.05), however, a significant up-regulation was found in GBE (P < 0.001), PGE (P < 0.05) mixed 1 (P < 0.001), mixed 2 (P < 0.001) and mixed 3 (P < 0.001) treatment groups in comparison to diabetic rats. We studied PPAR-γ in adipose tissue and found a significant up-regulation in PGE (P < 0.05), mixed 1 (P < 0.001), mixed 2 (P < 0.001) and mixed 3 (P < 0.0001) groups which had previously been found to be down regulated (P < 0.001) in diabetic rats compared to non-diabetic rats. We found that the body of the diabetic rats suffer with oxidative stress and measured a significant decrease for CAT (P < 0.0001) in diabetic group and significant increase was found in GBE (P < 0.05), PGE (P < 0.05), mixed 1 (P < 0.05), mixed 2 (P < 0.05), mixed 3(P < 0.05) groups compared to diabetic rats. Whereas, a significant decreased was recorded for MDA in GBE (P < 0.05), PGE (P < 0.05), mixed 1 (P < 0.001), mixed 2 (P < 0.001) and mixed 3 (P < 0.0001) groups, which previously showed a significant increased (P < 0.001) in diabetic group compared to non-diabetic. We linked oxidative stress with TNF- α and found a significant up-regulation (P < 0.0001) for all the three studied organs in diabetic groups compared to the non-diabetic group. In case of liver a significant down-regulation was found for GBE (P < 0.0001), PGE (P < 0.0001) and mixed 3 (P < 0.0001) groups compared to untreated diabetic rats. A significant down-regulation in the expression of TNF- α in muscle was recorded only in the mixed 2 (P < 0.001) and mixed 3 (P < 0.0001) groups compared to diabetic rats. However, a significant down-regulation in the expression of TNF- α in adipose tissue was observed for all the treated groups (P < 0.0001 for all groups) in comparason to the diabetic group. Summary 82 For serum creatinine a significant enhancement was observed for PGE (P < 0.05), mixed 1 (P < 0.05) and mixed 3 (P < 0.05) groups which were previously found to be reduced in diabetic rats. A significant increase for AST was found in diabetes (P < 0.0001) compared to non-diabetic rats, while a significant reduction was found to occur only for PGE (P < 0.05), mixed 2 (P < 0.05) and mixed 3 (P < 0.001) treated groups in comparison to the untreated diabetic group. Like AST a significant reduction was recorded for ALT in the diabetic group (P < 0.001) and only GBE (P < 0.001), PGE (P < 0.05) and mixed 3 (P < 0.05) showed a significant decreased in ALT level compared to untreated diabetic rats. In conclusion, we found that both GBE and PGE have strong individual anti-hyperglycemic, anti-hyper-triglyceridemic and anti-oxidative effects in an alloxan monohydrate induced rat model of diabetes. Both also showed strong influence on the activation on the expression of genes involved in the metabolic pathways of glucose and lipid which previously became dysfunctional in diabetic rats. When both these natural remedies were given in combination, synergistic effects were recorded in a dose dependent manner. Further work is needed to evaluate the way by which human beings suffering from diabetes are safely treated with these herbal remedies. Availability: Items available for loan: UVAS Library [Call number: 2260-T] (1). Place hold
Effects Of Stair-Step Nutrition Regimen On Growth Rate, Nutrien Utilization And Pubertal Development In Nili-Ravi

by Muhammad Iqbal Anjum | Prof. Dr. Mukhdoom Abdul Jabbar | Prof. Dr | Prof. Dr. Talat Naseer Pasha.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2011Dissertation note: Under this study, effect of stair-step nutritional regimen compared to the standard NRC recommended energy levels on growth rate, nutrient utilization, some selected blood metabolites, pubertal age, conception rate and economic analysis in ili- Ravi buffalo heifers were measured. Study lasted for 18 months during the years 2008- 20 I O. Twenty-two heifers, 6-8 month old, 98.57±5.07 kg average ody weight were divided into two equal groups and randomly assigned either control or stair-step nutritional regimen (SSNR) diets. The SSNR was designed in three phase program each having 6 months duration i.e., postweaning (7 to 13 month age), repubertal (13 to 19 month age) and pubertal/breeding (19 to 25 month age). In each phase, the treatment group during step 1, was fed on low energy diet (80% ME of NRC) for 4 months followed by high energy diet (120% ME ofNRC) for 2 months in step 2. The heifers in ontrol group were fed according to NRC (200 I) requirements of Holstein Friesian heifers continuously for 6 months. For both the groups individual feeding was carried out. Daily feed intake and fortnightly fasting weights were recorded. Nutrients digestibility and N balance trials were conducted during last week of each step during each phase. Blood samples were collected at the end of each low or high energy diets for blood metabolites analysis. Oestrus detection was done with the help of a teaser bull at age of 15-16 months. Transrectal ultrasonography was done to assess uterus and ovarian structures development. Measured blood serum progesterone concentration collected every 10 days interval at 09.00-10.00 hours during 18-20 months age by ELISA using commercial kit. The age and live weight at onset of puberty was recorded when heifer tood to be mounted by the bull first time in her life. The heifers detected in oestrus were bred by natural mating at approximately 12-15 hours of the onset of oestrus activity. Heifers not returning to oestrus were examined for pregnancy diagnosis through rectal alpation of uterus at 70-90 days post breeding. Data of feed onsumption during postweaning, prepubertal and pubertallbreeding phases were used to calculate the feed cost used per kg gain between the SSNR and control heifers. During postweaning phase, heifers fed SSNR low energy diet (2.03 Meal/kg) ained significantly (P<O.OS) lower daily weights than those fed control diet (2.SS Meal/kg), When heifers fed high energy diet (3.01 Meal/kg), daily weight gain was significantly (P<O.O 1) higher in SSNR compared to control. Average dry matter intake (DMI) was similar (P>O.OS) between the heifers of two groups. Feed conversion ratio (FCR) was poorer (P<O.OS) in SSNR heifers fed low energy diet compared to those fed control diet. But on high energy diet FCR was better (P<O.OS) in SSNR compared to control group. During prepubertal phase, there was no difference (P>O.OS) in weight gain between the heifers fed SSNR low energy diet (1.89 Meal/kg) and control diet (2.3S Meal/kg). But on high energy diet (2.80 Meal/kg) weight gain was higher (P<O.OS) in SSNR compared to control group. Average dry matter intake (DMI) was similar (P>O.OS) between the heifers of two groups. On low energy diet there was no difference (P>O.OS) in FCR between the two groups. But on high energy diet FCR was significantly (P<O.OS) better in SSNR compared to control group. Average DMI in heifers of both groups was similar (P>O.OS). During pubertal/breeding phase, similar trend of weight gain, DMI and FCR was found in SSNR versus control group as reported in prepubertal phase. Intake of DM, organic matter (OM) and crude protein (CP) as percent body weight were statistically non-significant (P>O.OS) differet between the SSNR versus ontrol groups during all phases. Metabolizable energy (ME) consumption was significantly P<O.OS) lower in SSNR group fed low energy diet than the heifers fed control diet. But ME consumption was significantly (P<O.O 1) increased in SSNR group fed high energy diet than control group. Similar, trend of ME consumption was observed in heifers fed SSNR (either low or high energy) and control diets during prepubertal and pubertal phases. Water to dry matter intake ratio in heifers during postweaning, prepubertal and pubertal phases were statistically similar (P>O.OS). In all phases, apparent DM and OM digestibility did not differ (P>0.05) between the heifers fed SSNR (either low or high energy) and control diets. Neutral detergent fibre (NDF) digestibility was higher (P<0.05) when SSNR heifers fed low energy diet, but on high energy diet NDF digestibility was significantly (P<0.05) lower compared to control, respectively, during all phases with the exception of step I in the prepubertal phase and step 2 in pubertal phase where the differences were non-significant (P>0.05) between the groups. Acid detergent fibre (ADF) digestibility with SSNR low energy diet was significantly (P<0.05) higher than the heifers fed control diets during three phases. But on high energy diet, ADF digestibility was not different (P>0.05) between the two groups. Also N intake was not different (P>0.05) between the heifers fed SSNR (either low or high energy) diets and control diets, respectively, with the exception of step 2 in the postweaning phase when the control group showed a significant (P<0.05) increase in intake of N compared to the SSNR group. Faecal N as well as Urinary N losses in heifers fed SSNR (either low or high energy) versus control diets did not differ significantly (P>0.05). All heifers have shown haematological values which are almost similar in heifers of two groups. Except total cholesterol, concentration of urea N, glucose and macro minerals in serum did not differ between the two groups. There was no significant (P>0.05) differences in age and weight at onset of puberty and number of services per conception between the two groups. Pregnancy rate in heifers fed on SSNR diet was 50% while on control diet was 57%. Fifty percent of heifer fed SSNR and 60% of heifers fed control diet as per NRC requirement had serum progesterone concentrations> 1.0 ng/ml in two samples collected 10 days apart before reaching puberty. The overall feed costs incurred (42660.88 vs 44509.96 Rs./animal) on SSNR heifers was significantly (P<0.05) less than the control heifers fed according to NRC recommendations from weaning to breeding age. Availability: Items available for loan: UVAS Library [Call number: 1376,T] (1). Place hold
Epidemiological And Molecular Profile Of Hepatitis-C Viral Infection Among Different Groups Of Population In And Around Lahore, Pakistan

by Dr. Abdul Majeed Akhter | Prof. Dr. Muhammad Athar Khan | Prof. Dr. Azhar Maqbool.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2012Dissertation note: Hepatitis C is an infectious disease affecting primarily the liver, caused by the hepatitis C virus (HCV). The infection is often asymptomatic, but chronic infection can lead to scarring of the liver and ultimately to cirrhosis, which is generally apparent after many years. In some cases, those with cirrhosis will go on to develop liver failure, liver cancer or life-threatening esophageal and gastric varices. The present project was carried out to study the prevalence of laboratory based confirmed patients of Hepatitis-C in various public, private hospitals and in high risk groups among the population of Lahore metropolitan and its distribution and pattern with respect to person, time and place. Second part of the project was designed to study the risk factors of Hepatitis-C patients from out patient departments of various public and private hospitals of Lahore. Individuals at high risk from different organizations and occupations across the city population of Lahore metropolitan were also included in the study. The third part of the project was designed to investigate the distribution of genotypes of Hepatitis-C virus among patients through RT-PCR and theireffect on viral load, various haematological and biochemical parameters. Project-I Study-1: To estimate the prevalence of hepatitis C in various public and private hospitals of Lahore Metropolitan among different groups a total of 1399 individuals were tested to estimate the hospital based prevalence of HCV. Out of these 233 individuals produced positive result for Hepatitis-C virus infection. The overall hospital based prevalence was estimated to be 16.66% during the year 2009. The current study revealed that the highest prevalence was estimated in Dialysis patients and Organ recipients (41.17%) followed by General Patients of age > 12 years (14.60%) and pregnant women (10.84%). It was further observed that the least affected group was the Children of age ? 12 years (3.85%). Study-2: The results of estimated prevalence of Hepatitis C virus infection in high risk groups from the population in and around Lahore revealed that the highest prevalence was estimated in patients with HIV/AIDS (36.36%) followed by injecting drug users (36.09%), blood donors (17.78%), long rout truck drivers (14.70%), house hold and direct contact personal (14.6%) and prisoners (14.28%). It was also find out that the less affected groups were police department (10.66%), staff nurses and other health care workers (9.87%) and barbers and beauticians (6.97%) while doctors and dental surgeons were least affected (1.32%) among the high risk groups. Study-3: To find out the pattern and distribution of HCV patients with respect to person place and time a total of 924 patients were selected from the registry of Provincial Hepatitis Control Cell Lahore through systematic random sampling. Out of these, 154 fulfilled the inclusion criteria. Among these, 90 were male and 64 were females. Average age of male and female patients was 35.88±10.49 and 37.78±9.12 years, respectively. The age difference between male and female patients was statistically non-significant (P-value>0.05). It was further observed that 147 patients were Punjabi and 7 were from other provinces. Moreover, It was found that the highest number of patients was observed during the month of December (n=18) followed by November, 2008 (n=15), March (n=15) and July, 2009 (n=14) while the least number of patients were observed during the months of September, 2008 and May, 2009 (n=10). Project-II To study the risk factors associated with HCV infection an analytical cross sectional study was conducted. Study-1: Lower socio economic class, place of birth (hospital), delivery assisted by whom and breast feeding were significantly associated with HCV infection in children of age ? 12 years. The mean age of reactive and non-reactive general patients was significantly associated (P=0.012) with anti-HCV status. Marital status (OR=2.042), socioeconomic status, blood donation (OR=2.15), prescription by doctor or non-doctor (OR=2.664), route of drug administration, relative having hepatitis and towel sharing (OR=1.987) were also significantly associated (P<0.05) risk factors for HCV infection. The mean age of reactive and non-reactive pregnant women was 27.55±3.43 and 25.37±4.24 years, respectively. Educational level (OR=3.093) and occupational status (OR=2.228) were the important risk factors associated with HCV infection. Tattoo on the body (OR=11.833), comb sharing (OR=20.86) and razor sharing (OR=4.786) were significantly associated (P<0.05) with HCV infection. Pregnant women who gave the history of dental procedures and tooth brush sharing were 3.15 and 4.12 times more prone to get HCV infection, respectively. In 205 patients having dialysis and organ recipients 41.17% patients were reactive for Anti-HCV. Blood transfusion, glass sharing and qualification of the patients were significant factors in this group. Study-2: In case of doctors/dental surgeons a significant association was observed with history of blood transfusion and duties in medical and surgical wards. The nurses who worked in surgical wards, visited beauty salons were significantly associated (P<0.05) with HCV infection. Among health care workers age, gender and other factors did not have any significant influence on the reaction of HCV. Among blood donors female to male ratio was 1:16.5. It was found that the occupational status (p=0.002), place of surgical treatment (p=0.035), history of blood transfusion (p=0.000), ever pricked by sharps (p=0.045), habit of injecting drugs (p=0.04) and glass sharing (p=0.017) were significantly associated with occurrence of hepatitis C in blood donors. In long route truck drivers geographical status, surgical procedure, dental treatment and family history were significantly associated (P<0.05). Among the injecting drug users, demographic factors like marital (P=0.007) and educational status (P=0.000) were found to be significantly associated with HCV infection. Furthermore, the behavioral factors; use of injectable drugs with reused syringes (P=0.003), sharing of syringes in groups (P=0.004), place of shaving (P=0.000), use of disinfected ustra (razor) (P=0.003) and razor sharing (P=0.000) were significantly associated with anti-HCV status for IDUs. Among HIV/Aids patients a statistically significant (P<0.05) difference was present among the ages of reactive and non reactive patients. Comb sharing has also a positive effect of HCV but all other factors were not contributing in this group. In Police personals odds ratio for married persons was higher (9.57) but statistically insignificant. The mean age for reactive persons was 39.75±8.24 years. A non-sexual contact with HCV patient and spoon sharing were significantly associated. In prison inmates skin infection and sexual involvement were significantly associated (P<0.000) with HCV infection. In the group of 43 barbers/beauticians age, working shift, tattoo on body (OR=19.5), injecting drugs (OR=19.5) and pre-testing for HCV (OR=19.5) were significantly associated with HCV infection. In house hold and direct contact group previous history of accidents and family history of HCV (OR=18.36) were significantly associated with HCV infection. Project-III A molecular epidemiological study was conducted in which the HCV reactive patients as tested by ELISA test were subjected to viral load and genotyping through RT-PCR. The positive cases of Project-I were included in this project. In the present study 558 patients were reactive for Anti-HCV. Out of these, 34 (6.09%) patients had Type-1 genotype, 67 (12%) patients were accounted for Type-2 and 410 (73.47%) patients were positive for Type-3. Multiple genotypes were seen in 19 (3.4%) patients, 9 (1.61%) patients had un-type able genotype whereas in 19 (3.4%) patients genotype could not be detected. According to the distribution of genotype-1, 1a was present in 30 (88.23%) while 1b was seen in 4 (11.76%) patients. In patients of Type-2 genotype, 2a and 2b were present in 54 (80.59%) and 13 (19.40%) patients, respectively. In patients having Type-3, 3a and 3b were identified in 353 (86.09%) and 57 (13.90%) patients, respectively. Furthermore, Bilirubin, ALT, AST, ALPT, viral load, Hb, TLC, DLC, Platelet and ESR were statistically same in all genotype. Availability: Items available for loan: UVAS Library [Call number: 1529,T] (1). Place hold
Epidemiological Intelligence On Distribution & Dynamics Of Main Transboundary Diseases Of Ruminants In The Central Districts Of Punjab

by Muhammad Akram | Prof. Dr. Muhammad Athar Khan | Prof. Dr. Muhammad Sarwar Khan.

Material type: book Book; Format: print Publisher: 2007Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1844,T] (1). Place hold
Epidemiological Studies And Evaluation Of Anthelmintic Resistance Against Gastrointestinal Nematodes Of Sheep In Balochistan

by Hamdullah | Dr.Muhammad Lateef | Prof | Prof. Dr. Azhar maqbool.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1960,T] (1). Place hold
Epidemiological, Haematological & Serological Studies Of Leptospirosis In Dogs And Human At High Risk In And Around Lahore City

by Muhammad Hassan Saleem | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr. Muhammad Arif Khan.

Material type: book Book; Format: print Publisher: 2013Dissertation note: Leptospirosis is an important zoonosis of global importance capable of causing significant subclinical and clinical syndromes both in humans and animals. The disease is characterized by fever, vomiting, diarrhea, myalgia and other signs consistent with renal and hepatic disease. Considering the significance and the substantial losses rendered by Leptospirosis, the present project was designed to study epidemiology and haematology in dogs and humans at high risk in Lahore district and its peri-urban areas. The study was accomplished in 4 phases. In phase-I, sero-prevalence both in dogs and human was studied including case fatality rate and associated risk factors through cross a sectional study. For this purpose, blood samples were collected from dogs attended at the Pet Centre of University of Veterinary and Animal Sciences, Lahore and other private clinics situated in and around Lahore area through systematic random sampling technique over a period of one year (1st Dec. 2010 to 30th Nov.2011). Blood samples from every fifth un vaccinated dog were collected, but if the dog was vaccinated then the sample was collected from the next unvaccinated one. In this phase 100 sera samples from human volunteers which were at maximum risk (veterinarian, pet and livestock owners, para-vet staff) were also collected. All samples were screened out by using ELISA kits like Canine Leptospira IgG ELISA Kit Catalog no. BG-CAN11485, NovaTein Biosciences, Woburn, MA, USA and Serion Elisa Plate, Virion/Serion GmbH, Wurzburg, Germany for dogs and humans respectively at the Medicine Laboratory and University Diagnostic Laboratory, University of Veterinary and Animal Sciences, Lahore. To study overall prevalence of Leptospirosis in dogs a total of 429 dogs were examined and it was found that out of 429 blood samples 155 were found positive for Leptospira antibodies. Thus an overall prevalence of Leptospira was recorded as 36.13%. Prevalence of Leptospirosis in dogs during different months of the year was also recorded. The months of September, October and June showed ere the highest prevalence and recorded as 50%, 48.57% and 45% respectively. Although, a few cases were seen during the months of December, January and February while moderate number of cases was recorded during the rest months of the year. There was a significant difference (p<0.05) in the prevalence of Leptospirosis during the different months of the year. Out of these 429, 93 pups and 336 adults were examined for Leptospirosis and found that 26 pups and 129 adults were positive i.e. a prevalence rate of 27.95% (26/93) and 38.39% (129/336) for Leptospirosis was recorded in pups and adult dogs respectively and this difference was non-significant (p>0.05). In this study a prevalence rate of 38.49% (102/265) and 32.31% (53/164) for Leptospirosis was recorded in male and female dogs respectively and this difference between the sexes was also non-significant(p>0.05). According to the results of this study a sero-prevalence of 21.24% (24/113) in winter, 35.82% (24/63) in spring, 40.34% (71/176) in summer and 49.32% (36/73) were recorded in fall season and this difference was significant (p<0.05). The highest prevalence rate was observed in fall and summer seasons of the year during higher rain fall seasons of the year. To study overall prevalence of Leptospirosis in humans, a total of 100 blood samples were examined through random sampling technique during the whole study period and overall prevalence rate of 44.00% was observed in human population. Different risk factors like different months of the year, age, sex and season were also studied and that the highest prevalence of Leptospira in humans was observed in the months of March, April and August i.e. 66.66%, 66.66% and 60.0% respectively. No significant difference (p>0.05) in the sero-prevalence of Leptospirosis in human during the different months of the year was observed. Sex-wise prevalence rate of 48.71% (38/78) and 27.27% (06/22) for Leptospirosis was recorded in male and female respectively and this difference was significant (p<0.05). The results of this research project revealed a prevalence rate of 47.29% (35/74) and 34.61% (09/26) for Leptospirosis in adults and young ones respectively and this difference was again non-significant (p>0.05). According to the results of this study a sero-prevalence of 41.93% (13/31) in summer, 40.00% (06/15) in fall and 25.92% (07/27) in winter, while 66.66% (18/27) was recorded in spring season of the year and this difference was significant (p<0.05) and the highest prevalence rate was observed in spring. In phase-II, the effect of Leptospirosis on various blood parameters were determined in both dogs and human. The results of present study revealed a significant difference (P<0.05) between the Hemoglobin (Hb), Erythrocytic sedimentation rate (ESR), Packed cell volume (PCV), Total Leukocytic count (TLC), Neutrophils, Eosinophils and Monocytes of healthy and Leptospira affected dogs, while a non-significant difference was observed (P >0.05)among values of lymphocytes. It showed that values of Hb forthe diseased dogs were lower than healthy ones while ESR, PCV, TLC, Neutrophils, Eosinophils and Monocytes, were more than in normal dogs. Likewise, in humans all the studied parameters were significantly (P <0.05) different between infected and healthy ones. The values of Hb concentration in diseased humans were lower than the healthy ones while ESR, PCV, TLC, Neutrophils, Eosinophils, Basophils, and Monocytes were higher than in healthy people. A negligible change was observed in the percentage count of lymphocytes. In phase-III, the comparative efficacy of commercially available vaccines against Leptospira was studied. Two commercially available vaccines, Vaccine #1 with protection against two serotypes of Leptospira (Canicola, Icterohaemorragiae) and vaccine #2with protection against four serovars of Leptospira i.e Canicola, Icterohaemorrhagiae, Grippotyphosa and Pomona were compared After six months it was observed through ELISA screening that the vaccine #2 provided better overall protection compared to the vaccine #1 to the pups as well as adult dogs against the Leptospirosis but this difference was non-significant (p>0.05). In the last phase of this study the chemotherapy trial was conducted. Results found that the efficacy of Penicillin G was 70%, while in group B Amoxicillin produced 60% results and in group C Sarsaparilla proved to be 40% effective against this infection although this difference was non-significant (p>0.05). It is concluded that among therapeutic agents used to treat Leptospirosis in dogs, Penicillin G , Amoxicillin and Sarsaparilla are ranked in respective order of efficacies. Availability: Items available for loan: UVAS Library [Call number: 1588,T] (1). Place hold
Epidemiological, Haematological And Biochemical Risk Factors Of Parturient Haemoglobinuria In Buffaloes

by Altaf Mahmood | Prof. Dr. Muhammad Athar Khan | Prof. Dr. Muhammad Arif Khan.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2011Dissertation note: Parturient haemoglobinuria is disease of economic importance which affects a considerable number of buffaloes every year in India, Pakistan and Egypt. It is a non infectious hemolytic syndrome characterized by intravascular haemolysis, hypophosphataemia, haemoglobinaemia, haemoglobinuria and anaemia. The exact pathogenesis is not known and diversified etiological factors have been associated with this disease in different parts of the continent. Information on multidimensional etiological aspects of this buffalo syndrome is quite scanty. The present study was therefore carried out in district Chakwal for assessment of disease burden (parturient haemoglobinuria), its distribution and quantification of associated epidemiological, haematological and biochemical risk factors in order to suggest control measures and future research priorities. Active surveillance was conducted in eight randomly selected villages of district Chakwal from April 2010 . March 2011. All breeding age buffaloes (1938) of these selected villages were taken as sampling frame whereas one breeding age buffalo was taken as sampling unit. Parturient haemoglobinuria appeared as number one disease among all problems of breeding age buffaloes with respect to mortality rate (1.03%) and proportional mortality rate (20%) whereas it appeared as 8th and 7th disease respectively with respect to incidence (3.97%) and case fatality (25.97%) rates. Case-Control study was conducted for quantification of epidemiological risk factors associated with disease by analyzing the data of 180 case-control pairs for various 162 hypothesized risk factors. . 7 months pregnancy, . 3 lactation number, . 60 days postpartum period, . 7 years age, previous history of haemoglobinuria and ingestion of cruciferous plants were recorded as significant (P . 0.05) risk factors with odds ratios of 15.80, 6.39, 6.23, 5.56, 3.41 and 2.51 respectively. Clinical trial was conducted on 30 haemoglobinuric buffaloes randomly divided into three groups with 10 animals in each group to compare and assess the recovery rates of three different treatment packages against parturient haemoglobinuria. The highest recovery rate (100%) was recorded for combined therapy of sodium acid phosphate and blood transfusion followed by sodium acid phosphate with antifibrinolytic drug tranexamic acid (70%) and tranexamic acid with Novacoc injection (50%). Cross-sectional epidemiological study was conducted on haemoglobinuric (n = 30) and healthy (n = 60) buffaloes for quantification of haematological and biochemical risk factors associated with parturient haemoglobinuria. Red cell count (. 5 ~ 106 /ƒÊl), haemoglobin (. 8g / dl), haematocrit . 25%, mean corpuscular volume (. 50fL), mean corpuscular haemoglobin (. 20pg) and erythrocyte sedimentation rate( . 80mm / 1st hour) were recorded as significant (P . 0.05) haematological risk factors with odds ratios of 26, 17.81, 28.95, 21, 12.25 and 26 respectively whereas billirubin unconjugated (. 0.2mg /dl), billirubin total ( . 0.3mg /dl), phosphorous (. 2.5mg /dl), molybdenum (. 70ƒÊg /dl) and selenium (. 15 ƒÊg /dl) were recorded as significant (P.0.05) biochemical risk factors with odds ratios of 26.55, 26.55, , 7.50, 11 respectively. Experimental study was conducted to determine the effect of orally administered gossypol on haematological and biochemical parameters of eight female rabbits of six 163 months age purchased from local market and maintained at university of veterinary and animal sciences from February 2011 . April 2011 under optimum conditions. The cotton seed cake containing free gossypol contents of 0.25% was fed to rabbits @ 4 grams per kg per day in addition to their routine diet including good quality fresh vegetables (cucumbers, spinach, cabbage & carrots) and clean water ad-libitum. Blood samples of each rabbit were collected after every 15 days interval and analyzed for haematological and serum biochemical parameters. Significant (P.0.05) decrease was recorded in total erythrocyte count, haemoglobin concentration, haematocrit, mean corpuscular volume and serum inorganic phosphorous whereas significant increase was recorded in mean corpuscular haemoglobin, mean corpuscular haemoglobin concentration, red cell distribution width, total leukocyte count, lymphocytes and monocytes from 0 . 60th day with the passage of time whereas non significant (P.0.05) difference was recorded with respect to granulocytes and serum calcium concentration. Availability: Items available for loan: UVAS Library [Call number: 1429,T] (1). Place hold
Epidemiology And Control Of Gastro-Intestinal Nematodes Of Large Ruminants In Balochistan

by Muhammad Ramzan (2009-VA-653) | Dr. Nisar Ahmad | Prof. Dr. Muhammad Azam Kakar | Prof. Dr. Kamran Ashraf | Prof. Dr. Aneela Khurram.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: The main area of research in this study was to assess the prevalence, hematological aspects of Bovine nematodiasis. Three main experiments were conducted to highlight the objectives of the present research study. The first experiment was conducted to find out the prevalence of large ruminants major nematodes for one year. For this purpose buffalo and cattle of either sexes and between < 1 year to > 2 years of age were selected from two sites i.e., Quetta and Qilla Abdullah. Fecal analysis of these cattle and buffalo showed overall higher (33.99%) nematodes prevalence recorded in buffalo in Quetta, (27.99%) in cattle at Qilla Abdullah followed by in cattle at Quetta (26.66%). Five nematode infection was recorded in all two experimental sites with higher prevalence of Haemonchus contortus in buffalo at Quetta and Ostertgia ostertagi in cattle at Quetta and Qilla Abdullah. The buffalo and cattle of < 1 year presented higher nematodes prevalence than 1-2 years and > 2 years. The female buffalo and cattle were infected with nematodes prevalence higher than male animals. These five nematodes were prevalent almost throughout the year, however a peak infection was recorded during August and September in cattle and October in buffalo. The high temperature, rainfall and humidity during these months may be predisposing factor of higher prevalence. Mostly the level of nematodes infection was low(< 800 EPG) and did not seriously impaired the buffalo and cattle productivity. Second experiment on assessing the comparative efficacy of anthelmintics (Levamisole, Oxafendazole and Ivermectin) against cattle and buffalo nematodes were conducted at Govt and private farms. The results showed that Ivermectin than Oxfendazole were found effective against cattle and buffalo nematodes. The higher (89-100%) reduction of EPG were recorded in cattle and 87 buffalo calves treated with Ivermectin followed by Oxfendazole (86-100%), Levmisole (88- 100%). Third experiment was conducted to determine the hematological values in healthy and nematodes infected animals. Different hematological parameters i.e., TEC, TLC, Hb estimation, were determined. The results showed that overall low Hemoglobin estimation and RBC were recorded in nematodes infected animals than healthy, while higher WBC were recorded in nematodes infected animals than healthy. The Lymphocytes and Neutrophil and Monocytes were higher in some nematodes and lower in other, while higher mean Eosinophil counts was recorded in all nematodes infected animals than healthy animals. Availability: Items available for loan: UVAS Library [Call number: 2730-T] (1). Place hold
Epidemiology And Controls Of Coccidiosis In Cattle

by Razia Sultana | Prof. Dr. Azhar Maqbool | Prof.Dr.MAnso | Prof.Dr.Zafar Iqbal Ch.

Material type: book Book; Format: print Publisher: 2009Dissertation note: Field study was conducted from September, 2007 to August, 2008 and a total of 2700 rectal faecal samples were collected from cattle farms of 3 categories i.e. Government Dairy Farm, Military Dairy Farm and Peri Urban Dairy Farms (Gawala Colonies) Lahore. Seventy five random samples were collected from each category of farms on monthly basis. The results of field study showed that overall prevalence of coccidiosis in cattle was 54.55%. Prevalence of coccidiosis in cattle at Military Dairy Farm Lahore was the highest (65.33%) during Autumn followed by summer (52.66%) then winter (47.66%) whereas the lowest (34.00%) during spring season. The highest (56.66%) prevalence was observed in animals between 6 & 12 month, whereas the lowest (46.33%) in animals under 6 months age. Prevalence of coccidiosis above 1 year of age was 50.66%. No coccidial oocysts was detected in calves less than 15 days old. In female animals prevalence was 51.22%.In the present study, the maximum oocyst per gram of feces (OPG) count was 65,000 whereas the minimum count was as 2000. The count was variable in different age groups and found to be decreasing in adult animals. The mean OPG in group A (under 6 month), group B (6 month to one year) and C (above one year) was 44000, 38000, and 22000, respectively. The four species of Eimeria were identified in all age groups i.e. E.bovis (29.28%) E.zuernii (26.03%) E. cylindrica (23.42%), E. ellipsoidalis (21.25%). The results of field study showed that prevalence of coccidiosis at Government Dairy Farm, Lahore was the highest during autumn (49.33%), followed by summer (44.33%), then winter (38.33%) where as the lowest during spring (30.33%). The highest (62.66%) month wise prevalence of coccidiosis was noted during August whereas the lowest (28.00%) during April. The highest ( 45.33%) prevalence of coccidiosis was observed in animals aged between 6 to 12 months, followed by 41.35% in animals under 6 months of age whereas the lowest (36.00%) above I year. Female animals were more frequently affected (41.28%) than males (39.50%).In the present study, the maximum OPG count observed was 55,000 and the minimum count as 2500. The counts were variable in different age groups and found to be decreasing in adult animals. The mean OPG of group A, B, C was 42,000, 35,000 and 20,000 . In the present study five species of Eimeria were E.bovis. E. zuernii E. cylindrica, E. subspherica, E. ellipsoidalis. The results of field study showed that prevalence of coccidiosis at Peri Urban Dairy Farms (Gawala colonies), Lahore was 71.55%. Month wise prevalence was the highest during August (90.66%) whereas the lowest (48%) during April. The seasonal prevalence indicated that it was the highest during autumn (84.00%), followed by summer (78.33 %), then winter (69.33%) whereas the lowest during spring (50.00%). The highest prevalence of coccidiosis (80.66%) was observed in animals under 6 months of age, whereas the lowest (62.33%) in animals above I year. Prevalence of coccidiosis in animals aged between 6months to 1 year was 71.66%. No coccidial oocysts were detected in calves less than 25 days old. Prevalence of coccidiosis was higher (74.61%) in females than in males (63.60%). In this study, the maximum OPG count observed was 65,000 and the minimum count as 2800. The counts were variable in different age groups and found to be decreasing in adult animals. The mean OPG of group A, B,C was 48,000, 38,000 and 23,000 respectively. Age wise analysis of Eimeria species showed that above mentioned five species were found in all age groups and most predominant species was E.bovis (26.39%) followed by E. zuernii (19.87%), E. cylindrica (23.60%), E.ellipsoidalis (18.63%), whereas the lowest prevalence of E.subspherica (11.49%)was noted (Table 16). The counts were variable in different age groups and found to be decreasing in adult animals. There was inverse correlation of OPG and the age of animals. The overall prevalence of coccidiosis was the highest during autumn (66.22%) followed by summer (59.66 %) then winter (51.77%) whereas the lowest in spring (38.22). The role of Meteorological data i.e. temperature, humidity and rain fall on the prevalence of disease was also studied. The bionomical showed that humidity and rain fall played a very important role in the causation and spread of disease and also help in the development of sporulated oocyst. Increased temperature showed higher prevalence of disease. The results of histopatholgical studies showed that there was an increase cellular infiltration of leukocytes, cellular debris in most of intestinal portion. Results of therapeutic trials by using toltrazuril, amprolium, sulphaquinoxaline, lasalocid are presented in table 17. The result of therapeutic trials showed that efficacy of toltrazuril was better than amprolium, sulphaquinoxaline and lasalocid. No clinical signs of disease were observed in treated animals while in diseased animals signs of disease were observed i.e. animals showed diarrhoea, loss of weight gain. From the results it was noted that efficacy of toltrazuril was better than other drugs . Statistically, there was no significant difference between efficacies of all four drugs. The efficacy of per oxygen based disinfectant was higher as compare to oocide while non- treated animals showed clinical signs of disease. Statistically, there was no significant difference between efficacies of both disinfectants Result of chemo prophylactic products are presented in table 19. It was noted that sonicated vaccine showed high antibody titer as compare to non- sonicated vaccine. Result of the challenge experiments revealed that the inactivated sonicated vaccines gave 100% protection to the challenge calves. Their faeces were normal and no clinical sign was recorded even 42 days post vaccination. Few remaining live oocysts were not able to produce the disease in calves. The weight gain of treated animals was higher as compare to non-treated animals. The FCR value in treated animals was better than non treated animals " Prevalence of coccidiosis was the highest during autumn followed by summer where as the lowest during spring. Farm wise prevalence of coccidiosis indicated that it was higher in Peri Urban Dairy Farms followed by Military Dairy farm where as the lowest at Government Dairy farm. " Prevalence of coccidiosis was higher in calves below 9 months of age than above 9 months. All the animals examined for coccidian were naturally infected with coccidiosis. These animals were not experimental calves and prevelance of infection was based on random selection of animals. Overall Prevalence of coccidiosis was slightly higher in females than male. Species wise prevalence indicated that Eimeria bovis is more pathogenic than other species. " Results of chemotherapeutic trials showed that among the four drugs used i.e. Toltrazuril, Amprolium, Sulfaquinoxaline and Lasalocid. Toltrazuril showed the highest efficacy followed by Amprolium, where as Lasalocid showed the lowest efficacy. No side effects of these drugs were noted when were given at their recommended dose rate and marked clinical improvement in animals was noted after treatment. " Two disinfectants were tried. Per oxygen based disinfectant showed better results than. Oocide disinfectant. " Histopathological studies showed inflammatory granulocytic infiltration of the mucosa and cellular debris in most of intestinal portions. There were necrosis of villi and degeneration of villi. Haemorrhages in mucosa and sub-mucosa were noted. Some of the glands in the sub-mucosa of intestine showed degeneration & necrosis. " Indirect Haemagglutination (IHA) antibody titer was higher in calves vaccinated with inactivated sonicated vaccines as compared to the calves vaccinated with inactivated sporulated vaccine. Results of the challenge experiments revealed that the inactivated sonicated vaccines gave protection to the challenge calves. Their faeces were normal and no clinical sign of disease were observed even 42 days post vaccination. " Weight in infected group was reduced. After treatment, high weight gain was reported in treated animals than control group. Recommendations: " Overcrowding should be avoided. " Provide good hygienic and managemental conditions in farms. " Proper drainage of rain. " Feeders and wateres should be above the level of the ground. " Regular use of coccidiostats is the need of the day. " Diseased animals particularly with diarrhoea should be separated from healthy animals. " Stocking density should be according to recommended of world Association of Parsitologists. " Contaminated faeces should be properly disposed off. " Grazing of animals during rainy season should be avoided. " Animals should be provided well balanced nutritive food. " Entry of visitors in the livestock farms should be restricted Availability: Items available for loan: UVAS Library [Call number: 1281,T] (1). Place hold
Epidemiology And Economic Losses Of Trichostrongylid Parasites In Sheep

by Sarwar Khan, M | Dr. Muhammad Athar Khan | Dr. Haji Ahmad | Dr. Khalid Pervaiz | Faculty of Veterinary Sciences.

Material type: book Book; Format: print Publisher: 1997Dissertation note: The meteorological data recorded during the study period from 1.1.96 to 31.12.96 showed the maximum temperature in June as 36.5°C and minimum temperature in December as 6.8°C. Maximum and minimum Humidity was recorded in the month of September and April as 85% and 55% respectively. The maximum rainfall during the year was recorded in the month of August as 660 mm. The faecal egg counts of sheep grazing on permanent pasture showed the minimum EPG during first week of January while maximum EPG on nid of September and first week of October. Pasture larval counts were performed on permanent pasture and experimental plot for the recovery of trichostrongylid larvae. The maximum number of larvae was recovered on 16th September, 1996, while minimum number was recovered in January and February from permanent pasture and experimental plot respectively. Two species of trichostrongylids were identified i.e. Haemonchus contortus and Trichostrongvlus colubriformis. The faecal and larval counts were very low in the months of January and February, the counts started rising in March. Peak counts were seen in the month of September. Decline in counts started in late October and reached to minimum in December. Mature and immature worm counts of slaughtered sheep were performed at 15 days interval. The, overall prevalence oftrichostrongylid parasites was 34%. The maximum number of mature parasites were seen during first week of October which was886 whereas maximum number of immature parasites including hypobiotic was 326 on 1st of December. During this study the average fecundity/female of contortus and L colubriformis parasites were calculated as 721 and 209 respectively. A spring rise in worm egg counts was experienced in mid of March. A pen parturient rise in the worm egg counts of pregnant and lactating ewes indicated the maximum counts during lambing week. An experimental group of sheep with mixed infection of trichostrongylid parasites showed the similar pattern of EPG counts as of naturally infected sheep. A study was performed to evaluate any protection provided by a particular Flaemoglobin type to trichostrongylid infection hut not difference could be observed. The Asparate Aminotransferase (AST) and total protein levels of infected sheep were decreased as a result of increase in the intensity of infection. A decrease in R.B.C. counts, Haemoglobin, Packed cell volume and lymphocyte counts was observed both in experimentally and naturally infected slaughtered sheep. However, an increase in total leukocytic count (TLC) alongwith an increase in the ratio of neutrophils, eosinophils and basophils was observed. At the end of experiment infected sheep gained 5.71 Kg/head less body weight and produced 4 3 grn less wool as compared with non-infected group. Based on epidemiological information the suggestions for control of the, trichostrongylid infection are submitted alongwi th recommendations for further studies. Availability: Items available for loan: UVAS Library [Call number: 0595,T] (1). Place hold
Epidemiology And Prophylaxis Of Babesiosis In Felidae

by Syed Saleem Ahmad | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr. Muhammad Arif Khan.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2011Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1425,T] (1). Place hold
Epidemiology Diagnosis And Chemotherpy Of Strangles In Equines

by Muhammad Ijaz | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr. Muhammad Arif Khan.

Material type: book Book; Format: print Publisher: 2010Dissertation note: Strangles is an infectious malady of equidae characterized by upper respiratory tract infection, dysponea, anorexia, regional suppurative lymphadenitis and causes high morbidity and low mortality. Considering the significance and utilization of equines in our country and the substantial losses rendered by Strangles, the present project was designed to study epidemiology, diagnosis and chemotherapy of strangles in Lahore and Sargodha districts of the Punjab province in Pakistan. The present study comprised of five phases. In phase-I, epidemiology of the disease including prevalence, variations in SeM, SzPSe and Se18.9 proteins and mortality rate were studied in Lahore and Sargodha districts. For epidemiology, nasal swabs and pus samples from the affected lymph nodes of 500 equines (nr=250 horses, rutz250 mules) suspected for strangles were collected and cultured for identification of S. equl. The collected samples were processed at Medicine and Microbiology Laboratories of the University of Veterinary and Animal Sciences, Lhore, Pakistan and Gluck equine research center, Department of Veterinary Science, University of Kentucky, USA. Out of 250 horses and 250 mules, 113(45.2%) horses and 99 (3 9.6%) mules tested positive for S. equi. on the basis of culture. Number of S. equl isolates were significantly higher (P<0.05) in pus samples taken from sub-mandibular lymph nodes as compared to nasal discharge samples. The difference was significant (P<0.05) among mules of different age groups. The highest prevalence of strangles was recorded in horses and mules less than 2 year of age as compared to those having age more than 2 years. In the present study, prevalence of strangles round the year in horses and mules were also calculated and it was found to be the highest during the months of February, March, April and May while few cases were seen during the months of January, June and July and no cases were observed during others months. The significant difference was observed (p<O.O5) among the prevalence levels of strangles in different months of the year. Similarly when compared the prevalence of strangles in different seasons of Pakistan i.e. summer, winter, spring and autumn. The highest prevalence rate was recorded during the spring season. The prevalence on the basis of Polymerase chain reaction (PCR) of S. equi in horses and mules was also recorded. Out of 250 horses and 250 mules tested, 122(48.8%) horses and 113(45.2%) mules were positive for S. equi. When compared the prevalence rate on the basis of PCR and culture of nasal and pus samples from affected submandibular lymph nodes it revealed that the sensitivity of Polymerase chain reaction appears to be much greater than culture. The culture along with PCR is the best diagnostic technique for S. equi as PCR test does not differentiate between dead and live bacteria, hence a positive test may not correlate with active infection; therefore, a positive culture may be necessary to confirm the diagnosis. In this phase of epidemiological study of disease, effect of selective pressure of allelic diversity in SeM of S. equi on immunoreactive proteins SzPSe and Se 18.9 was also studied. The aim of this study was to determine whether variations in SeM are accompanied by variations in the immunoreactive surface of exposed SzPSe and secreted Se18.9. Sequences of genes of 25 S. equi alleles isolated from different countries of the world over a period of 40 years were compared. Twenty different SeM alleles were identified including 6 not included in the data base (http:// Amino acid variation was also detected distal to the N- terminus of SeM. No variation was observed in SzPSe except for an Australian isolate which showed a deletion of one PEPK repeat. The Se 18.9 protein in all 25 isolates of S. equi did not exhibit any variation. Interestingly, only 2 SNP loci were detected in Se 18.9 compared to 93 and 49 in SeM and SzPSe respectively. The greater frequency of mutation in SzPSe compared to Se18.9 may be related to a high rate of recombination of SzPSe and the inclusion of exogenous DNA sequence based on the atypical GC percentage of its central hyper variable region. In horses the mortality rate was recorded as 1.64% whereas the mortality rate in mules having less than 5 years of age was found to be 0.88%. No significant difference (P>0.05) in mortality rate among horses and mules of different age groups affected with strangles was observed. In phase-I! of the present study, carrier status of the horses and mules were studied. Out of 122 horses found positive to PCR, 20 horses (10<2 years and 10 between 2 and 5 years of age) were selected and monitored for 12 weeks. Their nasal swab samples were used for identification of bacteria through culture and PCR on weekly basis. Till the end of 3rd week all horses <2 years of age remained positive but at the end of 4th to 7th weeks there remained positive only 5, 2, 1 and zero horses out of 10, respectively on the basis of culture whereas through PCR at the end of the 4th week all horse <2 years of age were found positive, but at the end of 5th to 10th weeks there remained 7, 5, 4, 2, 1 and zero horses out of 10, respectively. While all the horses aging between 2 to 5 year, were positive up to the 1St week but at the end of 2nd to 8th week out of 10 there were 9, 7, 6, 3, 1, 1 and zero horses respectively positive on the basis of culture but through PCR, all horses were positive till 4th week but at the end of 5th to 9th week number was reduced to 9, 7, 6, 3, 2 and zero. Similarly, out of 113 mules, 20 mules (10<2 year and 10 between 2 and 5 years of old) were also monitored for 12 weeks to study their carrier status. After the end of 2nd week all mules <2 years of age were positive but at the end of 3rd to 6th weeks there remained 7, 3, 1 and zero mules out of 10, respectively on the basis of culture but through PCR at the end of the 5th week all mules <2 years of age were positive, but at the end of 6th to 10th weeks there remained 9, 7, 3, 2 and zero mules out of 10, respectively. While in 2 and 5 year old mules, all were positive up to the 2nd week but at the end of 3rd to 7th weeks there were 6, 4, 2, 1, 1 and zero mules out of 10, respectively on the basis of culture but through PCR, all mules were positive up to 5th week but at the end of 6th to 10th weeks there were 8, 5, 2, 1 and zero. Horses and mules were declared free of infection on the basis of three consecutive negative samples through culture and PCR. From the result of present study, it may be concluded that sensitivity of Polymerase Chain Reaction appears to be much greater than culture for study of carrier status of equines. Moreover, recovered animals should be kept in quarantine period at least upto 9th week because the recovered horses and mules remain carrier for prolonged period of time and can act as source of infection for susceptible animals through periodic shedding of S equi. (comprising 10 horses and 10 mules) for in-vivo trials. Efficacy of the antibiotics was assessed weekly on the basis of negative nasal swab culture. Results of in-vitro antibiotic sensitivity revealed that in horses and mules, S equi was most sensitive to Procaine penicillin followed by ceftiofur Na, cephradine, erythromycin, ampicillin, tetracycline, chloramphenicol, sulfamethoxazole, trimethoprim + sulfdiazine and gentamycin whereas the result of in-vivo antibiotic trials revealed that horses and mules suffered from strangles without abscess formation were most sensitive to Procaine penicillin followed by ceftiofur Na, cephradine and erythromycin whereas animals which developed abscess showed no response. It is concluded from the result of present study that Procaine penicillin is most effective in-vitro and in-vivo antibiotic followed by ceftiofur Na and cephradine. These antibiotics might be used for the treatment of strangles infection. Phase-V, comprised over in-vitro trials of disinfectants. Efficacy of disinfectants, like povidone iodine, 0.6% H2S04, dettol and bleach was assessed. Phenol Co-efficient Test was applied, to ascertain efficacy of these disinfectants, used in, in-vitro trials. Among four disinfectants, povidone iodine was found to be the best one with a phenol coefficient of 1.25 that is greater than phenol i.e. 1.00 while 0.6% H2S04 showed similar phenol coefficient as that of phenol. The phenol coefficient of dettol and bleach were observed as 0.5 and 0.75 respectively. Therefore it is recommended that S. equi is highly sensitive to povidone iodine and 0.6% H2S04. Availability: Items available for loan: UVAS Library [Call number: 1211,T] (1). Place hold
Epidemiology Of Bovine Tuberculosis And Its Public Health Significance In Peshawar

by Irfan Khatak (2011-VA-562) | Dr. Muhammad Hassan Mushtaq | Prof. Dr. Umer Sadique | Prof. Dr. Mansur-ud-Din Ahmad | Prof. Dr. Muhammad Sarwar Khan.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: A cross-sectional study was carried out to determine the prevalence of bovine tuberculosis (bTB) and associated risk factors in cattle and buffalo in Peshawar, Pakistan. Cattle and buffalo, randomly selected from all four towns of District Peshawar were screened for bovine tuberculosis using comparative cervical intradermal tuberculin test (CCIT). For obtaining data on risk factors, socio-demographic condition, animal characteristics and management, interviewer administered pretested questionnaire to animal owners. Multivariable logistic regression models were used to measure association between risk factors and comparative cervical intradermal tuberculin reactors. A total of 556 cattle and buffalo were screened for bovine tuberculosis. Out of 556 animals screened, 5.75% (3.9-8.0%) were found positive. The prevalence was higher in old animals (P= 0.001) as compared to younger animals. Prevalence also varied with source of animal (either raised on farm or purchased), stay of animals at night (indoor or outdoor) and herd size. Farmer’s knowledge about transmission of TB from animals to human as well as signs and symptoms of TB was extremely low. Only 3.6% farmers correctly stated the combination of three major symptoms of TB. Results of the study call for immediate intervention to control bTB in animals as well as its transmission to human population. Furthermore, it is suggested to emphasize on local epidemiology of bTB and husbandry practices of cattle and buffalo during the control program. To assess the presence of Mycobacterium bovis (M. bovis) in milk sold at retail shops and find the knowledge, attitude and practice (KAP) about tuberculosis (TB) in the high risk M. bovis contaminated milk consumers, milk samples were obtained from 92 milk shops and analysed for presence of M. bovis. Data on socio-demographic characteristics and KAP about TB was Summary 152 obtained from 800 M. bovis contaminated milk consumers. Mycobacterium bovis was detected in 8.7% (8/92) milk samples. Although 97.4% of the participants had heard of TB but only 39.6% knew that cough lasts for more than 3 weeks was one symptom. Only 79.2% have awareness that TB can be prevented and the most frequently stated (48.4%) method of TB prevention was good nutrition. Participants believed that TB can be cured by prayers/ eating well (41.8%) and also by herbal cures/ consulting Hakeem (35.7%). Mean knowledge score for the participants was 12.1± 2.47 out of maximum 22. Mean knowledge score varied significantly with ethnicity, level of education and residential status (Urban vs rural). Overall knowledge about TB was low. Therefore community’s health education focused on increasing knowledge of TB must be initiated. This part of study was conducted to determine the occurrence of active pulmonary tuberculosis due to M. bovis in abattoir workers, butchers, livestock farmers and veterinarians and to document the Knowledge and practices of these professional regarding bTB. The cross sectional study included 141 abattoir workers, 317 butchers, 50 livestock farmers, 5 veterinary doctors and 3 veterinary assistants. Sputum samples were collected from those respondents who had chronic cough that last for more than 2 weeks. Four out of 16 suspected abattoir workers and 1 out of 50 livestock farmers were found positive for M. bovis by Polymerase chain reaction analysis. Duration of work as abattoir worker was found significantly associated (p<0.05) with occurrence of zoonotic TB. The knowledge of abattoir workers, butchers, livestock farmers and veterinary assistants regarding transmission of bTB from animal to human and symptoms of TB in human was very low. Most of these professional did not use protective material/ techniques and are considered at high risk of acquiring zoonotic tuberculosis. This study declares zoonotic tuberculosis a critical public health issue especially for professionally exposed groups in Summary 153 Peshawar, Pakistan and warrant immediate intervention for control of bovine and zoonotic tuberculosis. The last part of study aims to determine the proportion of zoonotic TB cases out of overall human TB patients and school children, drug resistance of M. bovis isolates and knowledge, attitude and practices about TB. Total 300 human TB patients and 100 school children were included in the study. Sputum samples were processed by PCR for presence of Mycobacterium tuberculosis and M. bovis. Sputum samples from TB patients were cultured and M. bovis isolates were subjected to drug susceptibility testing. Data on knowledge, attitude and practices were obtained from TB patients by administering pre-tested questionnaire. Among TB patietns 4% (12/300) were infected with M. bovis. None of the school children was positive for M. bovis. Residence, occupation, presence of animals at home and sleeping in shed at night was found significantly associated with occurrence of zoonotic TB. Except one all M. bovis isolates were resistant to Pyrazinamide. Among other drugs resistance to streptomycin and isoniazid was high. Low level of knowledge and practices were observed. The study concluded that considering zoonotic aspect of TB during diagnosis and treatment of TB is necessary and recommends national survey for true estimation of burden of zoonotic TB in Pakistan. Availability: Items available for loan: UVAS Library [Call number: 2540-T] (1). Place hold
Epidemiology Of Diarrheal Diseases Of Bovine Calves In Punjab

by Jawaria Ali Khan | Prof.Dr.Muhammad Sarwar Khan | Prof.Dr.Azhar | Prof.Dr.Muhammad Arif Khan.

Material type: book Book; Format: print Publisher: 2010Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1254,T] (1). Place hold
Epidemiology Of Giardia Duodenalis And Cryptosporidium Parvum Infections In Calves And Young Dogs

by Khalid Saeed | Dr. William P. Shulaw, Advisor | Dr. Margaret A. Masterson | Dr. Thomas E.

Material type: book Book; Format: print Publisher: 1998Dissertation note: In recent years Giardia duodenalis and Cryptosporidium parvum have been considered by some investigators to be important causes of diarrhea. The role of G. duodenalis as an enteropathogen in animals remains undetermined. Limited information is available concerning the effect of age and season on G. duodenalis and C. parvuni infection in calves. A year long prospective longitudinal study was conducted to determine the effect of age and a cross sectional study was conducted to determine the effect of season on infection rates and shedding intensity. Associations between Giardia and Cryptosporidium infections and abnormal stools were also determined. A separate case control study was conducted to investigate the association between Giardia, and Cryptosporidium infections and diarrhea in young dogs admitted to two animal shelters. Giardia and Cryptosporidium cysts/oocysts were frequently identified in fecal samples from calves. Giardia cysts and Cryptosporidium oocysts were found in 54% and 24% of samples respectively from 1 day to 387 day-old calves. About 80% of individual calves had at least one positive sample for Giardia and Cryptosporidium infections. Age was a significant factor in determining Giardia and Cryptosporidium infections and cyst/oocyst shedding levels (P< 0.01). The highest proportion of Cryptosporidium-positive samples was from 2 week-old calves. Giardia cysts were most frequently identified in samples from 8 week-old calves and about 80% of samples had cysts. Giardia cysts were less frequently found in samples collected in winter than in other seasons (P <0.01). Detection of Cryptosporidium oocysts was not influenced by season. Among infected calves, Cryptosporidium oocyst shedding levels were higher in winter than in other seasons. Giardia cysts were more frequently found in normal stools than in abnormal su)ols (P 0.01). Lrvptosporu.tiiein oocysts were more frequently identified in abnormal stools than in normal stools (0R3.5; P <0.001) and among infected calves higher oocyst shedding levels were observed in abnormal stools than in normal stools (P <0.01). No association between Giardia cyst and Cryptosporidiuni oocyst shedding levels and diarrhea was observed in the young dogs studied. Giardia infections were more common in females than in male dogs (P- 0.03). Gender was not associated with i3pru,,poriduun infections (Pr- 0.32). but higher mean oocyst shedding was observed in males than in females (P < 0.01 ). Mean body condition scores of cases was slightly lower than that of control dogs (P= 0.04). Availability: Items available for loan: UVAS Library [Call number: 0945,T] (1). Place hold
Epidemiology Of Influenza Virus H5n1 In Islamabad Capital Territory

by Zahida Fatima (2005-VA-246) | Prof. Dr. Muhammad Athar Khan | Dr. Khalid Naeem | Prof. Dr. Mansur Ud Din Ahmad | Prof. Dr. Khushi Muhammad.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: The poultry sector in Pakistan is the second largest industry that contributes to the national gross domestic products (GDP) and remains a major source of nutrition (protein and energy) for human population in Pakistan. Highly Pathogenic Avian Influenza (HPAI) outbreaks due to H5N1 virus in poultry have been recorded in over 62 countries, indicating the contagious nature of the disease and its potential to infect various avian species. These HPAI outbreaks in poultry have lead to killing/culling of around 120 million birds in various countries. During 2009, the Avian Influenza continues to occur in poultry in China, Hong Kong, India, Egypt, Nepal, Bangladesh and Canada . In Pakistan, an HPAI outbreak due to H7N3 virus was first observed in 1994-95 and those due to H9N2 virus in broiler and layer chickens were recorded between late 1990’s and early 2000. During the period between 2006 and 2008, poultry heavily suffered due to multiple outbreaks caused by H5N1 virus. The country experienced several and severe HPAI subtype H5N1 outbreaks during 2006-2008 in commercial poultry farms mostly, causing mass economic losses. In Pakistan all the four poultry production system exists being identified by FAO. The present study was conducted in peri-urban areas of ICT Islamabad, capital of Pakistan. The objectives of the present study were to investigate the outbreaks due to HPAIV H5N1 in 2006-2007 in ICT and identify the pattern and trends of these outbreaks. For this purpose descriptive epidemiological study was conducted and data was collected on a predesigned questionnaire regarding farm demography, culling, morbidity and mortality. The result statistical analysis showed a significantly (P< 0.05) higher morbidity, mortality, case fatality and culling rate in layers farms than breeders and broilers respectively. Layers and breeders of old ages were mostly affected with having higher mortality and culling in comparison to younger age layer and breeder commercial farms. The mean morbidity and mortality rates ranged 57–95% and 5-43% correspondingly. After the HPAIV H5N1 first reported outbreak in Pakistan in 2006 culling strategy was adopted after devastating outbreaks regularly reported from throughout the country. The reasons behind these emerging epidemics were unknown and several hypotheses were given birth after these outbreaks. Knowledge regarding potential risk factors responsible for HPAIV H5N1 epidemics in commercial poultry farms in Pakistan was lacking. Therefore we conducted a longitudinal cross sectional survey (1:1 matched case control study) to identify potential risk factors at farm level responsible for 2006-2007 HPAIV H5N1 infection in poultry in ICT. Information on farm characteristics, biosecurity practices and farm management were collected. Logistic regression model on data was used to unveil the potentially associated risk factors with cases (farms confirmed HPAI H5N1 Positive). Several candidate variables were studied and investigated for association. The results multivariable logistic regression showed that farm location such as in urban area (P<0.05: OR=18.50), wild birds entry (P<0.05: OR= 12.66) and farms situated in highly dense poultry populated area (P<0.05:OR=4.50) were found significantly associated with outbreaks of HPAIV H5N1 infection in commercial poultry farms during 2006-2007 epidemics in the study area. Live bird markets (LBMs) are essential for poultry marketing in developing countries like Pakistan. One year active disease surveillance for influenza viruses in avian species in LBMs in ICT area was conducted in 2011. LBMs in Pakistan are typically urban that brings together many avian species produced by different suppliers. Which make LBMs in Pakistan a potential source of HPAIV viruses as well as other emerging poultry pathogens i.e. new castle disease virus,infectious bronchitis etc. The results of the present surveillance data showed that seroconversion against H5N1 and H9N2 is present in LBMs bird species which were isolated from different samples like serum, cloacal, nasal samples and organ samples.This indicates the continuous threat of AIV viruses circulating in the live bird markets set up of Pakistan. Findings of these studies will help to tailor control and prevention measure against devastating outbreaks in future regarding the local circumstances of commercial poultry farms as well as in LBMs. These studies also succeeded to unveil the true reasons behind these devastating outbreaks and their higher impact on poultry industry. Such type of surveillance programs will be useful in future to investigate several emerging diseases and outbreaks in Pakistan and other developing countries. Availability: Items available for loan: UVAS Library [Call number: 2700-T] (1). Place hold
Epidemiology Seriodiagnosis And Chemoprophylaxis Of Theileriosis In Cattle

by Aneela Zameer Durrani | Prof.Dr.Muhammad Sarwar Khan | Prof.Dr.Abdul Rauf Shakoori | Prof.Dr.Kahlid | Faculty of Veterinary Sciences.

Material type: book Book; Format: print Publisher: 2008Dissertation note: The field study was carried out in indigenous and cross bred cattle in three districts of Punjab namely, Lahore, Multan and Rawalpindi during the year from September 2006 to August 2007. A total of 1200 cattle were selected as reference population comprising of 600 Sahiwal and 600 Cross bred animals. 300 blood samples were collected during each season by taking 100 samples from each district. The results of field study on the basis of PCR showed that prevalence of Tannulata during summer was highest 46.7% in both breeds of cattle while lowest prevalence was recorded in winter, 4.6 % and autumn season 4.3% . The breed wise prevalence of Tannulata was lower, 11.5 % in sahiwal cattle compared with 20.2 % in cross bred cattle. The mortality rate of 2.8% was noticed only in cross bred cattle with highest mortality recorded in district Rawalpindi ,64.7% and lowest in district Multan,29.4% .The positive percentage of Tannulata was higher,61.5%(234/380) in females as compared to males ,38.4% (146/3 80) of both breeds. The positive percentage in much animals was highest, 32.4 %( 123/380) in both breeds while lowest was recorded in heifers, 11.1 %( 42/3 80). In males of both breeds 26.3% (100/3 80) positive percentage was seen in adults above 1 year of age while lower, 12.1% (46/3 80) was recorded in young animals up to 1 year of age. The prevalence of Tannulata was highest,l2.2% in district Lahore in both breeds while lowest prevalence, 9.33% was seen in district Rawalpindi. The efficacy of PCR test was highest ,31.6% followed by microscopic lymph node smear examination,8.25% and microscopic blood smear examination,6% in diagnosis of field challenges of Theileria. During the present study mixed infection with Babesia bigemina, 158%, was recorded in reference population. TLc breed wise prevalence of Babesia bigen'iina was higher in cross bred animals 33.33 % compared to 17 % in sahiwal cattle respectively along with 6% prevalence of the ileria specie on blood smear examination. The overall economic losses of 3.39 million were calculated during the present study in three districts under study. The stocking pattern was highest (47%) for herd size of 1-2 animals while lowest herd size (12%) of 5-6 and above 6 was recorded. The survey of ectoparasites showed the highest prevalence of ticks,66.7% recorded in district Lahore while prevalence of lice was highest,36.3% in district Rawalpindi and prevalence of mange mites was highest ,4% in district Multan. The highest prevalence of Hyalomma 12.0%, followed by Boophilus 8.1% Haemaphysalis 5%.and Rhipicephalus 3.1% were recorded. During the present study the species of Hyalomma identified were Hyalomma a. anatolicurn (65.2%) and Hyalomma n-zarginatum marginaturn (34.8%).The examination of salivary glands revealed that Hyalomma a. anatolicum (87%) and Hyalomma marginatum inarginatum (20.8%) were infected with T. annulata sporozoites. It was observed that the population of ticks was heaviest in the month of June, mid September to mid October with lowest infestation during the month of November. No ticks were noticed on animals from December to February. The taxonomical study of Hylomma species showed the difference between both sexes and in different developmental stages. The two species of Hyalomnia in the present study were differentiated on the basis of structural features in adults. The pre-oviposition & oviposition periods recorded during spring were longest i.e 9 days and 12 days respectively. The incubation period of the ova of Hyalomma in summer and autumn was longest i.e 20 days. Mean survival period of unfed larva of Hyalomma was recorded as 56 days while for nymph it was 65 days. Larval and nymph engorgement period was longest in spring i.e. 9 days and 7days respectively while for adult the mena engorgement period in spring was longest i.e 9 days .The larval and nymph moulting period was longest in spring i.e 16 days and 17 days respectively . Amount of blood sucked in mg by first instar of Hyalomma ranged from 0.132 -0.126mg while for second instar it ranged from 140-79mg and for third instar it was 237-180 mg. The eggs were oblong in shape and measured 0.470 X 0.420 mm in size with weight of 0.041 rng on an average. It was observed that the maximum number of eggs laid by a single female tick in spring varied from 3720 to 3918, in summer from 2611 to 2961 and in autumn from 2423 to 2606. The bionomical study showed effect of varying temperature and humidity on the development of different stages of Hyalomma tick. The effect of constant temperature (30°C) and varying humidity showed mean pre-oviposition period of mid October with lowest infestation during the month of November. No ticks were noticed on animals from December to February. The taxonomical study of Hylomma species showed the difference between both sexes and in different developmental stages. The two species of Hyalomnia in the present study were differentiated on the basis of structural features in adults. The pre-oviposition & oviposition periods recorded during spring were longest i.e 9 days and 12 days respectively. The incubation period of the ova of Hyalomma in summer and autumn was longest i.e 20 days. Mean survival period of unfed larva of Hyalomma was recorded as 56 days while for nymph it was 65 days. Larval and nymph engorgement period was longest in spring i.e. 9 days and 7days respectively while for adult the mena engorgement period in spring was longest i.e 9 days .The larval and nymph moulting period was longest in spring i.e 16 days and 17 days respectively . Amount of blood sucked in mg by first instar of Hyalomma ranged from 0.132 -0.126mg while for second instar it ranged from 140-79mg and for third instar it was 237-180 mg. The eggs were oblong in shape and measured 0.470 X 0.420 mm in size with weight of 0.041 rng on an average. It was observed that the maximum number of eggs laid by a single female tick in spring varied from 3720 to 3918, in summer from 2611 to 2961 and in autumn from 2423 to 2606. The bionomical study showed effect of varying temperature and humidity on the development of different stages of Hyalomma tick. The effect of constant temperature (30°C) and varying humidity showed mean pre-oviposition period of that the values of TEC, TLC, and PCV and hemoglobin decreased considerably. Comparison of normal average with affected average values increased in Cross bred cattle while for Sahiwal cattle the values increased for lymphocytes and decreased for neutrophils, eosinophils, monocytes and basophils. The experimental study showed highest preyalence of disease in adult animals as compared to young animals by all diagnostic tests. The prevalence of disease in young animals at 12 months of age was highest (85.7% by MLE,71 .4% by MBE,85.7% by IFA & PCR in Sahiwal while 71.4% by MLE & MBE, 89% by IFA, 100% by PCR in cross bred animals. ) while lowest percentage of disease was seen at 3 months of age by all tests.The highest specificity and sensitivity ,96% and 75% respectively for PCR test was recorded while for MBE lowest specificity and sensitivity ,76% and 44% respectively were calculated. PCR analysis of the samples with 6u1 of MgCl2 gave successful results . It was found out that primers set A anneal at Tm 55 °C while Primer set B anneal at 60°C. The expected 721-bp fragment was generated from T. annulata DNA with primer set N5 1 6/N5 17721 -bp liagment with 0.00040% parasitemia, corresponding to 19 parasites per ml while primers 989 and 990 amplified the expected 1098 bp fragment of DNA. All animals that were positive by microscopic examination were also positive by IFA as well as PCR. The therapeutic trials showed efficacy of buparvaquone @ J/M 2.5 mg /kg body weight and Calotropisprocera @ 0.3mg! Kg dose orally.8 doses on alternate days was 60% and 100% respectively. After completion of treatment with Cal otropis procera no tick infestation was seen while ticks were present on the body of that the values of TEC, TLC, and PCV and hemoglobin decreased considerably. Comparison of normal average with affected average values increased in Cross bred cattle while for Sahiwal cattle the values increased for lymphocytes and decreased for neutrophils, eosinophils, monocytes and basophils. The experimental study showed highest preyalence of disease in adult animals as compared to young animals by all diagnostic tests. The prevalence of disease in young animals at 12 months of age was highest (85.7% by MLE,71 .4% by MBE,85.7% by IFA & PCR in Sahiwal while 71.4% by MLE & MBE, 89% by IFA, 100% by PCR in cross bred animals. ) while lowest percentage of disease was seen at 3 months of age by all tests.The highest specificity and sensitivity ,96% and 75% respectively for PCR test was recorded while for MBE lowest specificity and sensitivity ,76% and 44% respectively were calculated. PCR analysis of the samples with 6u1 of MgCl2 gave successful results . It was found out that primers set A anneal at Tm 55 °C while Primer set B anneal at 60°C. The expected 721-bp fragment was generated from T. annulata DNA with primer set N5 1 6/N5 17721 -bp liagment with 0.00040% parasitemia, corresponding to 19 parasites per ml while primers 989 and 990 amplified the expected 1098 bp fragment of DNA. All animals that were positive by microscopic examination were also positive by IFA as well as PCR. The therapeutic trials showed efficacy of buparvaquone @ J/M 2.5 mg /kg body weight and Calotropisprocera @ 0.3mg! Kg dose orally.8 doses on alternate days was 60% and 100% respectively. After completion of treatment with Cal otropis procera no tick infestation was seen while ticks were present on the body of animals treated with buparvaquone. With herbal treatment the animals showed diarrhoea for first 10-12 hours after administration of every dose on alternate days but animals recovered spontaneously without any antidiarrhoeal treatment. The results of CBC showed the characteristic macrocytic hypochrornic anemia in theileriosis was recovered by Calotropis procera treatment. The of result of LFT's and kidney function tests post treatment with Calotropis procera showed no toxicity of drug. In group C the characteristic signs of disease were noticed. The results of prophylactive trials with both drugs showed delay of 23 days in the onset of clinical disease with buparvaquone while clinical disease was not seen in second group that was prophylactively treated with Calitropis procera. The in vitro trials with both drugs to check the acaricidal activity supported trials with Calitropis procera as having acaricidal within 3 hours while no such effect was noticed with bupasrvaquone in vitro trials. Availability: Items available for loan: UVAS Library [Call number: 1033,T] (1). Place hold
Epidemiology Zoonotic Potential Haematology Amd Chemotherapy Of Sarcoptic Mange In Camel In Punjab

by Muhammad Irfan Zahid (2011-VA-800 | Prof. Dr. Azhar Maqbool | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr.Shazia Anjum | Prof. Dr. Kamran Ashraf.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2015Dissertation note: A camel is a very hardy ruminant animal, which can survive under harsh climatic conditions very effectively by utilizing the marginal areas with excellent capabilities and produce under such conditions (Hjort and Hussein, 1986; Abbas and Tilley, 1990). Camel is an important animal as it is well adopted in unique manners in the hot, arid and semi-arid environments (Schwartz, 1992). It can survive without water and food for many days and this unique ability of camel makes it an ideal for such harsh conditions for which it is also commonly known as “The Desert Ship”. In spite of the fact that camel is an important member of a group of animals which produces food for human consumption in the shape of milk and meat, yet it is the most neglected one in the field of scientific research. It may be due to the fact that camel belongs to such areas of the world which are arid, semi-arid or rain fed in nature, having harsh climatic conditions, where poor nutrition and poor management are the major issues (Sohail, 1983). It is an established fact that diseases originating from parasites lead to the main health hazard issues in animals. These parasites survive at the expense of the host animals causing lot of health problems, like skin irritation, anemia leading to weakness and debility. Some of the parasites have zoonotic importance and may become a source for the transfer of many contagious diseases like scabies to the human beings (Dominguez et al. 1978). McClain et al. 2009, observed the scabies as a major health problem globally both for humans and animal population. Sarcoptes scabiei is an ectoparasite which is a cause of scabies, a skin problem in the human beings worldwide and the similar species of mites do also produce a similar type of disease in a large variety of wild and domesticated mammals (Pence and Ueckermann, 2002; Fitzgerald et al. 2004). Fain, 1978, reported that more than fifteen (15) different species of Sarcoptes scabiei morphologically and genetically distinct from each other have been identified in different hosts. Introduction 2 Sarcoptic mange is the second important problematic disease of camel after Trypanosomiasis (Nayel and Abu-Samra, 1986). Scabies caused by Sarcoptes scabiei var cameli is a serious & highly contagious skin problem and also economically important disease of the camels (Pegram and Higgins, 1992). Camels, which are reared with deficient nutrition, poor management and under unhygienic conditions are mostly affected by this disease (Kumar et al. 1992). A large group of people and communities living in arid diverse ecozones in the entire world, particularly in harsh climates earns their livelihoods by depending on camels. This dependence may spread to the utilization of camel milk, meat, wool and leather besides its use in transportation, riding and sports (Wilson, 1984; Snow et al. 1992). In Pakistan camels are also raised by the people for meat, milk, riding, transportation and sports purposes in the deserts, semi desert & rain-fed / warm areas of the entire country being a hardy animal as it can tolerate easily the rugged climate as well as extremes of temperatures of such areas. The natural harsh and adverse climatic conditions, particularly during long dry seasons lead to a paucity of feeding regimes resultantly the camels raised in such areas are subjected to stress conditions which lower their resistance and make them easily vulnerable to diseases (Abbas et al. 1993; Agab, 1993). Abbas & Tilley, 1990; Saint-Martin et al. 1992; Abbas and Agab, 2002; Pathak and Chhabra, 2010; while reviewing the parasites & parasitic diseases of camel population in India were of the opinion that Sarcoptic mange is a serious, debilitating, dreaded and widely prevalent disease of camels in India. Besides other infectious diseases of bacterial and viral origin, camels are exposed to a wide range of internal & external parasitic infestations. Amongst other so many external parasites to which camels are exposed, the Sarcoptic mange is recognized to be one of the most Introduction 3 serious and damaging disease. This disease is caused by a mite known as Sarcoptes scabiei var cameli which belongs to genus Camelus of SARCOPTIDAE family in Veterinary Entomology. It is an extremely pruritic, contagious and debilitating skin disease which is very frequently and sudden in onset. It is also ranked as one of the most serious and important disease of the camels. Sarcoptic mange infestation is very common in the areas of thin skin, the head, neck, flanks, medial aspect of thighs or inguinal region, mammary glands and prepuce. The head is usually affected very rapidly as the animal uses its teeth for scratching the affected areas. Besides linking the occurrence of the disease with poor camel management, malnutrition and contact with infected objects, the stray & infected camels also often become a focus of infecting the healthy animals when mingling with them particularly at watering places for drinking purpose (Richard, 1987; Abdel-Rehman et al. 2001). Sarcoptes is a burrowing mite as it penetrates deeply through the skin surface of the infected camel. This burrowing of mites in the skin helps these parasites lead to intense pruritus and exudative dermatitis. In pruritus, mites penetrate deep into muscular areas, damaging the flesh and lowering the quality of meat. The early inflammatory reaction of the host body towards the mites becomes evident in the shape of small popular elevations, invasion and injuries leading to formation of hairless areas, scaly crust formation or scabs on the affected parts and the skin become dark and thickened. Skin of mangy camel show hemorrhages, and subcutaneous odema after the development of fissures in the underlying epidermis (Kumar et al. 1992; Amer et al. 2006). The fertilized female mites create winding burrows or tunnels in the upper layers of the epidermis of the skin of the host animal and feeding on the serous exudate, a liquid oozing from the damaged tissues. The female mites lay about 40-50 fertilized eggs in these tunnels which Introduction 4 hatch in 3-5 days into a six legged larvae. These larvae immediately crawl to the surface and burrow themselves in the superficial layers of the skin and create small molting pockets. In these molting pockets, the larvae molt to next stages of nymph and adult. The adult male then emerges and seeks a female either in the molting pocket or on the surface of skin. After fertilization the female produces new tunnels, either de novo or, by extension, of the molting pockets, lays eggs in these tunnels and a new life cycle starts. The entire life cycle of Sarcoptic mange is completed in 17-21 days. New hosts can be infected through direct transmission by contact between the animals, presumably from larvae, nymph or adult mites, which are commonly present on the skin surface of the infected animal. Indirect transmission of infestation can also take place through the objects or fomites having mange infection, which come into contact with the affected camel, such as harnesses, blankets, baggage tack, tents and tree trunks (Richards, 1987). The pruritus increases as the mites penetrate deeper in the skin (Al-Rawashdeh et al. 2000, Driot et al. 2011, Bekele et al. 2012). Based on the rate of infection camels can be seriously disturbed by the Sarcoptic infestation as they may stop grazing which can lead to a rapid fall in milk production, and deterioration of health condition. With the increase in the irritation due to scabies, the camel rubs, bites and scratches the affected areas in an attempt to reduce the itchiness. Due to rubbing, biting or scratching, the mites move to the periphery affecting the healthy tissues and resultantly affected area spreads. As the disease prolongs, the skin becomes excoriated, leading to hair loss and the development of scabs. These scabs in turn may be rubbed away and a red surface developed. The animal becomes restless due to severe Sarcoptic mange infestation and involvement of most of the body surface. If the diseased animal is not treated in time, the animal loses its health condition, become emaciated and within two, three weeks the acute stage of Introduction 5 disease may give way to more chronic state (Gorakh et al. 2000, Abubakar et al. 2002, Driot et al. 2011). Sarcoptic mites rarely survive long off the host under natural conditions. A continuous direct contact of animal keepers with their camels can also lead to transmission of diseased condition in human beings which is termed as pseudo scabies. Transmission of infection from camel to man usually takes place during milking, handling or riding. The main symptoms of pseudo scabies can therefore be seen in the inter digital spaces of the hands, on the wrists, forearms, the elbows, the axillary folds and inner side of the thighs. Once a herd is infected with Sarcoptic mange, continuous reinfection of the disease occurs (Schillinger 1987, Singh & Veer 2005, Premalatha et al. 2010). Sarcoptic mange is usually considered to be a seasonal disease and is often reported severe during the winter months as in cold weather the disease had an acute course. However, there is some evidence that in some countries hot weather predisposes to acute outbreaks of camel mange and in the cooler, winter season the rate of mange infestations are at the lowest. In the summer the activity of the mite seems to decline or disease becomes chronic. Dietary intake is an important factor in mange infestation. Nomadic camels on a low nutrition plan, probably carrying heavy worm burdens in hot desert conditions are likely, therefore, to be highly prone to Sarcoptes at this time (Dinka et al, 2010). During such periods of great activity, the mites are readily transmissible from one animal to other animals (Richards, 1987, Banaja & Ghandour, 1994, Tefera & Gebreah, 2001). Mange can easily be diagnosed clinically from the occurrence of pruritus, depilation, alopecia, thickened skin, folds around the joints and encrusted plaques being the main characteristics of this parasitosis. In order to control this zoonotic disease, it is essential to treat Introduction 6 both camel and man along with effective checks over other predisposing factors of the disease such as hygiene and nutritional requirements of the animals. The skin diseases like the scabies both in human beings and animals are being treated with a variety of allopathic drugs now a day, but the role of herbal plants in use since centuries in different shapes cannot be ignored at all, especially in the rural lifestyle. Further with the continuous use of different acaricidal drugs, the issue of resistance development has come across as a challenge for the researchers to find some alternatives for the purpose. Accordingly the research work on the use of traditional herbal medicines is gaining attention day by day. Although there are many reports and studies regarding the prevalence of Sarcoptic mange in camel from different parts of the world, only few preliminary reports are available for Pakistan and none of them provide detailed epidemiology of Sarcoptic mange and its effect on host health. Therefore, keeping in view the importance of the mange problem in camel population of the country, the present project was designed to determine the prevalence of Sarcoptic mange infestation, factors in its occurrence its zoonotic importance, effect on blood physiology and different treatment options in the camel population of Punjab, province in Pakistan. Availability: Items available for loan: UVAS Library [Call number: 2190,T] (1). Place hold
Epidemiology Zoonotic Potential Haematology And Control Of Amoebiasis In Dogs And Humans

by Muhammad Azhar Alam | Prof. Dr. Azhar Maqbool | Dr. Muhammad Lateef | Prof. Dr.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2130,T] (1). Place hold
Epidemiology, Molecular Diagnosis And Chemotherapy Of Giardiasis In Bovine

by Sultan Ayaz | Prf.Dr. Azhar Maqbool | Prof. Dr. Zafar Iqbal Chaudhary | Faculty of Veterinary Sciences.

Material type: book Book; Format: print Publisher: 2009Dissertation note: Giardia is a protozoan parasite of the small intestine that causes extensive morbidity worldwide. Dairy calves can excrete high numbers of the cysts of Giardia and the disease in cattle is clinically important and can reduce the growth performance of the ruminants. Giardia is the cause of non-viral diarrhoea in humans and is responsible for epidemics in the developed and developing countries. The cyst is the infectious form, is ingested in contaminated water or food or directly from faecal-oral contact. Giardia duodenal is the only species, which is found in both humans and animals including dogs, cats, bovines, pigs, sheep and equine. The present study was conducted to determine the prevalence in bovines at Military dairy farm, Gawala dairy colonies, the Government dairy farm and Household dairies in Lahore. The effect of season, sex, and age on infection rate and shedding of the cysts were also noted, and association of the Giardia infection with normal and abnormal stools was also studied. Overall 2160 bovine faecal samples (720 buffaloes, 720 cattle and 720 calves) were examined during the study period from August 2007 to July 2008, amongst calves 362/720 (50.27%) were found to be positive. The highest prevalence was recorded in the Government. Dairy farm (68.33%) followed by Gawala colonies (55%), then the Military dairy farm (44.33%) and the lowest (34.44%) was recorded in Household dairies. Overall, highest (61.6%) seasonal prevalence was recorded during autumn, followed by spring (60.83%), then summer (53.4%) and the lowest (34.1%) was recorded during winter. The highest (65%) prevalence was reported during August and the lowest (3 0%) during December. Females were found to be more susceptible (56.74%) than males (35.1%). The prevalence was significantly higher (71.52%) in younger calves than the adults (36.11%) (P<0.05). Overall prevalence in cattle was 28.05%. The highest (41.67%) prevalence was recorded at the Government dairy farm, followed by Gawala colonies (32.72%), then the Military dairy farm (22.72%) and the lowest (15%) was recorded in Household dairies. The highest (35%) prevalence was found during August and the lowest (21%) during January. A significant difference (P<0.05) was noted. Females were found to be more susceptible (29.21%) than males (18.75%). The young calves had significantly higher (3 8.88%) prevalence as compared to the adults (24.44%). Similarly, the overall prevalence in buffaloes was found to be 20.11% percent. The highest (40.55 %), prevalence was recorded at the Government Dairy Farm, followed by Gawala colonies (30%) then Military Dairy Farm (21.11%) and the lowest prevalence i.e. 12.77% was reported in Household Dairies. A non significant difference was recorded P>0.05). The highest (46.66 %) prevalence was recorded during August, while, the lowest (6.66%) during November and December. Females were found to be more susceptible than males. Where as the prevalence in a younger buffalo was significantly higher as compared to the adults. Comparison of direct microscopic examination and PCR based methods was made at the Government dairy Farm, Gawala colonies; Military Dairy Farm and Household Dairies. By direct Microscopic examination prevalence was found to be 28.05% (202/720) in cattle whereas by PCR it was 31.11%. Statistically analysis showed that the prevalence by PCR was significantly (P<0.05) higher than the microscopic examination. It was observed that the highest prevalence of Giardiasis in bovines (Calves, Cattle and buffalo) was noted during August when the average temperature was 31.48°C. However the maximum and minimum temperatures were 35.37°C and 27.6°C, relative humidity 7 1.28% and rainfall was 3.2mm. The results of therapeutic trials by using albendazole, metronidazole, and mebendazole in cattle were calculated on the basis of reduction in the cysts count in the faeces after treatment. Efficacy of albendazole at three dose levels i.e. 1 Omg/kg.b.wt, 1 5mg/kg.b.wt, 2Omg/kg.b.wt was 86.33%, 98.5% and 100% respectively, on day 27 after treatment. Efficacy of the metronidazole at 5Omg/kg.b.wt, 1 OOmg/kg.b.wt, and 1 5Omg/kg.b.wt. Was 85.42%, 87.8% and 94.02% respectively on day 27. Efficacy of mebendazole at three dosage level i.e. 7.5rng/kg.b.wt, lOmg/kg.b.wt and 2Omg/kg.b.wt was 81.15 %, 87.32%, and 90.4% on day 27 after treatment. Among these drugs, albendazole at 1 5mg/kg.body.weight was found to be most effective drug in the elimination Giardia infection. The significant (P<0.05) decrease in the CPG count after treatment in all the three groups and dose levels was noted. A significant difference (P<0.05) was observed in the level of leukocytes and of eosinophisl of infected cattle at day 06 and day 13 post inoculation. The leukocytes/lymphocytes count of Giardia infected cattle was 58.09%. Whereas, eosinophils constituted of leukocytes 9.69%. The total proteins of the sample were studied by sodium doedocyl sulphate polyacrylamide gel ELECTROPHORESIS (SDS PAGE). The result indicated that 8 diffeent molecular weight peptide badns were identified with size ranges from 20 to 70 KDa and common bands reported at 20, 24 and 35 K Da Availability: Items available for loan: UVAS Library [Call number: 1146,T] (1). Place hold
Epidemiology, Serodiagnosis And Chemotherapy Of Anaplasmosis In Cattle

by Farhan Ahmad Atif | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr..Muhammad Arif Khan.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2011Dissertation note: Anaplasmosis is globally distributed tick-borne disease of livestock with great economic importance in cattle industry. The current project was designed to estimate the prevalence of anaplasmosis, ticks and risk factors associated with seroprevalence of Anaplasma marginale among cattle in Sargodha, Khushab and Rawalpindi districts, Punjab, Pakistan. Moreover, haematological changes in A. marginale infected cattle and efficacy of chemosterilization regimens were evaluated using locally available drugs for the elimination of adult naturally infected carrier cattle. A total of 1050 blood, serum and tick specimens were collected from randomly selected small holders (n=90) and private livestock farms (n= 12) using multistage cluster random sampling technique. A total of 30 union councils, 34 cattle farms (30 small holders and 4 livestock farms) and 350 cattle were selected as primary, secondary and elementary sampling units from each district. Sampling unit was indigenous and crossbred cattle of both the sexes. Microscopic examination of the Giemsa stained blood mears revealed an overall prevalence of blood parasites as 21.14%. Anaplasma marginale was the highe t prevalent (5.81 %) haernoparasite of cattle followed in order by Theileria sp. (5.14%) and Babesia bigemina (4.76%), respectively. Crossbred cattle were more susceptible to TBDs as compared to the indigenous cattle. Highest prevalence of TBDs was recorded in summer. The prevalence of tick-transmitted diseases was higher in small holders (31.3%) than private livestock farms (17.5%). Chi square analysis indicated a significant association (P<0.05) among indigenous and crossbred cattle to selected TBDs. Wherea. non- significant association between different age groups, seasons, sex and farm sizes were revealed. The overall seroprevalence of Anaplasma marginale in cattle using cELlSA was 31.05%. Seroprevalence was higher in crossbred cattle of more than 4 years of age and there was a significant (P<O.OO I) association between different age groups and breed. The seroprevalence was significantly (P<0.05) higher in summer season in Sargodha and Khushab districts. Moreover, the seroprevalence was significantly higher in small holders in all study districts. The epidemiological data and relevant information regarding area, host and farm management factors were collected on a questionnaire through interview from each dairy farmer, attendant or manager from September, 2009 to August, 20 10. Multivariate analysis of risk factors revealed that cattle of more than 4 year of age (OR=5.42), heavy tick infested (OR =2.10), crossbred (OR = 1.59) cattle were significantly at higher risk for seroprevalence to Anaplasma marginale. Presence of Rhipicephalus (Boophilus) microplus (OR=3.70), use of ivermectin (OR=3.97), moderate interval of acaricide frequency (OR= 16.50), stall feeding (OR=4.90) and use of unhygienic needles (OR=24.00) were significantly associated with seroprevalence to Anaplasma marginale in cattle (P<0.05). The Sargodha district was at higher risk (OR = 1.81) as compared to Khushab and Rawalpindi. The tick species identified from cattle were Hyalomma anatolicum anatolicum, Rhipicephalus (Boophilus) microplus, Rhipicephalus sanguine us, Rhipicephalus (Boophilus) annulatus and Haemaphysalis sp. The overall prevalence of tick infestation among cattle was 54.76%. The highest prevalence (57.71%) of cattle tick infestation was tick infested sites in cattle followed by dewlap (92%), inner thighs (90%), neck & back (54%), tail (26%), ears (13%), around eyes (10%), flanks (4%) and legs (2%). The haematological changes were studied at different levels of parasitaemia " 7%, >7-15% and> 15%) in Anaplasma marginale infected Sahiwal and crossbred cattle. There was a significant difference (P<O.OS) among total erythrocyte count (TEC), total leukocyte count (TLC), haemoglobin (Hb), packed cell volume (PCV), mean corpuscular haemoglobin (MCH), mean corpuscular haemoglobin concentration (MCHC) at different levels of rickettsemia in both breeds. ignificant difference (P<O.OS) was noticed among RBCs, PCV and MCH blood parameters between Sahiwal and crossbred cattle. A total of sixty Anaplasma marginale seropositive adult Sahiwal cattle were selected having their ages between 3-4 years ranging in weight from 246-341 kg. The animals were divided in four groups designated as OXY -group-I, E RO-group-II, IMC- group-III and control-group-IV, comprising IS animals each. The seropositive animals received oxytetracycline (22 mglkg IV once in a day for five days), enrofloxacin (S mglkg IV once in a day for five days) or imidocarb (S mglkg 1M twice, 7 days apart). Re ult of chemosterilization study indicated that oxytetracycline 13/1S (86.67%) and irnidocarb dipropionate II/IS (73.33%) eliminated Anaplasma marginale infection in adult naturally infected carrier cattle on S6th day. The carrier clearance was confirmed by cELISA followed by subinoculation of blood in seronegative splenectomized calves. It was concluded that TTBDs are widely distributed in Punjab, Pakistan. Host. management and area factors are involved with the seroprevalence of Anaplasma marginale in cattle. Haemolytic anaemia is the major haematological finding of Anaplasma marginale in cattle. Oxytetracycline is more effective and safe In chemosterilization of persistent Anaplasma marginale infection in cattle. There is a need for country wide epidemiological studies on ticks and TBDs using advanced serological and molecular techniques. Moreover, the identification of the potential vector of anaplasmosis should be required for the effective prevention and control of anaplasmosis in Pakistan. Availability: Items available for loan: UVAS Library [Call number: 1368,T] (1). Place hold
Epidemiology, Serodiagnosis, Therapy And Control Of Schistosomiasis In Buffloes

by Ghulam Murtaza Arshad | Prf.Dr. Azhar Maqbool | Pof. Dr. Haji Ahmad Hashmi | Prof.Dr.Muham | Faculty of Veterinary Sciences.

Material type: book Book; Format: print Publisher: 2008Dissertation note: Schistosomiasis is one of the major diseases of public health and socio-economic importance in the developing countries of the world. Among human parasitic diseases, Schistosorniasis ranks second to malaria in tern-is of world wide public health risk. Keeping in view the importance of disease, the study was conducted to record the month wise and season wise prevalence of Schistosorniasis in buffaloes in four districts of the Punjab, province ie., Lahore, Sargodha, Kasur and Sheikhupura. The present study comprises of four parts. Part I: deals with epidemiology of Schistosomiasis in buffaloes. Overall prevalence of Schistosomiasis in buffaloes, different farms of Punjab province indicated that infection was the highest (17%) at Kasur district followed by Sheikhupura (14.83), then Lahore (14.6%) and the lowest (13.66%) at Sargodha. The highest month wise prevalence was recorded during August (25.5%) followed by July where as the lowest during December and January. Infection in buffaloes was higher in animals over two years of age (1 9%) than animals below two years of age (5%) in all the four districts of Punjab. The prevalence was higher in females (15.98%) than male (9.48%). There is variation in the prevalence as there is difference in the environmental and managemental condition of the area. For the serodiagnosis i.e. ELISA was used, the results indicated that the prevalence was lesser than the faecal examination because this was more specific and sensitive than the faecal examination. Part 2: deals with the prevalence and ecology of snails. Various species of snails which act as the intermediate host of the Schistosomes were collected from the study area. The e of infection in the snails and role of cercariae in transmission of the disease was studied. A total of 10418 snails were collected of these 13.51 per cent were found to be infected. Among these 2350 were collected from Kasur district with infection rate of 14.51 percent followed, by Sheikhupura 2882 (13.6%) then Sargodha 2709 (13.40%) and the lowest at Lahore 2477 (12.51%). At Kasur district, genus wise prevalence of snails with infection rate indicated that Oncomelonia, indoplanorbis and Bullinus are the predominant genera with infection rate of 31.79, 17.10 and 14.46 percent respectively. However the highest number of the snails collected belonging to the genera Indoplanorbis. At Sheikhupura district, genus wide prevalence of snail indicated that Bullinus, Lymnaea, Indoplanorbis and Physa are the four prominent snails with infection rate of 24.74, 20.57, 14.66 and 13.84 percent respectively. At Sargodha district, genus wise prevalence of snails indicated that Lymnaea, Indoplanorbis, Bullinus and Physa are the four prominent snails with infection rate of 25.09, 14.29, 14.28 and 16.77 percent respectively. At Lahore district, genus wise prevalence of snails indicated that Bullinus Lymnaea, Physa and Indoplanorbis are the four prominent snails with infection rate of 23.37, 18.96, 13.97 and 12.70 percent respectively.While the prevalence at the snail level the Chi square value is 242.944 and the P-Value is 0.0000 1 which is highly significant. Part 3: deals with the meteorological data ie, temperature, humidity, rainfall and pan evaporation with prevalence of snails and parasites. The temperature and rain fall play very important role in the spread of disease. The ideal temperature ranges form 22-25 °C where development within snail takes place in an efficient manner similarly humidity f ranges from 55-70% is ideal for the development of the snail and the parasite. Rainfall is very important for the spread of the disease. There is a positive correlation of disease incidence to maximum and minimum temperature, humidity, and rainfall and pan evaporation. It was seen that during summer and autumn, optimum temperature, relative humidity and rainfall play an important role for rapid propagation of the parasitic life Part 4: deals with therapeutic trials against Schistosomiasis in buffaloes. A total of 150 animals (140 infected and 10 animals, normal) age ranged 5-9 years and of both sexes naturally infected with Schistosorniasis were used in thirteen controlled experiments. The efficacy of certain indigenous drugs, including Nigella sativa (Kalongi) , Caesalpinia Crista (Karangwa), Lagenaria siceraria seeds (Kadoo ke Beej), Sausseria lappa (Qushte-e-Shreen) and Praziquanlel was compared with each other and control. Efficacy was quantified by determining the difference of egg per gram faeces (EPG) pre and post treatment. After the single dose of 50, 75 and 100 mg 1kg body weight of Nigella sativa (Kalongi) reduced EPG by 65.85, 68.29 and 71.79 per cent, respectively. After the second dose the respective reduction in EPG was 85.36, 92.68 and 94.87 percent. Caesalpenia crista at three dosage levels i.e.50, 75 and 100 mgI kg body weight caused 46.34, 53.65 and 59.52 percent reduction respectively while the reduction in EPO after second dose was 82.92, 90.24 and 92.85 percent respectively. Lagenaria siceraria Seed at three dosage levels i. e., 50, 100 and 150 mg/ kg body weight caused the reduction in EPG reduction 47.61, 52.63 and 64.10 percent respectively, while after second dose, counts as the reduction 80.95, 86.84 and 92.30 percent respectively. Sausseria lappa at three dosage levels i.e., 100, 150 and 200 mg/ kg body caused EPG reduction as under 50.00, 53.48 and 56.09 percent respectively, while after second dose the reduction in EPG count was 71.42, 81.39 and 85.36 percent respectively. Where as Praziquantel at the dose of 10 mg/body weight caused reduction in EPO 66.66% while after the second dose the reduction in EPG count was 97.43 percent. The efficacy order was Praziquantel, Nigella saliva, Caesalpinia crista, Lagenaria siceraria and Sausseria lappa. No side effects with any drug were noted. All animals showed clinical improvement after the treatment. Availability: Items available for loan: UVAS Library [Call number: 1150,T] (1). Place hold
Epidemiology, Zoonotic Potential, Haematiology And Therapy Of Toxocariasi In Dogs And Humans.

by Nisar Ahmad | Prof. Dr. Azhar Maqbool | Prof. Dr | Prof. Dr. Kamran Ashraf.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2010Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1505,T] (1). Place hold
Epidemiology, Zoonotic Potential, Molecular Characterization And Therapeutic Trial Of Leptospirosis In Horses

by Muhammad Luqman Sohail (2007-VA-94) | Dr. Muhammad Avais | Dr. Muhammad Yasir Zahoor.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Leptospirosis is an important zoonotic disease. It affects a wide range of mammals, fish and even a few reptiles. It is caused by Leptospira interrogans, having more than 250 serovars, distributed geographically throughout the world. In horses, Leptospira interrogans causes liver and renal abnormalities, ERU, and reproductive disorders in mares like abortion, perinatal death and still birth. It is transmitted to human beings, working with live or dead tissue of infected horses and through surfaces contaminated with urine of carrier or infected animals. In humans, it causes influenza like illness and death in severe cases. Serological testing, bacterial culture and molecular techniques are used for the diagnosis of disease. This study was aimed at estimating the seroprevalence of Leptospira spp. in horses and humans of three climatically distinct regions of Punjab, Pakistan. Furthermore, molecular biology techniques were employed for the confirmed diagnosis of equine leptospirosis and therapeutic efficacy of ampicillin and adhatoda vasica was analyzed against disease. It was the very first study in Pakistan conducted to explore equine leptospirosis in the country. During this study, 384 horse blood samples and epidemiological data were collected from three climatically distinct regions, viz;Rawalpindi, Lahore and Bahawalpur (128 from each study area) and were subjected to ELISA to determine seroprevalence of Leptospira. Results showed overall prevalence of 33.85% in Punjab with highest prevalence in Rawalpindi (40.62%) which experienced highest rainfall, followed by Lahore (38.28%), and least in Bahawalpur (22.65%). Risk factor analysis showed that age, gender, living area, herd size, water source, exposure to rodents and floods, feeding practices and usage of animals were found significantly associated with the disease. To study the seroprevalence of human leptospira, 360 human blood samples were collected (120 from each study area). Epidemiological data on pre-structured questionnaire Summary 140 were collected from all the participants of study. All the samples were subjected to ELISA and results showed overall prevalence of 40.83%, with highest seroprevalence in Rawalpindi (50.83%), followed by Lahore (38.28%) and least in Bahawalpur (27.50%). Age, gender, occupational and living area, water recreational activities, occupation, exposure to floods, educational status and history of wound were significantly associated risk factors while use of PPE during work was deterrent. During this study, 65 ELISA positive horse samples were subjected to molecular biology diagnostic technique PCR for the molecular characterization of equine leptospirosis in country. After DNA extraction, PCR was performed using primer sets specific for 16S rRNA gene, which yielded a fragment of length 306bp after gel electrophoresis. Out of 65 tested samples, 20 samples (30.76%) were PCR positive and was further sequenced and phylogenetic tree was constructed. Dendogram showed the sequenced samples were related to pathogenic Leptospira interrogans, revealing potential of 16S rRNA primer sets for the detection of eqine leptospirosis in country. Dendogram further showed closed resemblance of analyzed samples with serovar Icterohemmorhagae, Australis and Autumunalis which are dominant serovars in India, Iran and China, the neighboring countries of Pakistan. Therapeutic efficacy of ampicillin and AV was studied by analyzing the hematology, liver function test, renal function tests and serum mineral levels at day 0 (pre-treatment), 7, 21 and 35 (post-treatment). Results showed that all the tested parameters were changed significantly during infection and significant improvement was observed after treatment. Ampicillin was instrumental in revealing hematological abnormalities while AV played important role in normalizing the liver and renal insufficiency. After treatment ampicillin treated 58.33% of animals and AV treated 41.66% of animals. Summary 141 This first ever study of equine leptospirosis in country uncovers the high prevalence rates in horses and humans and raises a need for control strategies to prevent the transmission and spread of the disease. It also highlights the potential of molecular biology techniques for the confirmed diagnosis of equine leptospirosis and explores options for designing better specie specific treatment regimes for the disease. Availability: Items available for loan: UVAS Library [Call number: 2660-T] (1). Place hold
Epidemiology, Zoonotic Potential, Molecular Diagnosis And Chemotherapy Of Cryptosporidiosisin Bovine

by Sabiqaa Masood | Prof. Dr. Azhar Maqbool | Dr. Aftab | Prof. Dr. Zafar Iqbal Choudhry.

Material type: book Book; Format: print Publisher: 2011Dissertation note: Cryptosporidiosis is an important parasitic infection of cattle, buffaloes, goats, sheep, horses, cats, human beings and other vertebrates. Prevalence of Cryptosporidiosis in selected animals and human beings carried out on the basis of microscopic examination and polymerase chain reaction (PCR). Percent prevalence of Cryptosporidiosis determined on the basis of conventional identification method was highest in calves (23.1) followed by cattle (10.5) and buffaloes (8.47). Percent prevalence of Cryptosporidiosis in calves, cattle and buffaloes was higher at Government dairy farm (38.33, 20.55 and 16.66) followed by Gawala colonies (26.1, 12.77 and 9.44), Military dairy farm (18.3, 6.11 and 4.44) and then House hold dairies (10, 3.88 and 3.34). Percent prevalence recorded in calves having age less than six months was higher (26.45) than those with 7-12 months of age (16.6). Percent prevalence of Cryptosporidiosis in cattle having age of 2-3 years was higher than those cattle having 3-7 years of age. Similarly, infection rate was higher in buffaloes with 2-3 years age (11.8) than 3-7 years (9.8). Cryptosporidiosis percent prevalence recorded in female calves was higher (24.04) than male calves (18.2). Percent prevalence of Cryptosporidium oocysts observed in feces of male cattle was little higher (11.25) than female cattle (10.4). Cryptosporidiosis percent prevalence recorded in female buffaloes was higher (13.3) than male buffaloes (8.3). The data was analyzed monthly for the purpose to trace out the specific period of the year having the highest prevalence rate of Cryptosporidium infection. The highest percent prevalence of Cryptosporidiosis recorded in fecal samples of calves was during summer (27.5) followed by autumn (25.8), spring (20.3) and the lowest in winter season (14.5). Overall the highest percent prevalence of Cryptosporidiosis in cattle recorded was during summer (15), followed by spring/autumn (10.88) and the lowest in winter (6.6%). The highest percent prevalence of Cryptosporidiosis recorded in buffaloes was during summer (12) followed by autumn (20), spring (7.5) and the lowest in winter season (4.5). In human beings patients suffering from diarrhea were examined by microscopy and percent prevalence calculated was 40 in present study. Molecular percent prevalence rate determined was 12.22 in cattle. Percent prevalence recorded using PCR was the highest at Government dairy farm (22.7), followed by Gawala colonies (14.41), Military dairy farm (7.7) and the lowest at House hold dairies (5). The highest season wise percent molecular prevalence was observed during summer (16.6) followed by autumn/spring (13.3), the lowest in winter (7.7). The higher molecular percent prevalence in young cattle (2-3 years) was higher (23.7) than those having age between 3-7 years (10.7). Molecular percent prevalence of Cryptosporidiosis in selected cattle was lower in females (13.6) than males (15). The efficacy of albendazole observed was 43.05, 58.7 and 64.6 percents on 13th, 20th and 27th day post treatment. The efficacy of albendazole determined on this dose was 34.8, 57.1 and 62.9 percents on days 13, 20 and 27 post therapy. Efficacy of drug calculated on days 13, 20 and 27 was 32.8, 53.3 and 56.6 percent, respectively. Percent efficacy of used drug was 55.04, 68.5 and 79.4 on days 13, 20 and 27 post treatment, respectively. At 50mg/kg body weight dose rate of paromomycin significant decrease in OPG count was recorded from 6th day post treatment and onward (P<0.05). On days 13, 20 and 27 percent efficacy of used drug determined was 48.1, 65 and 69, respectively. Availability: Items available for loan: UVAS Library [Call number: 1678,T] (1). Place hold
Epidemiology, Zoonotic Potential, Serodiagnosis And Chemotherapy Of Sheep Fasciolosis In Different Ecological zones of balochistan

by Masood Ul Haq Kakar | Prof. Dr. Azhar Maqbool | Dr. Muhammad | Prof. Dr. Yasmeen Nawaz.

Material type: book Book; Format: print ; Nature of contents: biography; Literary form: Publisher: 2012Dissertation note: Various epidemiological aspects of human and sheep fasciolosis were investigated in four districts of Balochistan (Pakistan) having different ecology i.e. district Bolan from (Plain zone), Lasbela (Coastal zone), Qilla Saifullah (sub humid and semi arid sub zone of Upland zone) and district Pishin from (Arid sub zone of Upland zone). Sheep samples were examined through Coprological examination showed overall prevalence of 10.26% in one year study period from June 2010 t0 May 2011. The uppermost prevalence was recorded in district Bolan (14.79%) followed by Lasbela (10.63%), Qilla Saifullah (8.75%), and the lowest in district Pishin (6.88%). Overall the highest prevalence by season was recorded in autumn (25.31%) followed by winter (9.22%), summer (6.41%) and lowest in spring (5%). Amongst the month the overall highest prevalence was recorded in the month of September (30.63%) and lowest in the month of May (1.88%). Sex wise prevalence was found highest in female more susceptible to infection (11.22%) than male (8.48), but sex wise difference was non-significant statistically. Amongst the age group significantly higher prevalence was recorded in adults young than adult of age group (5.91%). During one year study period prevalence (%) of human fasciolosis in some districts of Balochistan was recorded (0.42%), with overall district wise prevalence in Qilla Saifullah and Bolan (0.83%) and (0%) in Lasbela and Pishin. Overall season wise prevalence was noted the highest in autumn (1.25%) followed by summer (0.63%) and 0% prevalence in winter and spring. Month wise results showed 2.5% prevalence only in the month of August and October while 0% in the other months. Gender wise prevalence 0.42% was found only in male, no female samples were collected due to some religious, traditional and community problems. Prevalence by age was recorded the highest in above 20 years of age group (0.74%) while this value decreased to zero in below 20 years of age group. Antibodies against fasciolosis in serum samples through indirect (ELISA) were recorded 13.13% (63/480) in sheep and 0.42% (2/480) in human indicates the higher prevalence (%) as compared to fecal examination. Likewise district, age and sex wise seroprevalence (%) of fasciolosis was reported higher than coprological examination in case of humans as well as in sheep. In sheep positive correlation was noted between fasciolosis and relative humidity while negative correlation with temperature (ºC) and rainfall (mm). While in humans prevalence positive correlation was observed with temperature (ºC), relative humidity (%) and rainfall (mm). Overall 1123 snails belonging to different 5 genera were collected from different district from different agr-ecological zones of Balochistan from June 2010 to May 2011. Amongst the snails the highest prevalence (37.04%) was found for Indoplanorbis, followed by Bulinus (32.15%), then Lymnea (20.66%), Melanoides (5.52%) and the lowest Physa (4.63%). Comparative study for coprological and serological tests (ELISA) was conducted for four districts from different agro-ecological zones of Balochistan i.e. District Bolan from (Plain zone), Lasbela (Coastal zone), Qilla Saifullah (sub humid and semi arid sub zone of Upland zone) and district Pishin from (Arid sub zone of Upland zone) for one year i.e. from June 2010 t0 May 2011. Overall prevalence of sheep and humans was 0% and 8.13% by coprological examination and 13.13% and 0.42% by indirect ELISA tests. Prevalence by ELISA was found higher than fecal examination when analyzed statistically. Similar seroprevalence for month, districts, age and sex was noted higher than coprological examination for sheep and humans. ELISA Sensitivity (%) and specificity (%) was recorded >97.0% and 95% and 100%, 100%, respectively for sheep and humans. Indigenous plants i.e., Saussurea lappa (roots), Fumaria parviflora (aerial) and Caesalpinia crista (seeds) were used at dose level of 60, 70 and 80 mg/kg body weight against naturally infected sheep with fasciolosis and their effectiveness was compared with triclabendazole (10mg/kg body weight). Triclabendazole was found 100 % effective after second dose whereas all herbal medicine it reached up to this mark after administration of second dose of 80 mg/kg body weight. From this study we can conclude that these herbal medicines can safely replace the triclabendazole, which is not, only cost effective but have no side effects. Availability: Items available for loan: UVAS Library [Call number: 1587,T] (1). Place hold
Epidemmiology Of Foot And Mouth Disease In Buffaloes Of Punjab Province

by Farhat Nazir Awan | Prof. Dr. Khushi Muhammad | Prof. Dr. Muhammad Akram Muneer.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2009Dissertation note: This study indicates that the ranking order of buffalo diseases, with respect to their incidence in descending order in Punjab province is Foot and Mouth Disease, Mastitis, Diarrhea, Haemorrhagic Septicemia, Sudden Death Syndrome and haemoglobinuria. Similarly the disease ranking order in cattle in descending order is FMD, Mastitis, Diarrhea, Hemorrhagic Septicemia, Haemoglobinuria and Sudden Death Syndrome. FMD is top most economic important disease both in buffaloes and in cattle in the province. Morbidity rate in the adult cattle and buffalo was higher as compared to the younger stock. However, the mortality rate was higher in young stock as compared to the adult animals of both the species. Moreover, adult and young males of both the species were more susceptible to the disease as compared to females. Cross-sectional survey revealed the economic loss of Rs. 41.32 million due to loss of milk, cost of dead animals and treatment cost of sick and complicated cases of FMD. The loss due to milk reduction was 57.3% of the total losses followed by mortality loss (26.4%), morbidity effect expenses (15.2%) and treatment charges in FMD complicated cases (1.0%). The findings of present study clearly indicate the association of age, feeding pattern, vaccination status and season as risk factors in the incidence of FMD in Punjab. Data obtained from the EPI-Unit Lahore showed that 719 FMD outbreaks occurred in the district of Punjab during 2007-2008. The highest number of outbreaks (212) was recorded in Rahim-Yar-Khan followed by Bhakkar (118), T.T. Singh (81) and Faisalabad (72). Of the total 309 disease outbreaks in buffalo, 174 (56.3%) were recorded in adults, whereas this number in cattle was 169 (61%). The incidences of the outbreaks increased gradually following the post-monsoon period. The greatest number of outbreaks was observed during the winter season, from December to February. Data from FMD Research Center, Lahore revealed the involvement of only FMDV serotype "O" in all the outbreaks during 2007-2008. Studies of the factors (age, feeding pattern, stage of pregnancy and species) on the immune response of local trivalent FMD vaccine revealed that buffaloes of all age groups responded well to vaccination against disease. It was also observed that 7-9 months pregnant buffaloes elicited significantly lower antibody response to vaccine as compared to the control groups. Similarly, buffaloes on grazing have shown lower anti-FMD-CF GM titer as compared to buffaloes on manger feeding. Sheep and goat were found to be late and poor responder to vaccine as compared to cattle and buffalo. Analysis of 300 serum samples from FMD affected buffaloes of 12 districts of the Punjab indicated the highest incidence of serotype "O" (62.3%) followed by Asia-1 (32.4%) and "A" (3.30%) in the population tested. FMD virus was inactivated at 61 ºC within 15 minutes and at pH 4, 8, and 10 within 24 hours. However, ultraviolet radiation was unable to inactivate the virus even after 45 minutes. The disinfectants/chemicals evaluated in this study including sodium hydroxide, sodium carbonate, citric acid, acetic acid, formalin, sodium hypochlorite, virkon-s, aldekol and Gas-G were effective in inactivating the FMDV at recommended concentration levels of 2%, 4%, 0.20%, 4%, 0.15%, 3.0%, 1.0%, 0.50% and 0.1% after 60, 30, 60, 60, 30, 30, 30, 60 and 30 minutes, respectively, at 300C. Sodium hypochlorite and Gas-G were equally good in inactivating the virus at half (1.5% and 0.05%) of the recommended concentration. Efficacy trial of local and imported oil based trivalent FMD vaccine in six villages, of the Faisalabad district clearly showed that 81.8% of FMD cases were prevented by the local inactivated vaccine in vaccinated animals whereas; this percentage was 70.6 in case where imported vaccines were employed. Moreover, efficacy of the local vaccine was higher than the imported vaccines. Availability: Items available for loan: UVAS Library [Call number: 1537,T] (1). Place hold
Epidemological, Serological, Heamatological And Therapeutic Studies On Ovine Nematodiasis In Three Ecological Zones of Balochistan

by Abdul Razzaq | Prof. Dr. Kamran Ahraf | Prof. Dr | Prof. Dr. Azhar Maqbool.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2012Dissertation note: The main area of research in this study was to assess the prevalence, hematological and serological aspects of ovine nematodiasis. Four main experiments were conducted to highlight the objectives of the present research study. First experiment was conducted to find out the prevalence of sheep major nematodes for one year (January-December 2011). For this purpose three sheep breeds i.e., Balochi, Babrik and Harnai (either sex and between 1-5 years age groups)were selected randomly from three sites i.e., Quetta, Ziarat and Loralai. Faecal analyses of these sheep showed overall higher (40.25%) nematodes prevalence at Loralai followed by Ziarat (29%) and Quetta (23.92%). Five nematodes infection were recorded at three experimental sites. Among these, H. contortus (5.58 to 10.42%)and was the higher prevalent followed by N. battus (6.92 to 9.33%), S. papillosus (4.42 to 9%), T. colubriformis (2.33 to 7.33%) and T. ovis (1.83 to 6.83%).The nematodes prevalence was higher in one and five years old sheep. The female-sheep were infected with higher nematode prevalence higher the than male once and sometimes non-significant difference. These five nematodes were prevalent almost throughout the year; however, a peak infection was recorded during August/September. The high temperature, rainfall and humidity during these months may be predisposing factor of higher prevalence. Second experiment was on diagnosis of sheep nematodiasis through Enzyme-linked immunosorbent assay (ELISA). For this purpose H. contortus and T. ovis positive samples (200) based on coprological examination were also indicated 100% positive sensitivity by the ELISA based on crude somatic antigen, while on excretory antigen based showed lower (92%) sensitivity. The sera (n=200) of non-infected sheep (based on coprological examination) showed marked difference results. Such as 168 (84%) and 166 (83%) samples were found positive with H. contortus and T. ovis, respectively. While, based on crude somatic antigen 158 (79%) and 144 (72%) samples were found positive with H. contortus and T. ovis, respectively. Third experiment was conducted to determine the hematological values and total serum protein indices in healthy and nematodes infected sheep. The statistically significant (P<0.05) difference in PCV, Hb, RBC, WBC, Eosinophil, ESR and Total serum protein values was observed among healthy and nematode infected sheep groups. While, there was no statistically significant (P<0.05) difference in TLC, Lymphocytes, Neutrophil, Monocytes and Basophils counts in healthy and nematodes infected sheep groups. Fourth experiment was conducted on assessing the comparative efficacy of synthetic (Oxfendazole and Ivermectin) and locally manufactured herbal medicine (Deedani, Kirmar and Atreefal Deedan) anthelmintics against sheep nematodes at AZRC/PARC Range-livestock Research Station Sanjavi district Ziarat. The present study results regarding the comparative efficacy showed that, Atreefal deedan among herbal products (Deedani and Kirmar) and Ivermectin than Oxfendazole was found effective against sheep nematodes. The sheep treated with Ivermectin showed highest (96%) FEC reduction, followed by Oxfendazole/Atreefal deedan (86%), Kirmar (60%) and Deedani (32%). Availability: Items available for loan: UVAS Library [Call number: 1613,T] (1). Place hold
Evaluation Of Different Extenders For The Cryopreservation Of Buffalo Bull (Bubalus Bubalis) Semen

by Dawar Hameed Mughal | Prof. Dr. Ijaz Ahmad | Prof. Dr. Muhammad Aleem.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2011Dissertation note: Buffalo is playing an important role in our country's economy by producing milk, meat and draught power. Genetic potential of low producing animals can be improved by using artificial insemination technology. Unfortunately, less number of elite bulls are available and low fertility rate of buffalo by using cryopreserved semen has been obtained. Semen is exposed to osmotic and oxidative stresses during processing, cryopreservation and thawing before insemination. Fertilizing ability is lost due to spermatozoa damage and it ultimately results in poor conception rates in buffalo. In order to protect spermatozoa from these stresses and improve fertility in buffalo, five osmotic pressure based concentrations of three extenders i.e. Citrate egg yolk extender (CEYE), Tris egg yolk extender (TEYE), and Lactose egg yolk extender (LEYE) were prepared by varying the quantity of the solutes to obtain an osmotic pressure of 255, 265, 275, 285 and 295 mOsm/kg. Osmotic pressure was measured by an osmometer. In the first experiment, equal volume of semen obtained from four Nili-Ravi buffalo bulls was pooled and used to study the effects of osmotic pressure on post thawed semen characteristics. For this purpose, three basic media: citrate fructose media, tris citric acid fructose media and lactose media were prepared and divided each media in to five equal parts to maintain osmotic pressures of 255, 265, 275, 285 and 295mOsm/kg. These basis media were stored in a biomedical freezer, which were later used in preparing three semen extenders i.e. Citrate egg yolk extender (CEYE), Tris egg yolk extender (TEYE), and Lactose egg yolk extender (LEYE). During each collection, fifteen extenders (each of three extenders having five osmotic pressures i.e. 255, 265, 275, 285 and 295mOsm/kg) were used to extend the semen. After freezing, semen characteristics like sperm motility rate, viability rate, acrosomal integrity rate, plasma membrane integrity (PMI) rate, MTT reduction rate, sperm DNA integrity rate and lipid peroxidation were noted. Post thaw sperm motility rate in (%) CEYE was significant (P<0.05) at 295mOsm/kg compared to 255, 265 and 275mOsm/kg. However, sperm motility rate of different osmotic pressures of TEYE and LEYE was non-significant (P>0.05). Sperm viability rate (%) was non-significant (P>0.05) in all three extenders. Sperm acrosomal integrity rate was non-significant in CEYE and LEYE. However, it was significant (P<0.05) at 265, 275 and 295mOsm/kg in TEYE. Sperm PMI rate, MTT reduction rate, sperm DNA integrity rate and lipid peroxidation were non-significant (P>0.05) in CEYE, TEYE and LEYE. On the basis of the individual and overall comparison of different semen characteristics of three extenders and their osmotic pressures, LEYE with was considered to be continued in the next experiment to upgrade the extender by adding taurine (TA) at 0.0, 30, 50 and 70 mM and trehalose (TR) at 0.0, 20, 40, 60 mM concentration. Semen collection, processing, freezing etc were done as per experiment-1 and same post thaw tests were carried out. Post thaw sperm motility rate was significantly (P<0.05) higher at TA-0.0 and TA-20mM and all concentration of TR. Sperm viability rate, acrosomal integrity rate, PMI rate, MTT reduction rate and lipid peroxidation at different concentrations of TA and TR were recorded non-significant (P>0.05). However, sperm DNA integrity rate was significant (P<0.05) higher at TA-0.0 and TR-0.0mM. On the basis of comparison of different semen characteristics under various concentrations of taurine or trehalose, supplemented in semen extenders. Concentration of TR-70mM was considered to be continued in the next experiment to test fertility of the optimized extender. Semen straws of LEYE supplemented with TR-70mM were used to inseminate the 50 buffaloes in heat (Supplemented group), while, traditionally used tris based buffalo bull semen extender was used (control group) to compared pregnancy rate (PR) of this experiment. Pregnancy rate in control and supplemented group was 38 and 54% respectively, which was statistically non-significant (P>0.05). Availability: Items available for loan: UVAS Library [Call number: 1538,T] (1). Place hold
Expression And Mutational Analysis Of Breast Cancer Susceptibility Gene 1 (Brca1) And Cyclooxygenase-2 (Cox-2) Gene In Feline And Canine Tumours

by Haleema Sadia (2007-VA-567) | Dr. Muhammad Wasim | Prof. Dr. TahirYaqub | Dr. Abu Saeed Hashmi.

Material type: book Book; Literary form: not fiction Publisher: 2014Dissertation note: Cancer is the first cause of death in cats and dogs while in human it is the second most cause of death (Jemal et al. 2008). According to an estimation, cancer related deaths in the world are 13% and 70% of these deaths are in poor countries (World Health Organization 2012). Such natural cases of cancers in cats and dogs especially, in dogs offer an opportunity to use the dogs for comparative cancer studies and as an animal model for anticancer drug development (Pawaiya 2008). Inu a series of more than 2000 autopsies, it was found that almost forty five percent dogs that lived for ten or more years expired because of cancer (Bronson 1982). Dogs are affected by skin cancer 35 times more often than humans. They are also affected 4 times more often by mammary gland cancer, 8 times more often by bone cancer, and twice more often by leukemia, than humans (Cullen et al. 2002). The regulation of cell proliferation, genome stability and programmed cell death are important for systemic homeostasis. 1.1Historical perspective on cancer causation Hippocratic and Galenic medicine attributed the spread of black bile (one of the four humours) in the tissue as the cause of the cancer (Diamandopolus 1996) is an idea survived intact through the Middle Ages and Renaissance. With the discovery of the lymphatic system by Gasparro Aselli in 1662, the black bile theory was superseded by the idea that cancer was an inflammatory reaction to extravasated lymph; a theory modified 150 years later by John Hunter who introduced the notion that contaminated coagulating lymph was the origin of the cancer (Kenneth 2003). A German pathologist Johannes Muller first time demonstrate that cancer is made up of cells (1838) but he also gave an idea that cancer cells were originated from a bud called Blastema instead of normal cells (Kardinal and Yarbro 1979). Following Schleiden and Schwann's cell theory of tissues,it was Rudolf Virchow (Muller’s student) who in 1855 demonstrated that every cell was derived from another cell (omnis cellula e cellula), including cancer cells (Mazzarello 1999; Porter 1999). In 1867 Wilhelm Waldeyer supported the theory of the normal cell for the origin of cancer and he believed that metastasis resulted from transportation of cancer cells by blood or lymph (Porter 1999). Around the turn of the twentieth century the beginning of tumour transplantation experiments led to the new view of the cancer cell as an autonomous cell. The first successful tumour transplants were described in 1876 by the Russian veterinarian Mstislav Aleksandrovich Novinski (Novinski 1876). He reported in his thesis entitled “On the Question of the Inoculation of Malignant Neoplasms” the first successful serial passage of tumours through transplantation in dogs. Novinski's transplantation experiments were based on the inoculation of canine transmissible venereal tumour (CTVT) in puppies. Novinski stated that successful tumour transplantation depends on the inoculation of a living element of the tumour and that the transplantation of the element of a cancerous tumour to healthy tissue acts as an infecting agent. In 1888 Wehr repeated Novinski's transplantation experiments in dogs with similar results (Shimkin 1955). It is interesting to note that the dogs used for transplantation of CTVT did not come from a single breed and were therefore not highly inbred. The allo-transplantation of tumours seemed less surprising in the late 19th Century than it does today with our modern knowledge of histo-incompatibility. The successful results obtained with CTVT served as model for tumour transmission in other animals. Hanau in 1898 inoculated two rats with vulvar epidermoid carcinoma and observed growth of the tumour in the recipients (Shimkin 1955). In 1901 Leo Loeb supported the transplant ability of tumours in rats (Witkowski 1983; Brent 1997). In 1903 a Danish veterinarian Carl O. Jensen determined the successful growth of transplanted tumours in mice by heredity (Brent 1997). The discovery that the tumour could be successfully transplanted into (Witkowski 1983; Brent 1997) other mice, led the scientists to use rodent system to supply tumours for experiments. The observation that a single tumour could be expanded through many generations exceeding the life span of the laboratory mouse led Leo Loeb to the "cancer immortality" concept (Witkowski 1983). The earliest observations reported by John Hill in 1759 and by Percival Pott in 1775 on the association of a specific tumour to a specific profession or work, led to the idea that some chemicals can cause cancer (Greaves 2000). In 1918 Yamagiwa and Ichikawa induced cancer by applying coal tar to rabbit skin(Greaves 2000; Luch 2005). After the discovery of the X rays by Wilhelm Conrad Roentgen in 1895, Frieben published data in 1902 indicating that cancer rates were increased among persons working with X-rays (Cassileth 1983; Greaves 2000) 1.2 Tumour Progression The first detailed characterization of the dynamic nature of cancer was described by Leslie Foulds (Foulds 1949). Foulds showed that tumours progress (evolve) through different stages, characterized by the acquisition of different phenotypic traits such as increased growth rate, hormone dependence, invasiveness, formation of metastasis (Foulds 1949; Fould 1954; Foulds 1957). With the progress of molecular biology the phenotypic view had been replaced with the somatic mutation theory, where cancer evolved through the accumulation of different mutations in several genes (Greaves 2000). The accumulation of mutations in somatic cells implicated the presence of different cells bearing different mutations and also the presence of natural selection, which selected the cells with advantageous mutations. One of the questions arising from the somatic mutation theory was whether a tumour had a single or a multiple origin. This observation was supported by a karyotype analysis in chronic myelogenous leukaemia (CML) by Peter Nowell and David Hungerford in 1960 (Nowell 2002). They described the presence of an unusually short chromosome 22 in all CML tumour cells analyzed, and the absence in the normal cells from the same patients. This observation suggested that this mutation was a somatic mutation that occurred in one cell in the bone marrow, which gave it a selective advantage to expand as a clone. Nowell postulated that a tumour develops by a Darwinian evolutionary process, where cells with mutations conferring a growth advantage are selected and expanded (Nowell 1976; Greaves 2002). In 1954 Peter Armitage and Richard Doll analyzed human cancer incidence over the age, and showed that chances of cancer increased in older people (Armitage and Doll 1954). The concept that cancer might be contagious also recurs throughout the past 300 years.In the 17th and 18th centuries, physicians Daniel Sennert and Zacutus Lusitanus supported the hypothesis that cancer was contagious. In fact in 1779 a hospital in Paris was directed to move the cancer patients from the city (Cassileth 1983; Kenneth 2003). 1.2.1 Exogenous and endogenous factors In 1844 the Italian physician Domenico Antonio Rigoni-Stern noted that cancer of the cervix was frequent among married ladies, rare among unmarried ladies and absent in Italians nuns. In contrast, breast cancer was more frequent among nuns (Greaves 2000). These observations led to the hypothesis that cervical cancer was sexually transmitted, and we now know that the cause is a papilloma virus (Hausen 2002).In 1908 Wilhelm E and Olaf B, transferred the leukemia in chicken by tissue filterates (Wyke 2003). In 1911, Peyton Rous demonstrated that viruses were the cause of solid tumours (Sarcoma) in chickens but it took many decades before his data were accepted (Dulbecco 1976). The notion that viruses can cause cancer was a discovery that brought back the fear that cancer was a contagious disease. There are many exogenous and endogenous risk factors that affect the tumor suppressor genes and oncogenes (Todorova 2006). Tumour viruses (Bishop 1980), chemical carcinogens (Loeb et al. 2000), natural chemicals, (Ames et al. 1990), herbicides (Glickman et al. 2004), physical carcinogens like radiation (Upton 1978) are exogenous factors while inherited genetic defects, immune system (Rosenthal 1998) and hormonal factors (Rodney 2001) are among endogenous risk factors. Although tumour cells are generally described as independent evolving units, recent results suggest that tumour cells are able to stimulate stromal cells to produce growth factors that increase tumour proliferation (heterotypic stimulation) (Kinzler and Vogestein 1998; Skibe and Fuseing 1998; Iyengar et al. 2003). It has been demonstrated that cells involved in the immune response to tumours may produce factors such as inflammatory chemokines that may also promote the tumour proliferation (Pollard 2004; Wyckoff et al. 2004) 1.2.2 Two hit hypothesis Retinoblastoma is a tumour that becomes manifested early in life. Retinoblastoma can be inherited or sporadic. According to the two hit hypothesis in the inherited form a single mutation in the Retinoblastoma (Rb) gene is present in the germ line which gives the genetic predisposition to develop cancer, but a second mutation in the normal Rb allele which occurs in the retinoblast must be acquired to develop cancer (Knudson 2001). In the sporadic form the two mutations in the Rb alleles occur in the somatic cells. Although the epidemiological and molecular observations have consolidated the multistage theory of cancer, the number of mutations and in which sequential order they have to be acquired to develop cancer is still an open question (Hanahan and Weinberg 2001; Hahn and Weinberg 2002b). 1.2.3 Oncogenes Early experiments involving transforming retroviruses and the transfer of genes from tumour cells into established rodent cells allowed the identification of several cancer causing genes called oncogenes. The result of these experiments suggested that cancer could be induced by the mutation of one proto-oncogene. However, the rodent cells used as recipient in the gene transfer experiments were not normal, but were immortalized, thus acquiring the ability to proliferate indefinitely. When the normal rodent cells were used, the transfer of a single oncogene failed to induce transformation, while the transfer of two oncogenes resulted in transformation. Human cells require more mutations than rodent cells and that there are differences also between cell types within the same species (Rangarajan et al. 2004). 1.3 Cancer Hallmarks Despite the enormous variety of tumours affecting different types of tissues in animals and humans, research over the past 50 years has revealed that all malignant cancers share the same essential alterations (Hanahan D and Weinberg RA 2000). These hallmarks include:  Immortalization  Evasion from programmed cell death (apoptosis)  Independence from growth stimulation  Resistance to growth inhibition  Angiogenesis  Invasion and metastasis  Genetic instability. These hallmarks are briefly described below. 1.3.1 Immortalization Telomeres contain DNA sequence repeats and protein. The repeat sequence consists of hexameric motifs such as GGGTTA in humans, extended for 10 –20 kilobases. The 3’ end has a 100-400 nucleotide over-hang (Mathon and LIoyd 2001). Telomeric DNA is generated by an enzyme called Telomerase Reverse Transcriptase (TERT) which has two subunits, RNA and catalytic protein subunit. This RNA binds the telomeres DNA ends thus acting as template for telomere elongation. The chromosome ends are protected by several proteins: TRF-1, TRF-2, and POT–1 (Mathon and LIoyd 2001; Hahn and Weinberg 2002a). Several experiments have shown that senescence is activated when the telomeres are shortened down to 5 kb and that senescence is triggered by the shortest telomere present in the cell (Hemann et al. 2001). Many reports have suggested that the replicative senescence is not activated by the erosion of the double strand repetitive sequence, but by the degradation of the 3’end single strand overhang, resulting in loss of protective capping (Stewart et al. 2003). Telomere length is maintained by the activation of telomerase or by an alternative mechanism called alternative lengthening of telomeres (ALT), where the telomeres are regenerated through recombination-based inter chromosomal exchange of sequence information (Bryan et al.1997; Dunham et al. 2000). In the normal cell telomerase is transiently expressed, since it can be detected only in S phase, but in neoplastic cells its expression is increased and is detectable throughout the cell cycle (Mathon and Lloyd 2001). In tumour cells the senescence and crisis barriers are avoided by the activation of telomerase regenerating the telomeres and by the inactivation of tumour suppressor and pro-apoptotic genes (Hanahan and Weinberg 2000; Hahn and Weinberg 2000b). 1.3.2 Apoptosis. The sensors detect the intra- and extra-cellular signals. The intracellular signals include DNA damage, hypoxia and oncogene overexpression (Evan and Littlewood 1998). The extracellular signals monitor the cell-cell and cell-matrix homeostasis (Aoshiba et al. 1997; Prince et al. 2002; Alberts et al. 2002a). The signals detected by the sensor are mainly conveyed to the mitochondria, where a series of cytoplasmatic proteins of the Bcl2 family control the release of cytochrome C from the mitochondria (Alberts et al. 2002a). The release of cytochrome C activates an array of intracellular proteases called caspases causing protein and DNA degradation (Hanahan and Weinberg 2000). The caspases can be directly activated by extracellular proteins such as FAS ligand, which binds to the death receptor FAS (Houston and O’ Connell 2004). Once the caspase cascade is triggered it cannot be inactivated (Alberts et al. 2002a). It has been reported that the tumour suppressor p53 can trigger the caspase cascade by the overexpression of the Bax protein, a member of the Bcl2 family, which in turn increases cytochrome C release thus inducing apoptosis (Hanahan and Weinberg 2000). In CTVT it is likely that expression of c-myc is up-regulated, due to insertion of a LINE-1 element as discussed later. Ectopic c-mycexpression can promote tumour growth and survival, as seen, for instance, in immunoglobulin gene c-myc chromosome rearrangements in Burkitt's lymphoma (Hemann et al. 2005). 1.3.3. Independence from growth stimulation Growth factors Thus the proliferation of a cell is dictated by the needs of the cells around it (Hanahan and Weinberg 2000). In contrast, a tumour cell escapes from the external dependence to become an autonomous evolving unit, by producing its own growth signals. Growth factor receptors Another mechanism selected by tumour cells is the overexpressions of growth factor receptors, which induce the tumour cells to become sensitive to concentrations of growth factor that normally, do not trigger proliferation (Hanahan and Weinberg 2000). Proliferation can also be induced by a mechanism independent of the growth factor, for example the alteration of the cytoplasmic tail of growth factor receptor causes self-activation of the receptor, which therefore becomes independent from the external microenvironment (Alberts et al 2002b). 1.3.4 Resistance of growth inhibition Like growth signals, the anti-proliferative signals derive from soluble factors or surface proteins that are produced by neighbouring cells, or are induced by components of the extracellular matrix (Hanahan and Weinberg 2000; Alberts et al. 2002d). These external inhibitory signals activate different intracellular pathways that regulate the cell cycle (Alberts et al. 2002c). The Rb protein and its related proteins, p107 and p130 play a key role in controlling this transition (Weinberg 1995). The association of Rb with the transcription factor E2F inhibits the transcription of genes involved in the G1-S progression (Alberts et al. 2002c). The hyper-phosphorylation of the Rb protein induces the dissociation with E2F, therefore allowing progression to S phase (Alberts et al. 2002c). Normally complexes of cyclin and cyclin dependent kinase (CDK) induce the phosphorylation of the Rb protein (Alberts et al. 2002c). Many tumours can avoid the antigrowth signals by altering Rb activity or the proteins involved in Rb phosphorylation (Mittnacht 2005). 1.3.5 Angiogenesis Although the majority of the new vessels in adult tissues are derived by sprouting from existing vessels, many evidences indicate that progenitor endothelial cells are derived from the bone morrow contributing to the vessel growth (Zhang et al. 2000; Contreras et al. 2003; Nishimura and Asahara 2005; Religa et al. 2005). Although endothelial cells are highly proliferative in response to several angiogenic factors, they have long half-lives up to several years (Carmeliet 2003). In order to adapt the vascular system to the tissue's requirements, several mechanisms regulate the process of angiogenesis (Carmeliet 2003). A key molecule involved in the angiogenesis process is the vascular endothelial growth factor (VEGF) (Carmeliet 2003). In addition it has been demonstrated that tumours can activate or inactivate pro- and anti-angiogenic factors respectively present in the extracellular matrix by producing several proteases (Gately et al. 1997; Harlozinska 2005). 1.3.6 Metastasis In cancer during tumour progression, some tumour cells acquire the ability to migrate and form new colonies at secondary sites and these cells then make new tumour cells (Hanahan and Weinberg 2000). It has been estimated that 90 % of mortality associated with cancer is due to metastasis (Sporn 1996). Results show that few cells in the primary tumour acquire the ability to grow in the secondary sites and that the tendency to metastasise is acquired in the early steps of tumour progression (Van’t Veer and Weigelt 2003). Progressive alteration of normal tissue homeostasis by tumour and stromal cells, allow tumour cells to move throughout degraded matrix, and to invade surrounding tissues (Hanahan and Weinberg 2000). Tumour cells are also aided to migrate by soluble factors (chemotaxis) and bound adhesion molecules (haptotaxis) (Nguyen 2004). In order to invade new organs, circulating tumour cells need to stop and exit the systemic circulation. In an unspecific manner, the extravasation may be due to the fact that large arteries progressively narrow in to arterioles and then capillaries and tumour cells can be trapped in this small vessel, thus allowing the migration in the new organ (Nguyen 2004). Although the exact mechanism behind the tumour homing is not completely understood, recent results suggest that the selective homing of cancer cells may be due to three mechanisms: 1) presence in the target tissue of specific growth factors or appropriate extra-cellular matrix that favour the selective tumour growth, 2) presence in the target organ vessel endothelium of specific adhesive proteins that interact with the tumour cells, favouring the tumour invasion, 3) production of a chemotaxis soluble factor by the target tissue that attract the tumour cells ( Fidler 2003). 1.3.7 Genetic instability Over the past 25 years numerous genetic alterations have been described in human and animal tumours. These genetic alterations can affect the DNA sequence and the chromosomes (Lengauer et al. 1998). The mutations of DNA include: substitution, deletion, translocation and insertion and they can affect one or more nucleotides. The necessity to transmit genetic information faithfully between generations demands genetic stability (Eisen and Hanawalt 1999) In normal conditions the genome is affected by spontaneous mutations caused by physiological DNA instability and by imprecision of the DNA polymerase proofreading activity during the DNA replication (Alberts et al. 2002e). In eukaryotic cells, several enzymes have been described with DNA polymerization activity, and five are the most important DNA polymerases involved in DNA replication and repair, alpha, beta, gamma delta and epsilon. To date the only polymerase involved in mitochondrial DNA replication is polymerase gamma. In vitro studies on the fidelity of DNA duplication has shown that the nucleotide mis incorporation rate varies among polymerases, with one in 5000 bases for beta and one in 10 000 000 for delta and epsilon polymerases (Umar and Kunkel 1996; Loeb and Loab 2000). To avoid non-complementary nucleotide incorporation, polymerase delta, gamma and epsilon contain a proofreading activity (Kunkel and Alexander 1986). Normally DNA replication is carried out by delta polymerase, but recent reports show that in some tumours this priority is shifted in favour of less accurate polymerases, thus increasing the mutation rate (Loeb and Loeb 2000). Environmental agents such as ultraviolet light, ionizing radiations and toxic substances in the dietary uptake can induce mutations (Loeb and Loeb 2000). 1.3.7a Single Base Excision Repair When a mutation effects on a single nucleotide then base excision repair take place. BER employs enzymes called DNA glycosylases, which are specific in removing a specific mutated base (Krokan et al 2000). 1.3.7b Nucleotide excision repair The nucleotide excision repair (NER) system is able to repair DNA damage induced by UV. In contrast to BER, the NER system recognizes altered nucleotides by scanning the DNA for a conformational alteration (bulky lesion) (Wood 1996). 1.3.7c Mismatch repair The mismatch repair (MMR) pathway includes a series of proteins that are involved in correcting errors that escape the DNA polymerase proofreading activity during DNA replication. They are also involved in suppressing recombination between non-identical sequences both in mitosis and meiosis (Kolodner and Marsischky 1999). Unlike BER and NER, MMR does not act on damaged or mutated sequences, but it targets only the newly synthesized DNA strand. Inactivation of the MMR system produces microsatellite instability (MSI) (Atkin 2001). 1.3.7d. Homologous recombination Homologous recombination repairs double strand breaks by using an intact and homologous DNA molecule as a template. In eukaryotes several proteins are involved in the homologous recombination process (Kanaar et al. 1998; Haber 2000). 1.3.7e. Non-Homologous End Joining Non-Homologous End Joining (NHEJ) is the more important repairing mechanism when there is break in DNA double strand and it is very important mechanism in mammals (Khanna and Jackson 2001). During the NHEJ process small deletions are generated. Given that majority of the mammalians genome is composed of non-coding regions, the probability that in normal situations the NHEJ process induces mutation in genes is low (Alberts et al 2002e). However, if there are multiple break points NHEJ increases the occurrence of illegitimate recombination (Rothkamm et al 2001). 1.3.7f Chromosome Instability (CIN) The cell reproduces by a series of events that allow DNA replication and cell division in a process known as the cell cycle. In order to check the correct order of events that take place in the cell cycle, a complex cell-cycle control system has evolved (Alberts et al 2002c). This system checks normal cell cycle progression by a series of stage-specific sensors known as checkpoints that are able to induce the arrest of the uncompleted stage until it is completed. The two fundamental processes in the cell cycle are the duplication and the division of the chromosomes, which take place during the Synthesis (S) and Mitosis (M) phase respectively. To prevent the possibility that two daughter cells have non-identical genomes, there are two checkpoints known as DNA replication and DNA damage checkpoints before mitosis, and one known as spindle-attachment checkpoint during mitosis (Alberts et al 2002c). Chromosome instability (CIN) is also associated with structural alteration of chromosomes, which include reciprocal and non-reciprocal translocations, amplifications, deletions and insertions (Cairns 2005). Structural chromosome instability, resulting from DNA breaks and rearrangements, is due to alteration of cell cycle checkpoints, DNA damage response and telomere integrity (Gollin 2005). Structural alterations may results in altered gene expression or produce fusion or chimeric proteins with dysregulated or new properties (Greaves and Wiemels 2003). Studies have shown that a large proportion of human tumours with chromosome instability have a high rate of loss of heterozygosity (Rajagopalan and Lengauer 2004). Therefore it has been argued that chromosome instability could accelerate the rate of inactivation or activation of tumour suppressor genes or oncogenes respectively (Rajagopalan and engauer 2004). CIN-associated genes can be classified on the basis of the mutations (Michor et al. 2005). Class I genes of CIN, e.g Mitotic Arrest Deficient gene (MAD-2 ) boost up CIN in case one allele is mutated or deleted. Class II genes of CIN e.g. Human Budding Uninhibited by Benzimidazoles (hBUB-1) gene boost up CIN if mutation is in one allele in a dominant negative fashion. Both Class I and Class II genes are required at the spindle assembly checkpoint (Amon 1999; Hoyt 2001). Class III genes of CIN e.g. Breast cancer gene BRCA1 and another Breast cancer gene BRCA2 boost up CIN if both alleles are mutated. BRCA genes have very important role at checkpoint and it is involved in DNA repairing and recombination (Yarden et al. 2002). 1.4 Evolutionary Dynamics of Tumour Development According to clonal evolution theory, cancer is the result of somatic mutations selected during tumour evolution (Nowell 1976). It has been argued that tumour cells cannot acquire the mutations needed for tumour progression at a physiological mutation rate, but that the tumour cell must acquire an increased mutation rate (Cairns 1998; Loeb and Loeb 2000). In order to induce cancer the mutations must affect a variety of genes that restrain somatic conflict (Frank and Nowak 2004). These genes are known as cancer related genes and can be subdivided in three categories: Gatekeeper, Caretaker, and Landscaper (Michor et al 2004). Gatekeeper mutations increase the cellular proliferation rate by the alteration of oncogenes, tumour suppressor genes and apoptotic genes (Michor et al 2004). Caretaker mutations increase genome instability by inactivating genes involved in maintaining genome integrity (Lengauer et al 1998). Landscaper mutations increase tumour proliferation by affecting genes involved in regulating the external cellular microenvironment (Bissel and Radisky 2001). While mutations affecting oncogenes behave in a dominant way, because only one mutated allele can induce a tumour phenotype, mutations affecting tumour suppressor genes can be neutral if the normal allele compensates the mutant allele, disadvantageous if the mutant allele triggers apoptosis, and advantageous if the mutated allele is inactivated and the second allele is insufficient to balance the wild type allele (Michor et al. 2004). In small compartments the inactivation of the two alleles of a tumour suppressor gene, is unlikely, unless the mutation rate is increased by genetic instability (Nowak et al. 2005). Loss of heterozygosity increases with chromosome instability (Michor et al. 2004). 1.5 Tumours of Feline and Canine included in this study 1.5.1Mammary Tumours Mammary gland tumours are most frequent in dogs (Moulton 1990) while in cats it is third in prevalence, after haemopoietic and skin tumours (Misdorp et al. 1999). The average age of peak prevalence of tumours in cats is approximately 9.3 years (Roccabianca et al. 2006). Mammary tumours can also affect male cats and dogs, with the average age for them being 12.8 years (Rutterman et al. 2000). Siamese has twice the risk in comparison to other breeds of cat (Weijer et al. 1972). Same predisposition was observed with our data, that all five cases collected in this study were belonging to Siamese breed. Mammary tumours are more prevalent in Pakistan and all the cats and dogs were between 5-11 years old. This suggests that there are more chances of mammary tumours in older cats and dogs. Mammary tumours included in this study were 23% all 22 tumours studied. 1.5.2 Canine Transmissible Venereal Tumours (CTVT) Canine transmissible venereal tumours first reported by Blaine in 1810 (Blaine, 1810) is a transmissible cancer in dogs. Studies found that CTVT was transmitted by transplantation of living cells (Novinski 1876), confirming it as a transmissible cancer. CTVT is of clonal origin, originating from a founder dog 11,000 years ago (Katzir et al. 1985; Murgia et al. 2006; Rebbeck et al. 2009; Murchison et al. 2014). It is one of only two transmissible cancers known (Murchison 2008) and is spread by allogeneic transfer of cells between dogs, usually during coitus. It manifests as a tumour, associated with the external genitalia of both male and female dogs, although tumours can also arise in the mouth, nose or skin. It is purported to be of histiocytic origin (Mozos et al. 1996; Mukaratirwa and Gruys 2003), and usually remains rather localised, except for rare cases of metastatic spread. Recorded cases of metastasis include involvement of the lymph nodes (Higgins 1966), skin (Dass 1986) and eye (Barron et al. 1963), among others. Experimental transplants of CTVT tumours into subcutaneous sites in experimental dogs are characterized by progressive and regressive phases. This is seen as a rapid volume increase, followed by tumour shrinkage, and eventually complete regression accompanied by serum-transferable immunity to reinfection (DeMonbreun 1934). In this project we collected 6 samples for BRCA1 and COX-2 studies in different tumours while 16 more samples for Department of Veterinary Medicine, University of Cambridge, UK. Although the prevalent rate of CTVT is in second number, many attentions were paid to collect CTVTs. For BRCA1 and COX-2 studies the 28% were CTVT out of 22 different tumours. 1.5.3 Perianal adenomas/Adenocarcinomas There are many glands present around the anus of dogs. These are sebaceous and non-secretary glands, while anal sac glands are positioned at 4 and 8 o clock to the anus and secrete their secretions into the lumen of theanal track (Yang Hai-Jie et al. 2008). Perianal adenomas are more frequent than adenocarcinomas (malignant form). In this study 3 tumours were collected which were 14% of total canine tumours collected. These tumours are mostly common in medium to older age dogs. 1.5.4 Granuloma Granuloma is also called as lick granuloma in dogs it is a type of skin cancer It typically results from the dog’s urge to lick the lower portion of one of her or his legs. This study reported 9% of total tumours included in this study. 1.5.5 Oral Tumours (Squamous cell Carcinoma) Oral tumours are 4th common cancers in canines. Male dogs have 2.4 times greater risk of developing oral tumours than female dogs (Dorn et al. 1968). This study reported 9% oral tumours in a period of 2 years. 1.5.6 Lymphoma Lymphoma is the second most prevalent intra –ocular tumours of dogs. Basic cause of lymphoma in dogs is unknown but genetic (chromosomal segregation), environmental and infectious factors such as retroviruses play vital role in developments of this cancer (Fighera et al. 2002). This study reported 9% Lymphomas of total collected tumours. 1.6 Rationale behind selection of genes 1.6.1 BRCA1 gene BRCA1 gene is tumour suppressor gene, it is involved in repairing the DNA double strands breaks and in case of failure it leads the cells towards apoptosis (Starita. 2003). BRCA1 forms BRCA1 Genome Surveillance Complex (BASC) when it combines with different types of tumour suppressor genes, DNA damage sensors and signal transducers (Wang et al. 2000). It is involved in Ubiqutination, transcription regulation (Friedenson 2007; Friedenson 2008). In humans BRCA1 was first identified at chromosome 17 (Hall et al. 1990) and it was isolated in 1994 (Miki et al. 1994). It is present at 17q21 with a length of 100 Kb. In canine it is located on chromosome 9. BRCA1 has 22 exons in canines and felines; it encodes a protein of 1882 amino acids in canine and 1871 amino acids in feline. Many scientists from different research showed that women who have famililal mutations in the BRCA1 or BRCA2 (BRCA1/2) genes have increased risk of breast cancer (Struewing et al. 1997). Fig 1: BRCA1 mechanism in DNA repairing. 1.6.2 Cyclooxygenase-2 Enzyme (Prostaglandins, COX-2). Cyclooxygenase-2 enzyme (Cox-2) is also called as Prostaglandins Endoperoxide synthase (PTGS). It is involved in the synthesis of prostaglandins which act as biological mediators in many body functions. It was first isolated from prostate gland that’s why it is called as Prostanglandin. Cyclooxygenase enzymes have two types, cyclooxygenas-1 and cyclooxygenase-2. Cyclooxygenase-1 is constitutively produced in the cell while cyclooxygenas-2 is inducible and it is constitutively produced only in kidneys, seminal vesicles and central nervous system. Its high expression has been recorded in many different types of tumours, it has been involved in anti-apoptosis, cell proliferation, tumour angiogenesis, cell invasion and immune suppression activities. In canine COX-2 is present on chromosome 7 having 604 amino acids and 10 axons. This correlation of cyclooxygenase-2 in cancer development suggests using new therapeutics against it. Studies have shown cycoloxygenase-2 high expression in number of different tumours (León-A 2008), such as intestinal, pancreatic, ovarian, prostatic, nasal cavity, oral cavity and mammary tumours of dogs (McEntee et al. 2002; Mohammed et al. 2004; Borzacchiello et al. 2007; Eplattenier et al. 2007; Mullins et al. 2004; Pireset al. 2010; Dore et al. 2003). Fig 2:COX-2 mechanism of action 1.6.3 DLADQA1 (MHCII gene) (Additional work performed at Department of Veterinary Medicine, University of Cambridge, UK). The Major Histocompatibility Complex (MHC) is a cell-surface protein mediating immune recognition through its interactions with T cells (Fig 3). There are three classes of MHC molecules in mammals - the classical MHC-I and II, and non-classical MHC-III Table 1). MHC-I interacts with CD8+ cytotoxic T cells, whilst MHC-II binds to CD4+ helper T cells. MHC molecules mediate antigen presentation to T cells. MHC-I typically presents self- peptides, whilst MHC-II presents foreign peptides. MHC molecules are extremely variable and polymorphic across the population, with a huge number of alleles at each MHC locus. This allows MHC molecules themselves to behave as antigens in transplant rejection, with the graft MHC peptide recognized as non-self by the recipient, and thus rejected. It would be expected that CTVT, an allergenic graft, should be rejected for two reasons: host MHC will present tumour antigens as foreign non-self to the host immune system, and tumour MHC will present a mismatch to the host immune system as a foreign antigen itself (Fig 3). This project focuses on the DLADQA1 locus (Wagner et al. 2002), a classical MHC-II gene on dog chromosome 12. There is high level of MHC allelic variability in any population (Niskanen et al. 2013). Fig 3:MHC is involved in graft rejection. This rejection (represented by the red arrow) occurs according to two principles. Firstly, host T cells may recognize the host MHC presenting a foreign peptide that should activate an immune response. Secondly, host T cells would also be able to recognize the tumour MHC presenting any peptide as foreign, since it is not self-MHC. It is thus surprising that CTVT is able to persist as an allogeneic graft. MHC expression was previously characterised molecularly by Murgia et al through RT-PCR of a MHC-I (DLA88) and MHC-II (DLADRB1) gene (Murgia et al. 2006). They found that there was downregulation of expression of both these MHC genes. DLA88 showed low levels of tumour-specific expression, whilst there was no detectable tumour expression of DLADRB1. Murgia et al. also performed MHC genotyping for a number of CTVT samples and confirmed that all CTVTs shared the same haplotype (Murgia et al. 2006). They identified two clusters at the DLADQA1 locus, with some CTVTs appearing to be haploid the locus, whilst others remained diploid. This is in contrast to evidence that suggests the DLADQA1 locus had undergone a copy-neutral loss of heterozygosity (LOH) (Murchison et al. 2014). 1.6.4 Technologies used in this research work. Different technologies are being used in cancer research such as PCR, flow cytometry, immunohistochemistry (IHC), in- situ hybridization (FISH, CSH) and microarray for diagnosis (Pawanet al. 2010). Here, I used Real time PCR for gene expressional analysis of BRCA1 and COX-2 and DLADQA1 (MHCII). Histopathology (Hematoxyline and Eosin staining) was performed for the diagnosis of tumours. CTVT diagnostics qPCR was also performed to measure the allele’s quantity of LINE-myc gene and CDKN2A gene. Conventional PCR measures at End-Point, while Real-Time PCR collects data during the PCR shows the data and quality of data during exponential growth phase also it has increase dynamic range of detection, it is very sensitive and no need for post PCR processing. Immunohistochemistry was performed to find out the expression of MHCII antigens in CTVTs. The serum protein electrophoresis and serum biochemistry was also measured. Western blotting was performed to detect antibodies in CTVTs (protein expression). It is a very good technique to measure the gene expression at protein level in fluidic material of cells. We performed capillary electrophoresis to find the mutations/SNPs in our genes of interest (BRCA1, COX-2 and DLADQA1). Genetic analyzer was used to find the sequence variations in our genes of interests. Other methods used for sequence variation studies, like SSCP, DGCG and HPLC miss the mutations (Rassi 2009). So the sequencing by capillary electrophoresis was the best option for this study. Availability: Items available for loan: UVAS Library [Call number: 2250-T] (1). Place hold
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice

by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr. SUMMARY 132 Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited SUMMARY 133 elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1). Place hold
Factors Affecting Biomass Producation Of Baby Hamster Kidney Cell Line In Roller Bottle Culture System For The Production of Foot and Mouth Diseas Virus

by Qaiser Akram | Prof. Dr. Khushi Muhammad | Prof. Dr. Masood Rabbani.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2012Dissertation note: Foot and Mouth Disease (FMD) is endemic in Pakistan and killed virus vaccines against prevalent serotypes are used for the control of disease. Baby Hamster Kidney (BHK-21) cells as monolayer culture are routinely used for the propagation of FMD viruses. Various nutritional factors: amount of growth medium and serum concentration as well as physical conditions: seeding density, rolling speed, growth time, and incubation temperature for the propagation of BHK-21 cells on roller culture bottles were optimized. The roller culture bottles having surface area of 480 cm2 were used for the propagation of cells. Feeding of cells with 100 ml of growth medium per bottle and supplementation of 5% serum supported the growth of the cells in optimum way. Seeding of ten million cells per bottle resulted into the development of complete monolayer with maximum cell density within 48 hours. The cultured cells remained confluent up to 60 hours while a rapid decline in the number of harvested cells was recorded after 72 hours of incubation. Growth rate of the cells was slower at 33° C that increases at 35° C, reaching to its maximum at 37° C while cells could not tolerate the temperature of 39° C. The bottles kept at rolling speed of 3 rpm yielded maximum amount of cells while higher or lower rotation speed negatively affected the cell proliferation. Antibody response of buffalo calves to different levels of FMD virus immunogen in trivalent vaccine was investigated. The vaccine containing 106.2 units of immunogen/TCID50 of each of the three serotypes of FMD virus induced log2(1.3± 0.4) units of anti-FMD "O" Complement Fixing Cumulative Geometric Mean antibody (FMD"O" CFT-CGM) titer, log2(1.4±0.3) units of anti-FMD"A" CFT-CGM titer and log2(2.0±0.7) units of anti-FMD"Asia-1" CFT-CGM titer. The vaccine containing 2x106.2 units of immunogen of each of the three serotypes of FMD virus induced log2(2.2±0.2) units of anti- FMD"O" CFT-CGM titer, log2(2.1±0.25) units of anti- FMD"A" CFT-CGM titer and log2(3.4±0.8) units of anti-FMD"Asia-1" CFT-CGM titer. The vaccine containing 3x106.2 units of TCID50 of each of the three serotypes of FMD virus induced log2 (5.3 ± 2.0) units of anti-FMD"O" CFT-CGM titer, log2 (4.6±1.9) units of anti-FMD"A" CFT-CGM titer and log2 (5.0±2.2) units of anti- FMD"Asia-1" CFT-CGM titer. The vaccine containing 4 x 106.2 units of TCID50 of each of the three serotypes of FMD virus induced log2(5.5±1.5) units of anti-FMD"O" CFT-CGM titer, log2(4.4±1.9) units of anti-FMD"A" CFT-CGM titer and log2(5.2±1.9) units of anti-FMD"Asia-1" CFT-CGM titer. Moreover, buffalo calves (n=3) which were primed and boosted with 60 days interval using vaccine containing 2x106.2units of immunogen of each serotype of FMD virus, showed log25.0 and log26.3 units of anti FMD"O"-CFT-GMT antibody titer, log24.6 and log2 6.0 units of anti FMD"A"-CFT GMT antibody titer, log25.6 and log26.0 units of anti FMD"Asia-1"-CFT GMT antibody titer, on 30 and 120 days post boosting. Each serotype of the virus grew well on BHK-21 cell line. The virus showed poor TCID50 (log 103.2±0.2) in BHK-21 cells having Glasgow Minimal Essential Medium (GMEM) without Fetal Calf Serum (FCS). Addition of FCS in the medium at the rate of one percent increased log 107.1±0.2 units of virus TCID50. Incubation temperature of 350 C and 370 C supported the multiplication and maintenance of BHK-21 cells and yielded log106.6±0.1 and log107.0±0.2units of virus TCID50, respectively. Each serotype of FMD virus showed log106.29±0.07 units of virus TCID50 in the stationary monolayer of BHK-21 cells in Roux flask (75cm2), log107.66± 0.02 units of virus TCID50 in roller bottles (490 cm2) and log108.34 ± 0.07 units of virus TCID50 on 0.2 g of micro-carriers suspending in 200 ml of the growth medium in stirring bottle. The infectivity titer/TCID50 of each of the virus serotypes was significantly higher in roller bottles than that achieved in Roux flasks (p<0.05) and was significantly higher in stirring bottle containing micro-carriers suspending in the growth medium than that of harvested in roller bottle (p<0.05). It is concluded that the infectivity titer of the virus is directly proportional to number of BHK-21 cells in the culture system. Availability: Items available for loan: UVAS Library [Call number: 1554,T] (1). Place hold
Feeding Management For Optimum Growth, Reproduction And First Lactation Performance In Sahiwal Heifers

by Muhammad Fiaz | Prof. Dr. Muhammad Abdulla | Prof. Dr.Masroor Elahi Babar.

Material type: book Book; Format: print Publisher: 2010Dissertation note: Sahiwal is well known dairy cattle breed in the tropical and subtropical regions of world for its excellent heat and tick resistance. The value of adequate nutrition and management of replacement heifers is mostly overlooked and production losses linked with slow growth rate are not entirely realized. Efficient utilization of nutrients like energy during pre pubertal and gestation periods is needful for melioration. The study included two experiments. The aim in first experiment was to investigate the effect of varying dietary energy levels on pre pubertal growth and age at puberty in Sahiwal heifers. Twenty Sahiwal heifers (Age = 12 ± 2 month and avg. wt = 125 kg) were assigned to four dietary treatments having five animals on each treatment. Isonitrogenous (CP=13.7%) diets having varying energy levels, viz; A=100% (Control), B=88%, C=112% and D=124% of NRC recommended level for small breed non bred heifers were fed to the respective groups until onset of puberty. Dry matter and protein intakes were not influenced by varying dietary energy levels during pre pubertal period. However, metabolizable energy (ME) 124% of NRC recommendation enhanced average daily gain (ADG) up to 571±15 g/d which was higher than all other dietary energy levels, whereas it was similar between ME 100% and ME 112% (442±11 and 450±05 g/d, respectively) but lower in ME 88% (397±07 g/d). The improvement in ADG of heifers fed ME 124% of NRC might be attributed to availability of excess energy nutrient for heifers to fulfill not only maintenance requirements but also to grow and develop body reserves. Provision of extra dietary energy improved efficiency of diets which might be attributed to availability of surplus dietary energy enabling heifers to convert feed into live body mass more efficiently. The 13 to 18 months of age was found optimum time period to have significantly highest ADG in Sahiwal heifers. This might be attributed to propitious physiological conditions under which heifers grow at faster rate. The optimum increase in body structures (Body length, height and heart girth) was achieved in ME 124% of NRC recommendations. The phase from 13 to 18 months of age was found optimum possessing significantly highest values of increase in body length and heart girth, whereas phase from 19 months to age at puberty was optimum to achieve significantly highest body height. The optimum increase in heart girth during first two phases (13 to 19 months of age) might be attributed to relatively faster muscle growth in body than bone growth. The digestibility percentages of nutrients (DM, CP, NDF and ADF) were not influenced by different dietary energy levels. No influence of dietary energy levels on digestibility of nutrients in the present study might be attributed to best adaptability of Sahiwal heifers to utilize diets even with low energy under local environment. Similarly, age at puberty was also not affected by dietary treatments and overall average was 833 ± 10 days. The optimum performance in terms of age at puberty at lower dietary energy level might be attributed to lesser energy requirements of Sahiwal under tropical and subtropical environment condition as elaborated by NRC (2000) that maintenance energy requirements of Bos indicus breeds including Sahiwal are about 10% lower. The similar pattern of influence was observed in serum progesterone concentration. The average of progesterone detected during a month before puberty was 0.44±0.005 ng/mL and during a month after onset of puberty was 1.48 ± 0.03 ng/mL serums. The similar rogesterone concentration among dietary treatments might be attributed to similar age at puberty in Sahiwal heifers. It is concluded from results of first experiment that higher dietary energy level (ME 124% of NRC) enhanced growth parameters and feed efficiency but reproductive performance of Sahiwal heifers in terms of age at puberty was optimum even at lower dietary energy level (ME 88% of NRC recommended level) under local environment conditions of Pakistan. The aim in second experiment was to study the effect of feeding varying dietary energy levels during last trimester of pregnancy on 1st lactation performance in Sahiwal heifers. Five to six months pregnant Sahiwal heifers (n=16) were assigned four dietary treatments having four heifers on each treatment. Iso-nitrogenous (CP=14.1%) diets having varying energy levels, viz; A=100% (Control), B=88%, C=112% and D=124% percent of NRC recommended level for pregnant heifers were fed to the respective groups until calving. After calving, all heifers were fed a similar diet having CP (16.2%) and ME (1.72 Mcal/kg). Dry matter and CP intakes were similar across the dietary treatments. Pre calving ADG was not different among heifers fed ME 112 and ME 124% (486 ± 13 and 497 ± 05 g/d, respectively) but higher than other diets, whereas it was also higher (444 ± 07 g/d) in ME 100% than 397 ± 08 g/day in ME 88% of NRC recommendation. Feed efficiency was similar between ME 124 and ME 112% but higher than other diets, whereas ME 100% was also more efficient than ME 88% of NRC recommendation. The higher feed efficiency in higher dietary energy levels might be attributed to availability of surplus dietary energy enabling heifers to convert feed into live body mass more efficiently. Better body score through higher pre calving dietary energy level might be attributed to availability of energy for animal in surplus to its requirements of maintenance and pregnancy. Higher level of energy at this stage enabled pregnant heifers to develop extra body reserves needed in early lactation period to fulfill high demand of lactogenesis. The similar birth weight of newly born calves might be attributed to the factor that needs of conceptus (growth of fetus, fetal membranes, uterus and mammary glands) are accorded high priority by the homeorhetic controls it transmits to the dam. Extra energy levels beyond NRC recommendation during prepartum period were not advantageous to increase milk yield in 1st calf heifers. The performance of 1st calf heifers in terms of milk yield was only optimum through pre calving feeding according to NRC recommendations. The lesser milk yield in diets having higher energy levels than recommended by NRC might be attributed to more availability of mammary fat pad which may limit further parenchymal tissue development and consequently decrease milk yield during subsequent lactation. However, milk fat percentage increased as pre calving dietary energy level was increased, whereas milk protein, lactose and SNF percent among animals fed different experimental diets did not differ. It is concluded from results of second experiment that the optimal performance of pregnant Sahiwal heifers was achieved through provision of pre calving extra dietary energy (ME 112%) beyond the NRC recommendation but first lactation yield was found optimum in heifers fed diet having energy level as per recommendations of NRC. Availability: Items available for loan: UVAS Library [Call number: 1230,T] (1). Place hold
Fiber Levels Durig Different Physiological Stages In Nili Ravi Buffaloes

by Saeed Ahmed | Prof. Dr. Makhdoom Abdul Jabbar | Prof. Dr. Anjum Khalique | Prof. Dr. Khalid.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1779,T] (1). Place hold
Genetic And Evolutionary Characterization Of Pakistani Pigeons And Parrots Through Mitochondrial D-

by Sehrish firyal | Dr. Ali raza awan | Prof, Dr. Aftab | Prof, Dr. Tahir yaqub.

Material type: book Book; Format: print Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1873,T] (1). Place hold
Genetic Evaluation Of Teddy Goats In Pakistan

by Zulfiqar Hussan Kuthu | Prof. Dr. Khalid Javed | Prof. Dr. Masroor Ellahi Baber.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2012Dissertation note: Data available on 20455 kidding and performance records of 5545 Teddy goats and progeny of 406 sires maintained as separate flocks at three different locations i,e (I) Livestock Experiment Station Rakh Ghulaman, District Bakkhar (1983-2008) (II) Livestock Experiment Station, Rakh Khariewala District Layyah (1971-2008) and (III) Livestock Experiment Station Chak Katora, District Bahawalpur (1975-2008) Punjab, Pakistan were analyzed for documenting both genetic and environmental sources which influence growth and reproductive traits. Breeding values of sires and does were estimated and genetic and phenotypic trends for various performance traits were drawn. The data was analyzed using the GLM procedure (General Linear Models) of the Statistical Analysis Systems (SAS, 2004) to study the influence of environmental sources of variation on various growth and reproductive traits. The genetic parameter estimation was done using REML procedure fitting an Individual Animal Model. Estimates of breeding values for various performance traits were also calculated by using BLUP. For these purposes WOMBAT software was used. The Least squares means for Age at first service, Age at first kidding, Weight at first service, weight at first kidding, services per conception, service period, kidding interval, birth weight, weaning weight, weight at six months, weight at nine months, yearling weight, pre-weaning daily gain, post-weaning daily gain at six months, post-weaning daily gain at nine months and post-weaning daily gain at twelve months the least squares means were 245.65±0.73 days, 14.07±0.01 kg, 394.14±0.76 days, 18.06±0 kg, 1.24±0.004, 153.58±0.73 days, 327.53±1.12 days, 1.66±0.03 kg, 9.59±0.01 kg, 11.70±0.02 kg, 16.69±0.02 kg, 21.03±0.03 kg, 70.21±0.16 grams, 31.39±0.08 grams, 45.25±0.03 grams and 45.95±0.02 grams, respectively. The percentage of single births was 43 percent, while multiple births were 57 percent. The sex ratio was 51:49 males and females. Year, sex, flock, and type of birth were main sources of variation on all the growth traits. The influence of season of birth was significant on yearling weight; however its effect on weight at six and nine months was non-significant. A significant influence of (p<0.01) birth and weaning weight was noticed on weight at 6, 9, 12 months and on post-weaning daily gain at 6,9 and 12 months. A significant effect (p<0.01) of year, birth weight and weight at service were observed on age of does at first service, while the seasonal and flock effect on the trait was non-significant. The influential environmental sources of variation on weight of does at first service were year, season and age at first service(p<0.01). A significant effect (p<0.01) of year, season, type, age and weight at service on age and weight at first kidding was noticed. The influence of year of service, flock, age and weight at service on services per conception was significant (p<0.01); however, effect of season of service on the trait was non-significant. A highly significant effect (p<0.01) of year and season of service, services per conception and weight at service were observed on service period. A significant effect (p<0.01) of year and season on kidding interval was noticed. The effect of flock was non-significant on the trait, however, age and weight at kidding had a significant effect (p<0.05) on the service period and kidding interval. The heritability estimates for birth weight, weaning weight, weight at six, nine and twelve (yearling) months, pre-weaning daily gain, post-weaning daily gain at six, post-weaning daily gain at nine, post-weaning daily gain at nine, post-weaning daily gain at twelve months, age at first service, weight at first service, age at first kidding, weight at first kidding, services per conception, service period and kidding interval were 0.28±0.23, 0.23±0.32, 0.19±0.42, 0.09±0.01 and 0.12±0.01, 0.21±0.32, 0.17±0.42, 0.12±0.02, 0.15±0.01, 0.19±0.22, 0.21±0.01, 0.19±0.04, 0.20±0.04, 0.07±0.01, 0.06±0.05 and 0.05±0.03, respectively. The repeatability estimates for birth weight, weaning weight, services per conception, service period and kidding interval were 0.53±0.02, 0.38±0.01, 0.02±0.05, 0.01±0.04 and 0.05±0.03, respectively. The estimates of genetic, Phenotypic and environmental correlations between birth weight and other growth traits were; weaning weight 0.61, 0.20 and 0.19, with weight at six months 0.39, 0.24 and 0.23, with weight at nine months 0.25, 0.38 and 0.36, with yearling weight 0.29, -0.01 and -0.02 and with pre-weaning daily gain 0.55, 0.31 and 0.29, respectively, while corresponding values for correlations between weaning weight and other growth traits were; with weight at six months 0.29, 0.19 and 0.17, with weight at nine months 0.23, 0.27 and 0.25, with yearling weight 0.45, 0.29 and 0.27 and with pre-weaning daily gain 0.97, 0.68 and 0.65, respectively, while the corresponding values for these correlations between weight at six months and other growth traits were; with weight at nine months 0.71, 0.27 and 0.25 with yearling weight 0.64, 0.21 and 0.19 and with pre-weaning daily gain were 0.31, 0.33, 0.31, respectively. The values for these correlations between weight at nine months and other traits were; with yearling weight 0.79, 0.23 and 0.21, with pre-weaning daily gain 0.25, 0.39 and 0.37, with post-weaning daily gain at six months 0.72, 0.81 and 0.79, respectively, while the estimates of these three correlations between yearling weight and other traits were; with pre-weaning daily gain 0.47, 0.41 and 0.42 and with post-weaning daily gain at six months 0.65, 0.10 and 0.08, while the corresponding values between pre-weaning daily gain and other traits were; with post-weaning gain at six months were 0.34, 0.15 and 0.13, with post-weaning gain at nine months 0.22, 0.13 and 0.12 and with post-weaning daily gain at twelve months were 0.54, 0.17 and 0.14, respectively. The estimates of genetic, Phenotypic and environmental correlations between age at first serviceand other traits were; with weight at first service 0.22, 0.79 and 0.76, with age at first kidding 0.76, 0.97 and 0.91 and with weight at first kidding 0.34, 0.14 and 0.11, respectively, while the corresponding values for these correlations between weight at first service and other traits were; with age at first kidding 0.39, 0.81 and 0.80, with weight at first kidding 0.35, 0.22 and 0.21 and with weight at first kidding 0.82, 0.18 and 0.16, respectively. Analysis of pedigree records for coefficient of inbreeding revealed that number of animals being 4465 (42.61 percent) with an average inbreeding of 2.43 percent and the highest level being 46.48 percent. The number of non-inbred animals was 6014 (57.39%). Out of the total of 406 sires used 23 were found inbred having an average inbreeding coefficient of 3.125 percent. Most frequent value for this category of animals was zero. The highest number of animals 1531 (14.61 percent) had an inbreeding percentage between 0.1 to 3.125, while only 104 animals (0.99 percent) were found with inbreeding of more than 25 percent. Most of the growth traits were statistically better in non-inbreds as compared to inbreds except yearling weight and post-weaning weight gain at twelve months, in which the means of both the traits were similar in both the groups. Among reproductive traits, age at first serviceand kidding, services per conception, service period and kidding interval were also statistically better in non-inbreds as compared to inbreds, while weight at first service and kidding interval were similar in both the groups. The ranges for estimated breeding values for different traits were, birth weight (-0.18 to 0.08 kg), weaning weight (-0.61 to 0.40 kg), weight at six months (-0.27 to 0.11 kg), weight at nine months, (-0.07 to 0.09 kg), yearling weight (-0.12 to 0.18 kg), pre-weaning daily gain (-0.30 to 1.20 grams), post-weaning daily gain at 6 months (-0.74 to 1.27 grams), post-weaning daily gain at 9 months (-0.32 to 0.57 grams), post-weaning daily gain at 12 months (-1.08 to 1.57 grams), age at first service(-43.23 to 58.06 days), weight at first service (-0.55 to 1.07 kg), age at first kidding (-53.31 to 48.34 days), weight at first kidding (-1.19 to 3.50 kg), services per conception (-0.18 to 0.16), service period (-7.07 to 9.80 days) and kidding interval (-13.23 to 20.89 days), respectively. The genetic trend in both birth weight and weaning weight showed an increasing trend during the period of study, while the genetic trend in weight at six, nine and twelve (yearling) months had no significant trend and fluctuated in the vicinity of zero. It is envisaged from the present study that over the 34 years period selection remained ineffective to bring the desired changes and it will remain so if random use of breeding animals is practiced. The possible use of ineffective selection could be unavailability of efficient techniques for the evaluation of animals and incorrect performance recording etc. It is therefore, necessary to correct all these discrepancies by taking corrective measures as discussed above. The following corrective measures may be a first step towards a goal oriented breeding policy. 1. The animals kept mainly for producing meat, the single most important factor is reproductive rate, which contributes to the efficiency of production (Shelton 1978). The most striking feature of sheep and goat enterprise is the ability to breed, off-season. Teddy goat is a non-seasonal breeder as kidding was observed throughout year with 36%, 19%, 25% and 20% kiddings recorded during spring, summer, autumn and winter, respectively, therefore a controlled breeding programme being practiced at times (as was observed during the present study at all the three stations) should not be advocated in any form at all and the desirable trait of non-seasonality should be the main pillar of a meat goat enterprise. 2. Although a higher percentage of abortions (70%) was observed in summer months but the percentage of dead births and mortality was almost equally distributed throughout the year, which indicates that better management of the flock during extremes of weather will results in less abortions and reduced mortality. 3. The high percentage of multiple births (57%) as against single births (43%) in teddy goats found in present study has backing of several studies, which showed that although there was slow growth rate in multiple births, yet they performed better by producing more total weight of kid weaned. Therefore prolificacy becomes a very important reproductive criteria and therefore emphasis should be selection of those animals with higher percentage of multiple births. 4. Environmental effects on productive and reproductive traits were significant; therefore through better management there are ample chances of improvement in these traits. 5. Low to medium heritability was recorded in all the growth traits, which offers scope for genetic selection. 6. Selection of animals to be the parents of future flock must be based on EBVs of growth traits. 7. Reproductive performance in present study was more than satisfactory. Early maturity which has been the main characteristic of Teddy breed was better as compared to many other breeds of the tropics (Beetal, Kamori, Jamunapari and Sirohi). Teddy goats were efficient than other breeds of the region when the means of the other reproductive traits like services per conception, service period and kidding interval were taken into consideration, however, room for improvement is still there. 8. Inbreeding in present study showed some increasing trend during the last five years and the percentage of animals kept on increasing during the last decade, therefore to control inbreeding a breeding plan with introduction of new blood from time to time is of utmost importance. Availability: Items available for loan: UVAS Library [Call number: 1582,T] (1). Place hold
Genome-Wide Association Mapping To Approach The Candidate Gene Having Potential Role In Dairy Bull Fertility

by Asif Nadeem | Prof.Dr.Masroor Elahi Babar | Dr.Atif Hanif | Prof.Dr.Muhammad Abdullah.

Material type: book Book; Format: print Publisher: 2011Dissertation note: Reproductive efficiency is a most important determinant of dairy profitability. Fertility in the herd is absolutely critical for both male and female animals. Fertility studies in dairy cattle were directed toward the female side and very little importance has been placed on the influence of the service bull. In this study association mapping was carried out Cor fertility trait in Holstein dairy cattle bulls using high-throughput and a high-density SNi> genotyping array. Single nucleotide polymorphisms (SNPs) were associated with dair, cattle bull fertility. Associated SNPs were queried in the bovine genome. Seven SNPs were found within the genes and fourteen were within 10 kh o! a gene. Seven gl'nes. namely LEPRELl, MOBKL3, CD247, LRRC8J\, LRFN5, IT] I [J and [·.NTP[) J were seleeted as candidate genes. Resequencing and fine mapping of selected candidate genes were performed and identified SNPs were associated with dairy cattle hull fertility. This is the first GWA study for dairy bull fertility using the Illumina Bovine S~ P50 Bcadchip containing 54001 S Ps powered by I1lumina lnfinium-Il assay. Availability: Items available for loan: UVAS Library [Call number: 1354,T] (1). Place hold
Genotyping Of Echinococcus Granulosus And Its Comparative Prevalance In Camels And Human Beings

by Azam Ali | Prf.Dr. Azhar Maqbool | Dr.Kamran Ashraf | Faculty of Veterinary Sciences.

Material type: book Book; Format: print Publisher: 2008Dissertation note: Hydaiidosis is caused by metacestode of the dog worm Echinococcus granulosus. It is a serious problem br both Public health and livestock economy. Echinococcus granaiiosu.s has number of genetically distinct strains which are known to differ morphologically and epidemiologically. Out of 100 camels examined only 25 Samples of hydatid cysts were collected from different organs i.e. livers, kidneys, lungs and hearts from Lahore abattoirs. Fertility and viability of the cysts was observed microscopically. Genotyp ing of Echinococcus granulosus was performed through Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP). Seroprevalence of hydatidosis in 25 butchers working in abattoir was also determined by the use of Latex agglutination test (LAT) kit for detection ob hydatidosis. Considerable information is available about genetic variants of E. granulosus around the world. Ten genotypes of E. granulosus have been described, which exhibit a diversity of morphology, development, and host range, as contrmed by various studies. In the Mediterranean area, the CI or common sheep strain, G2, Camel strain G6, and the equine strain G4 have been found in Spain, Italy, Lebanon, and Syria To date, molecular studies using mainly DNA sequences have identitied G-6 strain of E. granulosus. This categorization follows very closely the patterns of strain variation emerging from biological and epiderniological traits. In this study we perform serum analysis of butchers to detect antibodies against Echinococcus so that the prevalence of Echinococcus can be checked; the data available indicated that 14% of butcher's population is infected with Echinococcus. In order to confirm the strain of Echinococcus in camels the PCR-RFLP analysis were performed. The data obtained was analysed and it was concluded that the G6 strain of Echinococciis is prevalent in camels in Pakistan. The results demonstrated that PCRRFLP analysis of samples of patients suspected for Echinococcus is a promising diagnostic method and also confirms the type of Echinococcus prevalent in that area and also enables an early direct detection of parasite DNA. This will help to curtail this drastic malady at an early stage and will help to devise the strategy to minimize the losses due to this disease. It is hoped that the findings of the present study will be helpful for further planning about the control of the disease and correlating the prevalence in camels and butchers from the zoonotic point of view. Availability: Items available for loan: UVAS Library [Call number: 1010,T] (1). Place hold
Hatching Performance Of Different Broiler Breeder Strains At Four Production Phases With Three Different Egg Weights

by Hafiz Muhammad Ishaq | Prof. Dr. Muhammad Akram | Dr.Abdul waheed sahota | Prof. Dr.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1940,T] (1). Place hold
Identification And Expression Analysis Of Genes Involved In Obsessive Compulsive Disorder In Pakistani Population

by Javeria (2008-VA-627) | Prof. Dr. Masroor Ellahi Babar | Dr. Muhammad Wasim | Prof. Dr. Muhammad Abdullah.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: The background of this study is that WHO reports that psychiatry disorders affect worldwide 0.8 to 2% population. Anxiety illnesses are a class of illness associated with unreasonable and disturbing sensation of fear and tension. There are several types of anxiety disorders, such as panic disorder, agoraphobia, specific phobia, social phobia, OCD. Obsessive-compulsive disorder is a chronic disabling condition. OCD is characterized by repetitive, intrusive thoughts, images, and impulses and by repetitive, ritualistic physical or mental acts performed to reduce the attendant anxiety. The severity of OCD depends on the amount obsessions and compulsions. The Yale-Brown Obsessive Compulsive Scale (Y-BOCS) is a reliable and consistent scoring system that can be used to categorize OCD. The major genes involve in OCD are SLC6A4, BDNF, SLC1A1 and COMT genes. The study was enrolled patients treated for OCD. Blood samples have been collected from the patients. DNA extracted from fresh blood. Primers were designed. Then DNA amplification have done by Bio-Rad thermal cycler. Then gel electrophoresis was done for PCR product quantification. PCR products precipitated and sequenced. SNPs were identified. Real-time quantitative RT-PCR was performed for each sample with TaqMan Universal PCR mastermix which showed down regulation of COMT gene in OCD patients in Pakistani population. The aim of this study was SNP identification in Pakistani Population in Obsessive Compulsive disorder and to analyze the gene expression of COMT gene involved in OCD in Pakistani Population. Availability: Items available for loan: UVAS Library [Call number: 2620-T] (1). Place hold
Identification And Genotyping Of Vp1 Genses Of Fmd Viruses

by Atia Bukhari | Prof. Dr. Irshad Hussain | Prof. Dr. Khushi Muhammad.

Material type: book Book; Format: print Publisher: 2009Dissertation note: Within two decades after its first report in 1954 from Pakistan, Foot and mouth disease has become endemic in the country and poses a serious threat to large as well as small ruminant population. Foot and Mouth Disease (FMD) is prevailing in cattle and buffaloes and is caused by either 0, A, Asia-i serotype of the FMD virus in Pakistan. The present study was undertaken to study the mutation rate of FMD virus and also molecular typing of the strains prevalent in Pakistan was done. A total of 60 samples from buffalo and cattle were collected from five districts of Punjab including Lahore, Faisalabad, Sialkot, Okara and Sheikhupura. Soon after extraction of their RNA, all of them were reverse transcribed and then subjected to amplification by using different sets of the primers including universal as well as serotype specific primers. Then their VPI portions were amplified by using VP1 specific primers. Among 60 samples, 48 were positive with universal primers. Other 12 samples were not amplified with these primers hence not processed. Among 48 FMD positive samples, 24 were positive with serotype 0 specific primers, 16 with serotype Asia-i and remaining 8 were positive with serotype A specific primers. After their amplification, the amplicons were run on the gel. These amplicons were extracted by using DNA extraction kit. After their purification, they were sent to Macrogen® (Seopl, Korea) and Centre of Excellence for Molecplar Biology, Pakistan (CEMB) for sequencing. Each amplicon was sequenced thrice and the consensus sequence was established eliminating sequencing errors. Sequence identity and multiple sequence alignment of molecular sequences (nucleotide and amino acids) were performed with Clustal W algorithm (Thompson et al., 1994). Neighbour joining trees were constructed by using MEGA version 4.0 (Kumar et al., 2004). Nucleotide distance matrices were computed by Kimura two parameter algorithm based on the total nucleotide substitutions and evolutionary trees for VP1 genes were constructed. For FMDV serotype '0' phylogenetic analysis, 14 VPI sequences from various field isolates were compared with some previously published Pakistani FMD 0 type VP1 specific sequences available with GeneBank and some recently published VP1 sequences reported by countries bordering with Pakistan including India, Iran and Afghanistan Similarly, 12 VP 1 sequences of FMDV serotype Asia-I isolates of this study were compared with previously published sequences and their phylogenetic relationship was established. However, the sequencing results of serotype A were inconclusive and were not included for phylogenetic analysis. Three sequences of three locally available FMD vaccines were also studied and compared with the outbreak strains. Polymerase chain reaction was optimized with respect to MgCI2, buffer pH, annealing temperature, primer concentration, template concentration, and Taq polymerase. A concentration of 2.5 mM of MgCl2 resulted in the best amplification of the target sequences (Figure 1). The buffer with pH 8.8 yielded the best results (Figure 2) Although, the suggested annealing temperatures for various primers (of various serotypes) ranged from 48 °C to 63 °C, however, a temperature of 56 °C was found to be the best with all sets of primers (Figure 3). The best intensity DNA bands were observed with 0.3 pM concentration of the primers (Figure 4). Moreover, the best cDNA template concentration giving optimum amplification was found to be 3.0 p1 per reaction (Figure 5). Lastly, a concentration of 0.5 U of Taq polymerase was not sufficient for amplification of cDNAs, however, 1.0 U of enzyme was found to yield better amplification (Figure 6). VP 1 DNA sequences of six previously published Pakistani FMD serotype 0 strains were analyzed phylogenetically with VP 1 DNA sequences of 14 isolates of the study. Serotype 0 isolates of this study distributed themselves into two distinct clusters (Figure 19). First cluster comprised of Sheikhupura 1 and 2, Muridkey 1, Raiwind 1, Nankana 1, Gujranwala 1 and Gujrat I isolates (Figures 19 and 20), whereas the second cluster included Depalpur 1, Sahiwal 1, Okara I, Multan 1, Toba 1, Faisalabad I and Pattoki 1 isolates (Figures 19 and 21). The first cluster was found to be associated with previously published Pakistani isolates of 2006 mostly. However, it also showed association with Afghanistan's isolates of 2004 (Figure 20). The second cluster seemed to be mostly related to previously published Pakistani isolates of 2003 (Figure 21). The overall grouping of the 14 sequences, when compared with each other, depicted a three clustered phylogram (Figure 22). Serotype 0 isolates from Depalpur, Sahiwal, Okara, Multan, Pattoki, Toba Tek Singh and Faisalabad grouped together into a clan and had more than 85% sequence similarity with each other. The second cluster consisted of isolates of Sheikhupura, Nankana, Raiwind and Muridkey. These sequences had more than 86% similarity with each other. The third cluster consisted of only two isolates which were 100 % similar to each other. However the third cluster had only 74 % sequence similarity to cluster I and 73 % sequence similarity when compared with cluster 2. When the phylogenetic relationships with previously reported isolates of Asia 1 was evaluated, FMD Asia I isolates of this study were found to be scattered into two distinct groups (Figure 16). Group one consisted of isolates of Lodhran, Toba and Hafizabad that were more closely related to Indian isolates sharing more than 98% identity with each other and more than 94 % sequence identity with isolates of Indian 2001 to 2004 (Table 5 and Figures 16 and 17). However, they shared more than 86% sequence similarity with Pakistani isolates of 2002-2005 (Table 5). Group two comprised of isolates of kasur, Lahore, Pakpattan, Okara, Faisalabad, Jhang, Rahim Yar Khan, Bahawalpur and multan alongwith vaccine A and B (Figure 16). The isolates of group 2 were found to be closely associated with previously published isolates of Pakistani and Afghani origin of year 2003 and 2004 (Figures 16 and 18). Collectively, they shared an overall 70% sequence identity with each other. However, isolates of Bahawalpur, Rahim Yar Khan and Multan shared more than 98% similarity with each other, a measurement of close relationship denoting a likely common origin as one clan or dade. Similarly, isolates of Pakpatan, Faisalabad, Okara, Kasur, and Lahore shared 88% sequence identity with each other and qualified as one clade. Although, overall amino acid sequence similarity of our isolates was not strikingly different from that of the published isolates, however, amino acid substitutions with dissimilar properties were found with a scattered pattern of distribution. For example, 15th amino acid residue which is hydrophilic in the previously published isolates had a substitution with a hydrophobic amino acid residue in our three isolates namely Sheikhupura 2, Muridkey I and Raiwind I (Figure 25). Similarly, 14th amino acid residue which is hydrophobic in nature was found to be replaced with a hydrophilic one in our last five isolates. Amino acid residue number 13 (Figure 25) had a substitution with a hydrophobic residue in some of our isolates etc. etc. It is interesting to note that such substitutions with amino acids having dissimilar properties have also been found, albeit at lower rate, in previously published sequences by many researchers (Figure 25). A comparison of the deduced amino acid sequences in the critical VP I region of FMD serotype Asia I revealed that most of this study isolates shared very high homology with sequences of Vaccine A. However, the sequences of isolates of Lodhran, Hafizabad and Toba did not match much with that of either vaccines, A or B (Figure 23). Sequences of Vaccine A had a "K" which seemed to be replaced by a "T" in the sequences of most of the isolates. Considering the properties of various amino acids, this change does not signify a major shift in the three dimensional picture of the protein as K is a lysine, a positively charged amino acid, whereas a T is threonine, a hydrophilic amino acid in nature. Next substitution in most of the isolates is a "P" for "A" in comparison to the vaccines. Again, it is not a significant change as both P and A share the same property, hydorphobicity. Similarly a K with an R can be substituted without much change in the overall shape of the protein molecule. Next amino acid substitution is a leucine instead of methionine. Again both are hydrophobic in nature; hence their impact on the overall picture is minute, if at all. However, glycine and arginine are two very different amino acids; the former is a hydrophobic amino acid whereas the latter is positively charged one. Such amino acid substitutions may have the potential to make a major impact in terms of the epitopic differences in the capsids of vaccinal and field viruses. A comparison of the deduced amino acids of FMD serotype 0 isolates also exhibited such changes with the vaccinal virus (Figure 24). Of the three hyper immune sera raised against three different vaccines in rabbits, only one vaccine induced a measureable immune response yielding good precipitation line against various FMD virus antigens. In summary, RT-PCR for diagnosis of serotypes A, 0 and Asia 1 of FMDV was optimized and could be used for prompt and precise diagnosis of FMD in the country. Although, RT-PCR data pertains to bovines in the current project, but PCR optimization parameters are equally applicable to FMDV infections in other FMD susceptible animal species such as sheep and goat. The combination of PCR and sequencing of the VP1 gene to detect and analyze FMDV in disease outbreaks is fast (less than 6 hours for PCR and about 24 hours for sequencing), and it can give an accurate immunologic characterization of the virus, thus providing a rational basis for choice of vaccine. In fact, the molecular epidemiology of field isolates is a powerful tool to monitor the circulation of viruses (Saiz et al., 1993). Secondly, various isolates of serotypes 0 and Asia 1 were sequenced along with some vaccinal strains. Sequence similarity tree analysis indicated that most of our isolates were closely related to previously reported Pakistani isolates and to those of neighboring countries such as India, Afghanistan and Iran. Additionally, amino acid sequence similarity data of major immunogenic site that forms 13G-13H loop in FMDV serotypes revealed that serotype Asia 1 vaccinal strain and Asia 1 isolates of this study possessed high degree of similarity suggesting a likely host immune response against the vaccine that may afford some protection against most field isolates of serotype Asia 1 type. Lastly, of three vaccines tested, only one was found to afford protection against field isolates of FMDV suggesting more work on vaccine issue in the country. Availability: Items available for loan: UVAS Library [Call number: 1179,T] (1). Place hold
Identification Of Molecular Markers In Bmp15 Gene Of Different Pakistan Sheep And Goat Breeds

by Ahmad Nawaz | Prof.Dr.Masroor Elahi Babar | Prof. Dr | Prof. Dr. Khalid Javed.

Material type: book Book; Format: print ; Nature of contents: biography Publisher: 2011Dissertation note: Genetics of prolificacy in sheep and goat emphasize the importance of main genes which have been made known to affect litter size and rate of ovulation through various mechanisms. Natural mutations in prolific sheep and goat breeds have shown that the transforming growth factor beta (TGF-?) super family ligands such as bone morphogenetic protein 15 is crucial for ovulation and as well as for increasing litter size. Keeping in view the importance of prolificacy in sheep and goat, a research project was planed to identify the polymorphism, its association with fecundity and uncovering the nucleotide picture of BMP15 fecundity gene in sheep and goat breeds of Pakistan. In the research finding, various polymorphism, insertion and deletion of nucleotides in goat and sheep breeds of Pakistan were identified and associated with fecundity and secondly, some novel polymorphism in Pakistani goat and sheep breeds were identified which are different from the goat and sheep breeds of the world. This is the first report of the whole nucleotide of BMP15 gene in the sheep. A lot of work has been reported on these genes but total nucleotide picture in the sheep is not reported. Sequences of Bmp15 gene from sheep and goat breeds of Pakistan has been submitted to the NCBI GenBank database libraries,USA under accession numbers JN655669, JN655670, JN655671 and JN655672. It will result in fast vertical expansion of small ruminants to increase the mutton production and uplift the socio economic condition of small ruminant's farmers in the country. Availability: Items available for loan: UVAS Library [Call number: 1421,T] (1). Place hold
Immune Response Of Buffaloes To Foot And Mouth Disease Virus Vaccine

by Munir Ahmad Tariq | Prof.Dr.Khushi Muhammad | Prof.Dr.Muhammad Akram Muneer | Faculty of Veterinary Sciences.

Material type: book Book; Format: print ; Nature of contents: biography; Literary form: Publisher: 2007Dissertation note: Foot and Mouth Disease (FMD) is a highly contagious infection of cloven-footed animals such as buffalo, cattle, sheep, goats and camels and FMD is characterized by high rise of temperature, salivation, smacking of mouth, vesicular lesion in the buccal cavity, inner flares, coronary band and interdigital spaces, memory glands etc. In Pakistan FMI) disease is caused by "0", "A" or "Asia-i" type of the virus of an Aphthovirus of Picornaviridae. The vaccinal serotypes of FMD virus were characterized as "A", "0" and "Asia-i" by virus neutralization test using imported mono-specific rabbit antiserum. Each of the serotypes multiplied rapidly on monolayer of Baby Hamster Kidney -21 (BHK-21) cells. The BHK-2 I cells were propagated in carrel and roux flasks in MEM 199 containing 10% fetal bovine serum. Heat treated goat serum was equally effective as growth promoter for BHK-21 cell line. The cells rapidly multiplied and formed a monolayer within 72 hours at 37 °C. The cells were harvested using trypsin (0.025%) without affecting the cell viability that was observed by cytometeric as well as by colorimetric assays. The cells were stored in cryogenic containers and revived successfully on 12 months post storage. The FMD virus isolate ("0", "A" and "Asia-i") grew well on the monolayer of BHK-21 cells and produced more than 106, and i04 units of the Tissue Culture Infective Dose-50 (TCID50) on 5th passage, respectively. Each of the virus serotypes was effectively inactivated using 0.12 % formaldehyde, or 0.004 M of Binary Etyhieneimine (BET). The inactivated virus suspension was admixed with either oil base, lanolin or aluminium hydroxide gel and homogenized to get stable vaccine preparation. The adjuvant containing vaccines induced detectable level anti-FMDV-VN antibodies titer in buffalo calves on 19 days post-priming. Oil and gel based FMD vaccines induced detectable geometic mean titer (GMT) of the anti-FMDV-CFT antibodies (2-3 and 7-8) on 19 days post vaccination, respectively. The oil and gel based vaccines induced 1: 64 and 1:80 GMT titer of the anti-FMDV-CFT antibodies on 128 and 64 days post-vaccination, respectively and the titer declined there after as 1: 9 and 1: 3.3 on 258 days post vaccination. From this study it can be concluded that oil based vaccine induces the antibody response in buffalo latter than that of gel adsorbed vaccine. Higher titers of the antibodies are retained for comparably longer period of time by oil based vaccines. Moreover, age of buffaloes, animal species and vaccine storage at 4 C exhibited undetectable effects on the antibody response to the vaccine. The study has indicated that vaccination programs against field infection of FMD in all the domestic cloven footed animal species could be effective way of immunoprophylaxis. Availability: Items available for loan: UVAS Library [Call number: 0973,T] (1). Place hold
Immuno Pathological Effects Of Neem (Azadirachta Indica) In Commercial Broiler Chickens

by Zahid Jawad | Prof. Dr. Muhammad Younus | Dr. Muti-ur-Rehman | Prof. Dr. Azhar.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2012Dissertation note: These experiments were conducted to study the effects of Azadirachta indica admixed in poultry feed on weight gain performance, haemtological values,immune modulations, and toxic effects in broiler chickens. A total number of 144 commercial broiler 1-day old chicks were reared in the experimental sheds of the Department of Pathology, University of Veterinary & Animal Sciences, Lahore, The birds were fed with balanced commercial feed and water ad libitum. The birds were divided into 3 groups; A, B and C having fourty eight chicks each. Birds of all groups were sub divided into four groups of each i.e. A1, A2, A3 and A4; B1, B2, B3 & B4 and C1, C2, C3 and C4, respectively. Each of the sub groups containd 12 birds. Sub groups A4, B4 and C4 were control group with no medication. The birds of groups A, B and C were fed with poultry feed containing dry powder of neem leaves @ 2 gm, 4 gm and 6gm per kg of feed respectively. The birds of groups A1, B1 and C1 were treated with the herb from day 0 to 42 of their life. The birds of groups A2, B2 and C2 were given the neem from day 14 to 42 of their life, whereas the birds of groups A3, B3 and C3 were treated with the herb from day 28 to 42 of their life. Difference between weekly weight gain in the birds of groups A1, B1 and C1 was non significant (P>0.05) however the difference between weight gain in the treated and control groups was significant (P<0.05). The birds treated with the herb from day 0 of their life showed more weight gain. There was no difference in the haematological indices between all of the treated groups and the control groups. The neem treated birds showed increased antibody titers against ND and IBD viruses as compared to control groups. The values of ALP and ASTshowed decreasing trend when the level of neem leaf meal was increased in the ration. Serum creatinine and serum uric acid values posed a slight declining trend in the neem fed birds. There was a decrease in serum cholesterol level in the neem treated bird groups, the higher the concentreation of the herb, the lower the cholesterol value. The organ body weight indices showed that there was no significant difference in liver, spleen and thymus weights among treated groups as well between treated and control groups. There was absence of prominent gross pathological lesions in liver, spleen, kidneys and thymus, however some treated groups showed mild hypertrophied liver and kidneys as did the organs of the birds in control groups. No histopathological changes except a few mild changes were observed in liver, spleen, kidneys and thymus in the birds of experimental groups. Availability: Items available for loan: UVAS Library [Call number: 1774,T] (1). Place hold
Immunobiological And Molecular Characterization Of Pasteurella Multocida From Buffaloes

by Muhammad Kamran | Prof. Dr. Mansur-ud-Din Ahmad | Dr. Aftab Ahmad Anjum | Prof. Dr. Azhar.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2012Dissertation note: Hemorrhagic septicemia is an acute bacterial disease of buffaloes and cattle caused by Pasteurella multocida. In the present study, 400 samples (200 from carriers and 200 from sick animals) from Sargodha division were collected. Among four districts of the division, 15 samples were positive by API Kit, 13 by conventional biochemical tests and eleven were found positive for P. multocida through serological and molecular characterization. Biochemical profile index obtained with API kits had lesser accuracy than conventional and serological profiles for the identification of P. multocida. Passive mouse protection test and AGPT were used for serological confirmation. Different molecular techniques like SDS-PAGE, PCR and RFLP were used to investigate variation at the molecular level in field and vaccinal strains. There were no significant variation between field isolates and vaccinal strain in sick animals and carriers, or in isolates of different districts. Five major and three minor polypeptide bands were observed by SDS-PAGE. Genetic relatedness among the isolates was assessed by cluster analysis using Fingerprint Analysis of Missing Data (FAMD) of 12 isolates. The12 isolates clustered into 5 groups namely I, II, III, IV and V. Group I and II consisted of only one isolate in each (8.33%) of the total designated BKC-01 (S5) and KBO-01 (S1), respectively. Group III composed of 2 isolates (16.67%) namely KBC-02 (S4) and MNO-01 (S2). Group IV had the highest numbers of isolates (50%) designated as KBC-02 (S3), MNO-01 (S6), BKO-02 (S7), MNC-02 (S8), SGO-02 (S9) and V. Only two isolates were typed in group V (16.67%) named as SGO-01 (S10) and BKO-01 (S11). The size of amplified gene was 460 bp. HindIII I endonuclease cleaved bacterial genome at four sites as compared to other four enzymes (DNase1, PstlI, EcorI and BamHI) change the writing of these enzymes which cleaved at two sites. The isolates were also subjected to ten routinely used antibiotics for sensitivity testing and found enrofloxacin as drug of choice with 90.91% sensitivity, followed by gentamycine, chloramphenicol, ciprofloxacine and norfloxacine (72.73%), ampicillin and amoxycillin (45.45%), amikacin (36.36%) and lowest to sulfadiazine and erythromycine (18.18%). Availability: Items available for loan: UVAS Library [Call number: 1767,T] (1). Place hold
Immunoprophylaxis Of Tick Infestation In Bovine

by Zakir Ali | Prof. Dr. Azhar Maqbool | Prof. Dr | Prof.Dr. Khushi Muhammad.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2010Dissertation note: A study to investigate prevalence of different genera of hard ticks was carried out in three districts of the Punjab province, Pakistan (Faisalabad, Jhang and Khanewal). Overall prevalence of Hyalomma species is the highest at 61 % as compared to other genera of hard ticks. In sex-wise distribution, it was found that female Hyalomma species were the highest at 85% followed by A mblyomma species at 81 %, whi Ie Rhipicephalus (Boophilus) species and Haemaphysalis species were at 77%. Infestation rate in cattle at 70% was higher as compared to buffaloes at 34%. In tick infestation level study, high infestation level in cattle at 59% was higher as compared to that of buffalo population at 18%. In cattle population, peR results showed the prevalence of T annulata in H anatolicum and Hidromedari ticks as 50% and 40% respectively. No theilerial organism was detected in Himarginatum, Rhipicephalus (Boophilus) annulatus and Amblyomma variegatum ticks. Three different types of vaccines were prepared from different organs of ticks i.e., salivary gland, intestine or whole ticks of the same species of Hyalomma and they were injected to rabbits. It was found that vaccine prepared by grinding whole tick produced the higher level of antibody as compared to two other vaccines. Each of the whole tick homogenate vaccine prepared from either of the species of Hyalomma, Rhipicephalus or Amblyomma and injected to rabbits. These vaccines produced antibody as well and cross reacted with each other showing each of the hard ticks were antigenically similar. Efforts were made to prepare oil based whole Hyalomma tick vaccine with three different antigen concentration 5.0 mg, 7.5mg and 10.0 mg and evaluated its potency in buffalo calves. It was found that the vaccine dose containing 5.0 mg antigen per dose did not produced detectable antibody in buffalo calves while the vaccine containing 7.5mg or more antigen produced detectable antibody. Moreover, we concluded that montanide based bard tick homogenate vaccine with more than 7.5mg protein per dose is effective in producing antibodies against tick infestation in the dairy animals. The antibody level in vaccinated buffaloes as well as invaccinated rabbits reached to peak level on day 45 post vaccination and started declining thereafter. Capacity of vaccine in controlling tick infestation was assessed in 12 cross-bred calves. It was found tbat rejection percentage in immunized group was higher as compared to control group. There was no difference of engorgement period between immunized and control group. Reproductive index in immunized group was lower as compared to control group. The efforts were made to grow midgut cells insect culture media after isolation them from Hyalomma Ticks.. The purpose of this experiment was to grow midgut cell and then use these cells as a source of was found that the vaccine dose containing 5.0 mg antigen per dose did not produced detectable antibody in buffalo calves while the vaccine containing 7.5mg or more antigen produced detectable antibody. Moreover, we concluded that montanide based bard tick homogenate vaccine with more than 7.5mg protein per dose is effective in producing antibodies against tick infestation in the dairy animals. The antibody level in vaccinated buffaloes as well as in vaccinated rabbits reached to peak level on day 45 post vaccination and started declining thereafter. Capacity of vaccine in controlling tick infestation was assessed in 12 cross-bred calves. It was found tbat rejection percentage in immunized group was higher as compared to control group. There was no difference of engorgement period between immunized and control group. Reproductive index in immunized group was lower as compared to control group. The efforts were made to grow midgut cells insect culture media after isolation them from Hyalomma Ticks.. The purpose of this experiment was to grow midgut cell and then use these cells as a source of contamination for the tick cell culture which are extrinsic as well extrinsic. The growth rate of these cells in our study was not optimal so the media was not splitted to get more cells. Availability: Items available for loan: UVAS Library [Call number: 1416,T] (1). Place hold
Implications Of Varying Electrolytes (Sodium Potassium And Chloride And Their Balance On Growth Performance and Physiologcal Responses of Broilers

by Mirza Muhammad Haroon | Prof.Dr.Talat Naseer Pasha | Dr. Saima | Prof. Dr. Muhammad | FAPT.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2010Dissertation note: A series of experiments were envisaged to evaluate the effect of supplementation of dietary electrolytes with applicability of dietary electrolyte balance by using different salts on growth and carcass responses, body physiological responses and litter condition of modern day broiler chickens under phase feeding system. Day-old straight-run Hubbard broiler chicks were randomly allocated to eight dietary treatments replicated four times in such a way that a floor space of 0.09 m2 was provided to each bird. Birds were housed in environmental control system. Continuous light was provided 24 hours for the first 3 day and thereafter a light pattern of 23L:ID was adopted for the entire experimental. In each experiment, a basal diet was formulated having lowest level of each electrolyte. In experiment 1, Na and DEB in the basal diet were maintained at 0.08% and 160 mEq/kg, respectively. This basal diet was then supplemented with sodium bicarbonate (NaHCO3) and disodium sulphate (Na2SO4) to maintain four levels of Na (0.17, 0.26, 0.35, and 0.44%) by fixing K and Cl with DEB 200, 240, 280 and 320 mEq/kg, respectively. In experiment 2, a basal diet was prepared to contain the lowest level of K and DEB i.e. 0.70% and 160 mEq/kg, respectively. This basal diet was supplemented with potassium sulphate (K2S04) and potassium carbonate (K2C04) by fixing Na and Cl. So, four levels of K (0.86, 1.02, 1.18, and 1.34%) were maintained in eight dietary treatments. In experiment 3, a basal diet was prepared to contain the lowest level of Cl and DEI3 i.e. 0.17% and 320 rnEq/kg, respectively. This basal diet was supplemented with ammonium chloride (NH4CI) or calcium chloride (CaCl2), so that, in each diet, we can have the increase of 40 mEq/kg DEB at 0.3 I, 0.45, 0.59 and 0.73% of Cl at DEB 280, 240, 200 and 160 mEq/kg, respectively, by fixing Na and K. At the end of each phase (pre-starter, starter, grower and finisher); data of feed intake, weight gain, feed to gain ratio, mortality, water intake, water intake-to-feed intake ratio and litter quality were collected and evaluated. At the end of each experiment, two birds were slaughtered for their carcass and body physiological responses. Blood was also collected from these same birds for blood pH. glucose and serum mineral analyses. For statistical analyses, four (4) levels of electrolyte were used with two (2) sources of salt in a factorial arrangement of 4 x 2 under completely randomized design using GLM. In experiment 1, highest weight gain and feed intake were found in birds consuming 0.17% (NaHCO3) and 0.44% (Na2SO4) dNa, respectively during d 1-10. However during d 11-20, weight gain and feed:gain were reduced with same levels of dNa. Maximum weight gain was found in diets containing 0.17 and 0.24% dNa during d 21-33 and 34-42, respectively. Improved FG was the result of diets containing 0.20% (NaHCO3) and 0.37% (Na2SO4) dNa during d 2 1-33. Linear rise in water intake was observed in birds with increasing dNa during d 1-42. Minimum litter dampness was seen at 0.37% (NaHCO3) and 0.2 1% (Na2SO4) during d 1-10. Minimum and maximum mortality were observed at 0.37% level of dNa in case of supplementation of NaHCO3 and Na2SO4, respectively. Significantly increased pH and kidney weight while reduced dressing percentage were observed by amount and salt of dNa. Increased breast, thigh and gizzard weights were observed with increasing sodium. Weights of pancreas, gall bladder, bursa, and lungs, and shank length were affected by interaction of amount and salt of dNa. In experiment 2, BWG (P0.03) and feed:gain (P0.05) was improved at 1.20% dK during 32 to 42 d of age. K2S04 supplemented diets increased feed intake during I to 10 d (P<0.05), water intake during 34 to 42 d (P0.04) and mortality during 1 to 42 d (PE0.02). Water intake was increased linearly with increasing dK when supplemented by K2C03 whereas this was decreased linearly with increasing dK with that of K2S04 during 11 to 20 d (P0.002). The K2S04 supplemented diets lowered the blood pH (P0.00l), dressing (P0.04), abdominal fat (P0.03) weights and shank length (P0.02). A significant salt x dK effect was observed where low levels of dK with K2C03 and high levels with K2504 exhibited lower litter moisture during all phases. Increasing concentration of serum cations was observed by increasing dK, by balancing of increasing serum HCO3 with decreasing Cl at the end of the experiment. In experiment 3, body weight gain and water consumption were optimized at 0.73%, and 0.73% (CaCI2) and 0.45% (NH4CI), respectively, during d 1-10. During d 2 1-33, maximum weight gain and feed intake were observed at 0.42%, and 0.63% (CaCI2) and 0.63% (NH4CI), respectively. Highest weight gain (0.60% dcl), feed intake (0.61% CaCI2 0.42% NH4CI) and mortality (0.73%) while improved feed:gain (FG; 0.38% dCl) were obtained by interaction effects of amount and source of dCl during d 34-42. Fl (0.60%), feed:gain (0.3 8%) and litter moisture (0.31% NH4CI; 0.35 CaCl2) was affected during I -42d by amount of dcl. Increased blood pH, serum glucose and dressing percentage were found by dCl and replacing CaCI, with NH4C1. Improved breast meat, thigh meat and shank length while reduced abdominal fat were observed by replacing salts (CaCI2 withNH4Cl). It is concluded that birds showed better growth performance and reduced mortality against high levels of dietary sodium in Na2SO4 than NaHCO3 supplemented diets, while significant rise in pH, breast and thigh meat yield while reduced dressing percentage were observed with increasing dietary sodium. The importance of high concentration of dK for better weight gain and feed efficiency was depicted in later stages of production. K2C03 increased survivability and dressing responses but both dK levels and salts played important role for water intake, litter condition, carcass characteristics and serum mineral concentration. Birds were also suggested to be more sensitive to amount and source of dC1 in later part of their life. Availability: Items available for loan: UVAS Library [Call number: 1212,T] (1). Place hold
Improving Nutritional Value And Acceptability Of Dairy Products With Lower Contents Of Saturated Fatty

by Muhammad Nadeem | Dr. Muhammad Ayaz | Dr. Imran Javed | Prof. Dr. Muhammad.

Material type: book Book; Format: print Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1742,T] (1). Place hold
Influence Of Early Weaning On Growth Performance, Plasma Metabolites And Rumen Fermentation Indices In Neonatal

by Muhammad Afzal Rashid | Prof. Dr. Talat Naseer Pasha | Prof. Dr. Makhdoom Abdul Jabbar.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2013Dissertation note: Rearing of young calves is a labor intensive and costly segment of livestock production. From birth to weaning, young calf undergoes a transition from monogastric to adult ruminant. The concept of weaning from milk at an early age is based on early development of functional rumen enabling calves to utilize low quality roughages. In current study, a series of experiments were conducted to refine the more effective weaning regime for buffalo calves and use of by-products of the ethanol production industry in early weaned cattle calves. Conventionally, buffalo calves are kept with the dam, allowed to suckle a little amount of milk along with seasonal green forages, and weaned around the age of one year. To date, limited published work was available on growth performance and economics of buffalo calves weaned from milk at an early age. Therefore, the experiment was conducted to reduce the weaning age and evaluate the growth performance of male Nili-Ravi buffalo calves. Twenty-four male buffalo calves were assigned to one of the three treatments: continuous milk feeding (CMF), limited milk feeding (LMF), and early weaning (EW). After colostrum feeding, calves were individually fed whole milk at 10% of their BW, adjusted weekly until 6 wk of age. Thereafter, milk allowance was gradually tapered to zero in CMF, LMF and EW treatments at 12, 10 and 8 wk of age, respectively. Calf starter feed was provided ad libitum from wk 2 through wk 12 and individual intakes were recorded daily. Blood sampling was carried out form wk 6 through 12, on a weekly basis. The BW and structural measurements (HG, WH, and HW) were carried out at the start of experiment and later on a weekly basis. In young buffalo calves, the regimen of weaning at 8 weeks of age was more effective. The early weaned calves showed similar growth rate to those in the CMF and LMF by consuming more calf starter and saving a substantial amount of high priced milk. On the basis of the results of this experiment, buffalo calves successfully adapted to early weaning that might help to mitigate issues like poor growth and low returns associated with traditional calf rearing practices. Furthermore, this study effectively reduced the weaning age from 1 year to 8 weeks of age. Hence, reducing weaning age did not affect the growth performance of Nili-Ravi buffalo calves by 12 weeks of age. Early development of the rumen is the main objective of a successful early weaning program which depends upon the amount of starter intake, VFA production, and ruminal papillae development. Studies have shown that grains in starter feed can be replaced by DDGS up to 28% of DM without compromising the growth performance and rumen development. Second experiment was planned to evaluate the effects of replacing grains and soybean with DDGS and ammonia treated DDGS at 25% of DM. Study was conducted in collaboration with dairy science department SDSU (USA). Twenty one neonatal male Holstein calves were assigned to one of the three of dietary treatments: C = 0% DDGS, DDGS = 25% DDGS, CAFEX-DDGS = 25% CAFEX treated DDGS. In a 10 week experiment, calves were fed 680 g MR through 4 week, reduced to half during wk 5, and weaned at the end of wk 5. Starter intakes were conducted daily; whereas, body weights, structural measurements were conducted at the start of experiment and then on a weekly basis. Jugular blood samples were taken on a weekly basis using EDTA and NaFl coated evacuated tubes. Rumen samples were collected from a subset of 15 calves (n=5 calves/ treatment) at wk 5, 7 and 10. At the end of experiment, four calves from each treatment were also slaughtered to determine rumen morphometric measurements (PL, PW, RWT and PC). Experiment illustrated that weight gain, structural measurements, total starter intake, DMI and feed efficiency were not affected by the inclusion of DDGS and CAFEX treated DDGS at 25% of DM in starter feeds. CAFEX treatment of DDGS improved the CP contents of DDGS from 29.5% to 40%; however, inclusion of CAFEX-DDGS in starter reduced feed intake during the pre-weaning period. Whereas, overall starter intake was higher in calves fed DDGS based starter feed indicating the effect of ammonia treatment on palatability. Lower pre-weaning starter intake, slow rumen fermentation of CAFEX-DDGS resulted in lesser BHBA concentration leading to lesser development of rumen papillae growth (PL and PW). However, there was a tendency for higher weight gain in calves fed DDGS based starter due to increase in starter intake. In the light of these results it is concluded CAFEX-DDGS can be included in starter feeds at 25% of DM without affecting the growth performance. However, further research is required to evaluate the digestibility of DDGS after CAFEX treatement. Similar, growth performance indicates that CAFEX-DDGS can replace the corn and soybean meal in starter feeds. In third experiment, microbial diversity in developing rumen and intestine of young calves fed DDGS and CAFEX treated DDGS at 25% of starter was investigated. Experiement was carried out at SDSU dairy research station (USA). Fifteen calves with n=5 per treatment, fed according to protocols described in Experiment II. Calves were sampled for rumen contents at wk 5, 7 and 10 of age; whereas, intestinal contents were collected at the time of slaughter. The DNA was extracted subjected to PCR-DGGE and dendogram was constructed using cluster analysis software. Results revealed that microbial population was highly different from each other at wk 10 indicating the effect of age and dietary treatment on rumen micro flora. Whereas, intestinal and rumen bacterial diversity at wk 5 and 7 of age was not affected by inclusion of DDGS and CAFEX-DDGS in starter feed. The changes in intestinal microflora of DDGS and CAFEX-DDGS fed calves compared with control group showed that the effect of dietary treatments on post-ruminal availability of nutrients and microbial proteins. In conclusion, rumen bacterial population changes with the advancing age and the type of ingredients used in the diet. Further, research is required to identify the effect of feeding DDGS on growth of particular bacteria like methanogen and their impact on methane production and feed efficiency. Availability: Items available for loan: UVAS Library [Call number: 1595,T] (1). Place hold
Isolation And Characterization Of Clostridium Perfringens From Domestic Animals An Man In Punjab

by Waheeda Raana | Prof. Dr. Muhammad Akram Muneer | Dr. Khushi Muhammad | Prof. Dr | Faculty of Veterinary Sciences.

Material type: book Book; Format: print Publisher: 2007Dissertation note: The objectives of present investigation were to isolate the Cl. perfringens from the domestic and zoo animals and human beings; characterize it through biotyping and pathogencity observation, and to develop a vaccine- from the common CI. perfringens isolate. For this purpose a total of 1240 samples of morbid tissues (faecal samples from animals and gangrenous tissues from humans). From cattle (n=180), goats (n=180), horses (n=250), camel (n=250), deer (n=28), wild beast (n=07), monkeys (n16), zebra (n10), elephant (n01), yaks (n=09), foxes (n07), jackals (n=08), baboons (n=08), and bears (n08) were collected and processed for isolation of CI. perfringens. In addition a total of 100 human cases; 83 wound swabs and 17 gas gangrene were also collected and analyzed bacteriologically. This study has indicated that Clostridium (Cl.) perfringens causes multiple clinical problems in animals and human beings as was indicated by good rate of its isolation from the examined morbid tissues and fecal samples. Of the total 1240 samples from various types of animals 297 (23.95%) indicated the presence of CI. perfringens. The overall isolation percentages of various types of CI. perfringens from the cattle, sheep goat, horses, camel, wild beast, deer, bear, jackal, zebra, monkeys, yak, elephant, baboon, foxes, and humans were 22.2, 12.2, 57.2, 8.0, 21.6, 57.1, 30.76, 37.50, 50.0, 50.0, 37.50, 33.33, 100.00 75.00, 57.14 and 18.00, respectively. Of the tested population of domestic animals, goats indicated the highest Cl. perfringens (57.2%) infection rate. In the zoo animal population, the elephant, baboons, wild beast, jackals, and foxes were shown to be heavily infected with various CI. perfringens types compared to other wild life animals species. Of the 298 isolates obtained through this investigation Cl. perfringens type D was obtained from 118 (39.7%) morbid samples of the domestic and zoo animals; CI. perfringens type A from 63 (21 .21%) samples, Cl. perfringens type B from 95 (31.98%) samples; and the CI. perfringens type E was isolated from 21(7.07%) samples. None of the samples indicated the presence of CI. perfringens type C. Of the total 100 samples from the humans, CI. perfringens type A was isolated from 14 (14%) and Cl. perfringens type D was isolated from 04 (4%). None of the human samples showed the presence of Cl. perfringens types B, C, or E. Of the 17 human gangrene tissue samples, Cl. perfringens type A was isolated from 09 (52.94%) samples and the Cl. perfringens type D was recovered from 02 (11 .76%) samples. However, all attempts to isolate Cl. perfringens types B, C or E from the human gangrene tissue/material samples were unsuccessful. The overall findings indicated that of the total 297 samples positive for various Cl. perfringens types 63 indicated the presence of Cl. perfringens type A. Of those 63 Cl. perfringens type A isolates, 49 were recovered from the animals; and 14 were isolated from the wound swabs and gangrene tissue material samples from humans. Of the 63 Cl. perfringens type A isolates from the animals, 5 were isolated from cattle; 3 from sheep, 20 from goats; 5 from the horses; 10 from camels, 01 from the deer; 01 from the zebra, 01 from baboon, 01 from fox, 01 from the monkey, and 01 isolate was recovered from yak. Of the 14 isolates of Cl. perfringens type A from humans, 05 were recovered from the open wound swabs, and 09 strains of the organism were isolated from the gangrenous tissue material. Of the 297 samples positive for various Cl. Perfringens types, 95 animal samples indicated the presence of Cl. perfringens type B. These 95 isolates were obtained from cattle (n=22), sheep (n=10), goats (n=30), horses (n=03), camel (n=14), deer (n03), wild beast (n=02), monkey (n=02), zebra (n=02), yak (n=01), fox (n01), jackals (n02), baboon (n02) and bear (n=02). None of the human samples was positive for Cl. perfringens type B. Isolation of C/. perfringens type B from the zoo animals is a matter of concern for the human health, as the zoo visitors have the possibility to get infected with this organism. Of the total 297 positive samples of faecal and morbid tissues from various types of animals and human being Cl. perfringens type D isolates were recovered from 118 (39.7%) samples. Of these 118 isolates of Cl. perfringens typeD, 114 were obtained from various types of animals, and 04 isolates were from the humans. Of the 114 animal isolates, 10 from the cattle, 5 from the sheep, 44 from the goats, 9 from the horses, 27 from the camel, 4 from the deer, 02 from the wild beast, 02 from the monkey, 02 from the zebra, 01 from the elephant, 01 from the yak, 02 from the fox, 02 from the jackals, 02 from the baboon, and 01 isolate the bear. A total of 04 CI. perfringens type D isolates were recovered from gangrenous tissue and open wound samples from human beings. During this investigation 21 isolates of CI. perfringens Type E were obtained from domestic and zoo animals. Of the 21 isolates, 03 were from cattle, 04 from sheep, 09 from goats and 03 from horses, 01 from monkey, and 01 from the baboon. All the 21 isolations were from the fecal material of above mentioned animals. None of the human samples was positive for CI. perfringens type E. Alpha toxin was produced by all of the 63 Cl. perfringens type A isolates. Within the toxin producing isolates, there was no difference in the quality of toxin in respect to its lethality for mice, dermonecrosis effects for guinea pigs and cytotoxicity in the HeLa cells. The 07 fecal isolates were hemolytic, lecithinase (+), and positive for all biochemical characteristics of Cl. perfringens. Those isolates were not lethal for mice, indicated no dermonecrotic activity in guinea pig, and produced mild degree of cytotoxicity in the cell cultures. The activity of beta toxin obtained from 95 isolates of CI. perfringens type B isolates was determined using standard toxin-antitoxin test carried in mice and the standard serum neutralization test with antitoxin raised in rabbits. Within the toxin producing isolates, no difference was seen in the potential of toxin based on its lethality for mice. Epsilon () toxin activity of the 114 isolates of CI. perfringens type D from animals and 4 of the human isolates was also determined. Of the 114 animal isolate, 110(96.49%), and all the 4 human isolates produced E-toxin. There was no difference in the lethal potential of toxin for mice, dermonecrotis action in guinea pig and production of CPE in VERO cells. Iota (i) toxin activity of the 21 isolates of Cl. perfringens type E was also determined serum neutralization test in mice. Many isolates produced more than one major toxin. Ci. perfringens (CP) type A produced Alpha (a) toxin; CP type B produced Alpha (a), Beta (3) and Epsilon (E) toxins; OP type D isolates produced Alpha (a) and Epsilon (E) toxins, and OP type E isolates produced Alpha (a) toxin + Iota (i) toxin. The immunobiologic studies of isolates showed that many of the isolates were quite antigenic. Isolates of CI. perfringèns type D and B were found highly immunogenic as those isolates producing SN titer of 1:320. Availability: Items available for loan: UVAS Library [Call number: 0998,T] (1). Place hold
Isolation And Characterization Of Phytase Producing Fungi For Poultry Feed

by Ali Ahmad (2002-VA-121) | Prof. Dr. Aftab Ahmad Anjum | Prof. Dr. Masood Rabbani | Prof. Dr. Kamran Ashraf.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: Isolation And Characterization Of Phytase Producing Fungi For Poultry Feed Availability: Items available for loan: UVAS Library [Call number: 2770-T] (1). Place hold
Isolation And Molecular Characterization Of Antimicrobial Resistant E-Coli Isolation From Retail Meats

by Ali Ahmed | Prof.Dr.Khushi Muhammad | Dr.Mueen Aslam | Prof.Dr.Masood.

Material type: book Book; Format: print ; Nature of contents: biography; Literary form: Publisher: 2010Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1252,T] (1). Place hold
Isolation And Molecular Characterization Of Rotavirus From Calf Diarrhea And Preparation Of Vaccine

by Nadia Mukhtar (2008-VA-718) | Prof. Dr. Tahir Yaqub | Dr. Jawad Nazir | Prof. Dr. Asim Aslam.

Material type: book Book; Literary form: not fiction Publisher: 2016Dissertation note: The main contribution of the thesis “Title” is threefold. First, rotavirus was isolated and identified from calf diarrhea samples from 10 districts in Punjab. Second, optimization of molecular diagnostics and genome sequencing was done of the positive bovine rotavirus isolates from Pakistan. And thirdly, the preparation as well as evaluation of killed vaccine against bovine rotavirus isolates was performed. The above three objectives of this study were created due to the distribution of rotavirus all over the world as an enteric pathogen in both human as well as animal species. In developing countries where cases of malnutrition are very common in young children and animals, this virus has a special importance as an etiologic agent. It causes severe diarrhea, when accompanied with severe dehydration, leads to high rate of mortality. Among the rest of the infectious diseases present in calves, neonatal diarrhea is a dire threat as it has a major impact on economic viability. Calf diarrhea is the most important problem in dairy calves that causes more financial losses to the calf producers than any other. Although numerous etiological agents may be implicated, Rotaviral diarrhea is one of the main infections causing calves to scour between five to fourteen days of age. The cattle and buffalo calves’ population in Pakistan is devastatingly affected by the neonatal calf diarrhea due to rotavirus outbreaks. Neonatal calf mortality varies from 8.7 to 64 per cent throughout the world accounting for 84 per cent of the total mortality in the first month of age and is particularly high in the third week. While vaccination is available for the disease, it is being imported in Pakistan from other countries. The importation of the said vaccine thus, leads SUMMARY 117 to extra expenses for the farm managers. As mentioned above one of the aims of this study is to develop an effective vaccine against bovine rotavirus and cut down expenses for farm managers. To fulfill the objectives proposed in this thesis, rectal swabs and fecal samples were collected from public/private sector buffalo and cattle farms from 10 districts of the Punjab: Lahore, Faisalabad, Okara, Sahiwal, Sargodha, Chakwal, Bhakkar, Bahawalnagar, Multan and Bahawalpur. The samples were selected on the basis of agro-ecological zones of the province. As sampling based on agro-ecological zones allow for better data collection for recording incidence rate of the disease. Samples (n=10) from each diarrheic and apparently healthy cattle and buffalo calves from all of the districts were collected. In this way a total of 200 samples from buffalo calves and 200 samples from cattle calves were collected for this study. Antigen of bovine rotavirus was screened from calf feces through Direct Sandwich ELISA. Bovine rotavirus samples were further confirmed through the amplification of the VP4 and VP6 genes through Rt-PCR. Homology and phylogenetic analysis of the sequenced samples was also performed. The data gathered through this analysis was helpful in collecting important data regarding the similarities as well as differences of the bovine rotavirus strain present in Pakistani isolates when compared to local regions as well as international ones. The data is also valuable when it comes to production of effective vaccines again rotavirus. RNA viruses are known to mutate unpredictably and it is safe to assume that a particular vaccine might not work effectively against all strains of a particular virus. That’s why analysis of data pertaining to all possible BRV strains is important for creation of an effective vaccine of import quality in order to help the economy of Pakistan. Rotavirus isolate, after adaptation on MDBK cell line, was further propagated to determine TCID50 for vaccine preparation purposes. Final dose of the vaccine was adjusted to SUMMARY 118 approximately 3ml, containing 40% culture and 60% adjuvant. Final vaccine contained 1ml of inactivated bovine rotavirus harvested culture, 1.8ml of Montanide ISA 70, 0.2ml of PBS and 0.05% of Thiomersal sodium. Efficacy of the vaccine was checked in rabbits. For vaccine efficacy testing twenty one month old rabbits were procured. Rabbits were reared in individual isolator units in the shed facility of Quality Operations Laboratory, UVAS, Lahore. The collected rabbits were divided into two groups, vaccinated and unvaccinated rabbit groups. Each group had 10 rabbits. One ml of rotavirus vaccine was administered intramuscularly in vaccinated rabbits group. In unvaccinated rabbits group 1ml of normal saline was injected intramuscularly. The second dose of vaccine was administered at 24 days post-vaccination of first dose. The rabbits from both groups were bled at 0, 14, 28 and 42 days post-vaccination. The antibody response of rabbits to rotavirus vaccine was determined through using Antibody detection kit. The rabbits were challenged on day 42 post-vaccination using live field strain of rotavirus having TCID50 1 × 108.5. The rabbits were observed daily up to 14 days post-vaccination for appearance of diarrheic signs. The stool samples of ELISA positive were further confirmed by reverse-transcriptase polymerase chain reaction (RT-PCR) at least 14 days post-vaccination. The field trials were conducted at Livestock Production Research Institute, (LPRI) Bahadurnagar, Okara. The field study was done to evaluate the prepared rotavirus vaccine for prevention of neonatal calf diarrhea. For this trial, 100 dams were selected. The dams were divided into two groups and each group consisted of 25 pregnant cows and 25 pregnant buffalos. A total of 50 dams (25 cattle and 25 buffalo) were vaccinated intramuscularly with 3ml of prepared inactivated rotavirus vaccine. The 50 remaining dams (25 cattle and 25 buffalo) were kept unvaccinated. SUMMARY 119 The blood samples were collected for serum separation after 0, 14, 28 and 42 days post vaccination in dams. The antibody titers were measured using antibody detection ELSIA kit. After calving, newborn calves were fed with the colostrum obtained from the vaccinated dams daily for 5 consecutive days. Similarly, the calves from unvaccinated dams were fed on colostrum from their unvaccinated dams. The 5 calves from vaccinated and 5 from the unvaccinated dams were isolated in individual isolators. These calves were challenged orally with 1ml of live field strain of rotavirus having 1 × 108.5 TCID50 and the animals were observed for diarrheic signs for 7 days. All of the collected data was subjected to statistical analysis of (one way) ANOVA and t-test using SPSS. The <0.05 p-value determined the significance of the results through this study. The data collected through this study allowed for the creation of valuable inferences. According to the current results of this study, the prevalence of bovine rotavirus was shown to be 6% in Punjab. This 6% included 40% and 20% from the districts of Lahore and Faisalabad respectively. Keeping these results in mind, it is to be noted that the recorded prevalence percentage from this study is higher than the prevalence of 2% in Lahore according to a previous study done in the country. It is to be noted that while the 6% prevalence of rotavirus in Punjab detected through ELISA is lower than the prevalence of 16.83% which was detected by ELISA in diarrheic calves from pervious researches, the 12% prevalence detected by ELISA in this research is higher than the prevalence of 7.25% detected by ELISA in diarrheic calves from past data. In the present study of this thesis it was observed that the use of killed vaccine for bovines produced more efficient immune response in calves. It also enhanced the clostral rotavirus antibody titers as compared to previous studies where the use of the same strain of modified-live virus in a commercial vaccine administered IM with or without adjuvant did not significantly SUMMARY 120 elevate colostrum antibody titers. The results collected from the present research showed that the average antibody titers in the 25 cattle dams at 0, 14, 28 and 42 days post vaccination were 0%, 57%, 68% and 78% respectively. In a similar manner the average antibody titers in the 25 buffalo dams at 0, 14, 28 and 42 days post vaccination were 0%, 55%, 70% and 82% respectively. These results indicated the protective maternal antibody level against the rotavirus which will be transferred passively to calves. The results indicate that vaccinated dams were able to provide passive immunity to both buffalo and cattle calves in order to provide protection against the deadly virus. Availability: Items available for loan: UVAS Library [Call number: 2570-T] (1). Place hold
Isolation And Molecular Identification Of H9N2 Avian Influena Virus From Human In Punjab Province Pakistan

by Abdul ahad | Prof .Dr, Masood rabbani | Prof. Dr. Rana | Prof. Dr. Tahir yaqub.

Material type: book Book; Format: print ; Literary form: not fiction Publisher: 2012Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1926,T] (1). Place hold
Isolation, Characterization And Pathogenesis Of Capripox Virus

by Abdul Sajid | Prof. Dr. Zafar Iqbal Chaudhry | Dr. Aftab | Prof. Dr. Azhar Maqbool.

Material type: book Book; Format: print ; Nature of contents: biography; Literary form: Publisher: 2010Dissertation note: Goat pox is the most important pox diseases of livestock and it usually causes huge economic losses. The economic losses occur in terms of mortality, reduced productivity and lower quality of wool and leather. The clinical manifestations of the disease include high temperature, lesions skin in the form of macules, papules, vesicles, pustule and scabs on hairless areas of the body. The disease is highly contagious having high morbidity and mortality in the infected herds. The present study was conducted to document the prevalence of goat pox disease in the different regions of Punjab. The study was based on clinical manifestation of the disease in various collecting spots including slaughter houses, cattle and hide markets and tanneries. The prevalence of goat pox at slaughter houses in different regions was 9.93% in arid region followed by 8.69% and 7% in southern and northern irrigated regions respectively. The prevalence of pox disease in sheep was highest (8.54%) in the northern irrigated region, 7.69% and 6.62% in arid and southern irrigated regions respectively. The prevalence of pox recorded in the hide markets shows a trend of high presence 7.29% in arid region followed by 6.22% and 3.84% in southern and northern irrigated regions. Whereas in sheep the overall prevalence was 0.51 %, 4.44% and 1.66% in northern irrigated, arid and southern irrigated regions. In tanneries the pox lesions were identified on the basis of method as adopted in hide markets. The overall prevalence of pox in goat was 3.96%, 4.06% and 4.09% while in sheep 9.58%, 2.41 % and 10% in northern irrigated, arid and southern irrigated regions. The overall prevalence of pox disease in goat was 5%, 5.79% and 5.34% in Northern irrigated, arid and southern irrigated regions respectively. Where as in sheep, pox was 3.133%, 4.11 % and 2.67% in Northern irrigated, arid and southern irrigated regions respectively. The highest trend of incidence of disease was present in the arid regions followed by southern and northern regions. The slaughter houses shows high incidence of disease as compared to cattle and hide market and tanneries. The result was significant (P<0.05) among the regions and samples collecting spots. A total of 100 samples consisting of 55 scabs and 45 skin tissues were randomly selected from the different collecting spots of the three regions. The scabs and skin tissue samples were processed on dehydrated minimum essential media tor virus isolation. The virus was isolated on Vero cell line culture and its characteristics were observed on the basis of specific cytopathic effects. All 55 scab samples consisting 20 from cattle markets, 20 from slaughter house and 15 from hide market and tannery were tested through cell culture. The cell culture positive result for scabs was 60% cattle markets, 20% hide market and tannery and 40% slaughter house. All 45 skin tissue samples including 5 from cattle markets and tannery, 20 from hide market and 20 from slaughter house were subjected to virus isolation on Vero cell line. The cell culture positive result for skin tissue samples was 100% cattle markets, 30% hide market and tannery and 60% slaughter house. In this way the total cell culture result for scabs and skin tissue samples from all areas become 41.82% and 51.11 % respectively. The isolated virus was confirmed through peR. All the collected samples were also analyzed through peR in order to compare the two techniques for disease diagnosis. Out of 40 samples from slaughter houses 18 scabs and 15 tissues sample were positive through peR with 82.5%. Out of 25 samples collected from cattle markets consisting of 20 scabs and 5 skin tissues, 17 of scabs and 5 skin tissues were positive with 92%. Similarly a total of 35 samples out of which 15 were scabs and 20 were skin tissues collected from hide markets and tanneries. The peR of 7 scabs and 14 skin tissues was positive with 60%. In this way the total peR result for scabs and skin tissue from all areas was 42% and 34% respectively. In the 3rd study of the present project the isolated virus was inoculated in to experimental animal to study the detail pathogenesis. The disease followed the same pattern as in the natural outbreak. But however the routes of inoculation affect the severity of the disease. During the study the diseased animals were periodically slaughter at weekly interval after the appearance of 1 st clinical signs. The detailed lesions were observed in different visceral organs and the tissues were collected and preserved in 10% formalin. The tissues were processed for histopathology and immunohistochemical examination. The IHC was successfully optimized for the detection of viral antigen in the tissues of skin, lung and lymph nodes. Availability: Items available for loan: UVAS Library [Call number: 1372,T] (1). Place hold
Isolation, Characterization Of Chondroitin Sulphate And Its Efficacy In Osteoarthritis

by Humaira Majeed Khan | Prof. Dr. Muhammad Ashraf | Prof. Dr. Mansur-ud-Din Ahmad.

Material type: book Book; Format: print ; Literary form: drama Publisher: 2012Dissertation note: Chondroitin sulphate (CS) and Glucosamine sulphate (GS) are two main components of articular cartilage. It is believed that these molecules slow down wear and tear of cartilage. Moreover, if administered exogenously as drugs, these may initiate synthesizing capacity of cartilage. Among these, GS promotes the formation and repair of cartilage, whereas CS promotes elasticity and prevent cartilage breakdown by inhibiting degradative enzymes. Concurrent use of both structural units of cartilage as drugs in osteoarthritis (OA) may lessen the progression of disease. The present study was conducted to elucidate the chicken keel cartilage as an alternate and potential source for this endogenous component that may be used exogenously to repair or prevent damage to joints. Chicken keel cartilages were collected from healthy broilers. CS was extracted using MgCl2 solution (3M), dialyzed and digested with papain. The extracted material was purified by ethanol precipitation, centrifugation and then freeze dried. Proximate analysis of semi-purified polysaccharides revealed the presence of carbohydrates (65.49±0.10), crude protein (12.82±0.26), ash (11.12±.56), moisture (9.88±0.32) and fat (0.69±0.14). Fiber contents were found to be nil in the processed samples. Dimethylmethylene blue binding (DMMB) assay was performed for determination of percent contents of CS in extracted semi-purified samples and mean concentration was found to be 70.77±2.35. Semi-purified polysaccharides were further characterized by FTIR (Fourier Transform Infrared Spectrometer) technique and characteristic Peaks of CS molecules were recorded at 854, 854 and 853 cm-1 and then compared with spectrum of standard CS. Protein content being a major impurity in extracted samples was determined by Bradford method quantitatively (4.64±0.29). Two protein impurities having 77.8 and 50.5 kDa molecular weights were revealed by SDS-PAGE. Efficacy of semi-purified CS from chicken keel cartilage, standard CS from shark sou