Epidemiological, Haematological & Serological Studies Of Leptospirosis In Dogs And Human At High Risk In And Around Lahore City
by Muhammad Hassan Saleem | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr. Muhammad Arif Khan.
Material type: ; Format:
print
Publisher: 2013Dissertation note: Leptospirosis is an important zoonosis of global importance capable of causing significant subclinical and clinical syndromes both in humans and animals. The disease is characterized by fever, vomiting, diarrhea, myalgia and other signs consistent with renal and hepatic disease. Considering the significance and the substantial losses rendered by Leptospirosis, the present project was designed to study epidemiology and haematology in dogs and humans at high risk in Lahore district and its peri-urban areas.
The study was accomplished in 4 phases. In phase-I, sero-prevalence both in dogs and human was studied including case fatality rate and associated risk factors through cross a sectional study. For this purpose, blood samples were collected from dogs attended at the Pet Centre of University of Veterinary and Animal Sciences, Lahore and other private clinics situated in and around Lahore area through systematic random sampling technique over a period of one year (1st Dec. 2010 to 30th Nov.2011). Blood samples from every fifth un vaccinated dog were collected, but if the dog was vaccinated then the sample was collected from the next unvaccinated one. In this phase 100 sera samples from human volunteers which were at maximum risk (veterinarian, pet and livestock owners, para-vet staff) were also collected. All samples were screened out by using ELISA kits like Canine Leptospira IgG ELISA Kit Catalog no. BG-CAN11485, NovaTein Biosciences, Woburn, MA, USA and Serion Elisa Plate, Virion/Serion GmbH, Wurzburg, Germany for dogs and humans respectively at the Medicine Laboratory and University Diagnostic Laboratory, University of Veterinary and Animal Sciences, Lahore.
To study overall prevalence of Leptospirosis in dogs a total of 429 dogs were examined and it was found that out of 429 blood samples 155 were found positive for Leptospira antibodies. Thus an overall prevalence of Leptospira was recorded as 36.13%. Prevalence of Leptospirosis in dogs during different months of the year was also recorded. The months of September, October and June showed ere the highest prevalence and recorded as 50%, 48.57% and 45% respectively. Although, a few cases were seen during the months of December, January and February while moderate number of cases was recorded during the rest months of the year. There was a significant difference (p<0.05) in the prevalence of Leptospirosis during the different months of the year. Out of these 429, 93 pups and 336 adults were examined for Leptospirosis and found that 26 pups and 129 adults were positive i.e. a prevalence rate of 27.95% (26/93) and 38.39% (129/336) for Leptospirosis was recorded in pups and adult dogs respectively and this difference was non-significant (p>0.05). In this study a prevalence rate of 38.49% (102/265) and 32.31% (53/164) for Leptospirosis was recorded in male and female dogs respectively and this difference between the sexes was also non-significant(p>0.05). According to the results of this study a sero-prevalence of 21.24% (24/113) in winter, 35.82% (24/63) in spring, 40.34% (71/176) in summer and 49.32% (36/73) were recorded in fall season and this difference was significant (p<0.05). The highest prevalence rate was observed in fall and summer seasons of the year during higher rain fall seasons of the year.
To study overall prevalence of Leptospirosis in humans, a total of 100 blood samples were examined through random sampling technique during the whole study period and overall prevalence rate of 44.00% was observed in human population. Different risk factors like different months of the year, age, sex and season were also studied and that the highest prevalence of Leptospira in humans was observed in the months of March, April and August i.e. 66.66%, 66.66% and 60.0% respectively. No significant difference (p>0.05) in the sero-prevalence of Leptospirosis in human during the different months of the year was observed. Sex-wise prevalence rate of 48.71% (38/78) and 27.27% (06/22) for Leptospirosis was recorded in male and female respectively and this difference was significant (p<0.05). The results of this research project revealed a prevalence rate of 47.29% (35/74) and 34.61% (09/26) for Leptospirosis in adults and young ones respectively and this difference was again non-significant (p>0.05). According to the results of this study a sero-prevalence of 41.93% (13/31) in summer, 40.00% (06/15) in fall and 25.92% (07/27) in winter, while 66.66% (18/27) was recorded in spring season of the year and this difference was significant (p<0.05) and the highest prevalence rate was observed in spring.
In phase-II, the effect of Leptospirosis on various blood parameters were determined in both dogs and human. The results of present study revealed a significant difference (P<0.05) between the Hemoglobin (Hb), Erythrocytic sedimentation rate (ESR), Packed cell volume (PCV), Total Leukocytic count (TLC), Neutrophils, Eosinophils and Monocytes of healthy and Leptospira affected dogs, while a non-significant difference was observed (P >0.05)among values of lymphocytes. It showed that values of Hb forthe diseased dogs were lower than healthy ones while ESR, PCV, TLC, Neutrophils, Eosinophils and Monocytes, were more than in normal dogs. Likewise, in humans all the studied parameters were significantly (P <0.05) different between infected and healthy ones. The values of Hb concentration in diseased humans were lower than the healthy ones while ESR, PCV, TLC, Neutrophils, Eosinophils, Basophils, and Monocytes were higher than in healthy people. A negligible change was observed in the percentage count of lymphocytes.
In phase-III, the comparative efficacy of commercially available vaccines against Leptospira was studied. Two commercially available vaccines, Vaccine #1 with protection against two serotypes of Leptospira (Canicola, Icterohaemorragiae) and vaccine #2with protection against four serovars of Leptospira i.e Canicola, Icterohaemorrhagiae, Grippotyphosa and Pomona were compared After six months it was observed through ELISA screening that the vaccine #2 provided better overall protection compared to the vaccine #1 to the pups as well as adult dogs against the Leptospirosis but this difference was non-significant (p>0.05).
In the last phase of this study the chemotherapy trial was conducted. Results found that the efficacy of Penicillin G was 70%, while in group B Amoxicillin produced 60% results and in group C Sarsaparilla proved to be 40% effective against this infection although this difference was non-significant (p>0.05). It is concluded that among therapeutic agents used to treat Leptospirosis in dogs, Penicillin G , Amoxicillin and Sarsaparilla are ranked in respective order of efficacies.
Availability: Items available for loan: UVAS Library [Call number: 1588,T] (1).
Add to cart (remove)
Epidemiological, Haematological And Biochemical Risk Factors Of Parturient Haemoglobinuria In Buffaloes
by Altaf Mahmood | Prof. Dr. Muhammad Athar Khan | Prof. Dr. Muhammad Arif Khan.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2011Dissertation note: Parturient haemoglobinuria is disease of economic importance which affects a considerable number of buffaloes every year in India, Pakistan and Egypt. It is a non infectious hemolytic syndrome characterized by intravascular haemolysis, hypophosphataemia, haemoglobinaemia, haemoglobinuria and anaemia. The exact pathogenesis is not known and diversified etiological factors have been associated with this disease in different parts of the continent. Information on multidimensional etiological aspects of this buffalo syndrome is quite scanty. The present study was therefore carried out in district Chakwal for assessment of disease burden (parturient haemoglobinuria), its distribution and quantification of associated epidemiological, haematological and biochemical risk factors in order to suggest control measures and future research priorities.
Active surveillance was conducted in eight randomly selected villages of district Chakwal from April 2010 . March 2011. All breeding age buffaloes (1938) of these selected villages were taken as sampling frame whereas one breeding age buffalo was taken as sampling unit. Parturient haemoglobinuria appeared as number one disease among all problems of breeding age buffaloes with respect to mortality rate (1.03%) and proportional mortality rate (20%) whereas it appeared as 8th and 7th disease respectively with respect to incidence (3.97%) and case fatality (25.97%) rates.
Case-Control study was conducted for quantification of epidemiological risk factors associated with disease by analyzing the data of 180 case-control pairs for various 162
hypothesized risk factors. . 7 months pregnancy, . 3 lactation number, . 60 days postpartum period, . 7 years age, previous history of haemoglobinuria and ingestion of cruciferous plants were recorded as significant (P . 0.05) risk factors with odds ratios of 15.80, 6.39, 6.23, 5.56, 3.41 and 2.51 respectively. Clinical trial was conducted on 30 haemoglobinuric buffaloes randomly divided into three groups with 10 animals in each group to compare and assess the recovery rates of three different treatment packages against parturient haemoglobinuria. The highest recovery rate (100%) was recorded for combined therapy of sodium acid phosphate and blood transfusion followed by sodium acid phosphate with antifibrinolytic drug tranexamic acid (70%) and tranexamic acid with Novacoc injection (50%). Cross-sectional epidemiological study was conducted on haemoglobinuric (n = 30) and healthy (n = 60) buffaloes for quantification of haematological and biochemical risk factors associated with parturient haemoglobinuria. Red cell count (. 5 ~ 106 /ƒÊl), haemoglobin (. 8g / dl), haematocrit . 25%, mean corpuscular volume (. 50fL), mean corpuscular haemoglobin (. 20pg) and erythrocyte sedimentation rate( . 80mm / 1st hour) were recorded as significant (P . 0.05) haematological risk factors with odds ratios of 26, 17.81, 28.95, 21, 12.25 and 26 respectively whereas billirubin unconjugated (. 0.2mg /dl), billirubin total ( . 0.3mg /dl), phosphorous (. 2.5mg /dl), molybdenum (. 70ƒÊg /dl) and selenium (. 15 ƒÊg /dl) were recorded as significant (P.0.05) biochemical risk factors with odds ratios of 26.55, 26.55, , 7.50, 11 respectively.
Experimental study was conducted to determine the effect of orally administered gossypol on haematological and biochemical parameters of eight female rabbits of six 163
months age purchased from local market and maintained at university of veterinary and animal sciences from February 2011 . April 2011 under optimum conditions. The cotton seed cake containing free gossypol contents of 0.25% was fed to rabbits @ 4 grams per kg per day in addition to their routine diet including good quality fresh vegetables (cucumbers, spinach, cabbage & carrots) and clean water ad-libitum. Blood samples of each rabbit were collected after every 15 days interval and analyzed for haematological and serum biochemical parameters. Significant (P.0.05) decrease was recorded in total erythrocyte count, haemoglobin concentration, haematocrit, mean corpuscular volume and serum inorganic phosphorous whereas significant increase was recorded in mean corpuscular haemoglobin, mean corpuscular haemoglobin concentration, red cell distribution width, total leukocyte count, lymphocytes and monocytes from 0 . 60th day with the passage of time whereas non significant (P.0.05) difference was recorded with respect to granulocytes and serum calcium concentration.
Availability: Items available for loan: UVAS Library [Call number: 1429,T] (1).
Add to cart (remove)
Epidemiology And Control Of Gastro-Intestinal Nematodes Of Large Ruminants In Balochistan
by Muhammad Ramzan (2009-VA-653) | Dr. Nisar Ahmad | Prof. Dr. Muhammad Azam Kakar | Prof. Dr. Kamran Ashraf | Prof. Dr. Aneela Khurram.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The main area of research in this study was to assess the prevalence, hematological aspects
of Bovine nematodiasis. Three main experiments were conducted to highlight the objectives of
the present research study.
The first experiment was conducted to find out the prevalence of large ruminants major
nematodes for one year. For this purpose buffalo and cattle of either sexes and between < 1 year
to > 2 years of age were selected from two sites i.e., Quetta and Qilla Abdullah. Fecal analysis of
these cattle and buffalo showed overall higher (33.99%) nematodes prevalence recorded in buffalo
in Quetta, (27.99%) in cattle at Qilla Abdullah followed by in cattle at Quetta (26.66%). Five
nematode infection was recorded in all two experimental sites with higher prevalence of
Haemonchus contortus in buffalo at Quetta and Ostertgia ostertagi in cattle at Quetta and Qilla
Abdullah. The buffalo and cattle of < 1 year presented higher nematodes prevalence than 1-2 years
and > 2 years. The female buffalo and cattle were infected with nematodes prevalence higher
than male animals. These five nematodes were prevalent almost throughout the year, however a
peak infection was recorded during August and September in cattle and October in buffalo. The
high temperature, rainfall and humidity during these months may be predisposing factor of higher
prevalence. Mostly the level of nematodes infection was low(< 800 EPG) and did not seriously
impaired the buffalo and cattle productivity.
Second experiment on assessing the comparative efficacy of anthelmintics (Levamisole,
Oxafendazole and Ivermectin) against cattle and buffalo nematodes were conducted at Govt and
private farms. The results showed that Ivermectin than Oxfendazole were found effective against
cattle and buffalo nematodes. The higher (89-100%) reduction of EPG were recorded in cattle and
87
buffalo calves treated with Ivermectin followed by Oxfendazole (86-100%), Levmisole (88-
100%).
Third experiment was conducted to determine the hematological values in healthy and
nematodes infected animals. Different hematological parameters i.e., TEC, TLC, Hb estimation,
were determined. The results showed that overall low Hemoglobin estimation and RBC were
recorded in nematodes infected animals than healthy, while higher WBC were recorded in
nematodes infected animals than healthy. The Lymphocytes and Neutrophil and Monocytes were
higher in some nematodes and lower in other, while higher mean Eosinophil counts was recorded
in all nematodes infected animals than healthy animals. Availability: Items available for loan: UVAS Library [Call number: 2730-T] (1).
Add to cart (remove)
Epidemiology And Controls Of Coccidiosis In Cattle
by Razia Sultana | Prof. Dr. Azhar Maqbool | Prof.Dr.MAnso | Prof.Dr.Zafar Iqbal Ch.
Material type: ; Format:
print
Publisher: 2009Dissertation note: Field study was conducted from September, 2007 to August, 2008 and a total of 2700 rectal faecal samples were collected from cattle farms of 3 categories i.e. Government Dairy Farm, Military Dairy Farm and Peri Urban Dairy Farms (Gawala Colonies) Lahore. Seventy five random samples were collected from each category of farms on monthly basis. The results of field study showed that overall prevalence of coccidiosis in cattle was 54.55%. Prevalence of coccidiosis in cattle at Military Dairy Farm Lahore was the highest (65.33%) during Autumn followed by summer (52.66%) then winter (47.66%) whereas the lowest (34.00%) during spring season. The highest (56.66%) prevalence was observed in animals between 6 & 12 month, whereas the lowest (46.33%) in animals under 6 months age. Prevalence of coccidiosis above 1 year of age was 50.66%. No coccidial oocysts was detected in calves less than 15 days old. In female animals prevalence was 51.22%.In the present study, the maximum oocyst per gram of feces (OPG) count was 65,000 whereas the minimum count was as 2000. The count was variable in different age groups and found to be decreasing in adult animals. The mean OPG in group A (under 6 month), group B (6 month to one year) and C (above one year) was 44000, 38000, and 22000, respectively. The four species of Eimeria were identified in all age groups i.e. E.bovis (29.28%) E.zuernii (26.03%) E. cylindrica (23.42%), E. ellipsoidalis (21.25%).
The results of field study showed that prevalence of coccidiosis at Government Dairy Farm, Lahore was the highest during autumn (49.33%), followed by summer (44.33%), then winter (38.33%) where as the lowest during spring (30.33%). The highest (62.66%) month wise prevalence of coccidiosis was noted during August whereas the lowest (28.00%) during April. The highest ( 45.33%) prevalence of coccidiosis was observed in animals aged between 6 to 12 months, followed by 41.35% in animals under 6 months of age whereas the lowest (36.00%) above I year. Female animals were more frequently affected (41.28%) than males (39.50%).In the present study, the maximum OPG count observed was 55,000 and the minimum count as 2500. The counts were variable in different age groups and found to be decreasing in adult animals. The mean OPG of group A, B, C was 42,000, 35,000 and 20,000 . In the present study five species of Eimeria were E.bovis. E. zuernii E. cylindrica, E. subspherica, E. ellipsoidalis.
The results of field study showed that prevalence of coccidiosis at Peri Urban Dairy Farms (Gawala colonies), Lahore was 71.55%. Month wise prevalence was the highest during August (90.66%) whereas the lowest (48%) during April. The seasonal prevalence indicated that it was the highest during autumn (84.00%), followed by summer (78.33 %), then winter (69.33%) whereas the lowest during spring (50.00%). The highest prevalence of coccidiosis (80.66%) was observed in animals under 6 months of age, whereas the lowest (62.33%) in animals above I year. Prevalence of coccidiosis in animals aged between 6months to 1 year was 71.66%. No coccidial oocysts were detected in calves less than 25 days old. Prevalence of coccidiosis was higher (74.61%) in females than in males (63.60%). In this study, the maximum OPG count observed was 65,000 and the minimum count as 2800. The counts were variable in different age groups and found to be decreasing in adult animals. The mean OPG of group A, B,C was 48,000, 38,000 and 23,000 respectively.
Age wise analysis of Eimeria species showed that above mentioned five species were found in all age groups and most predominant species was E.bovis (26.39%) followed by E. zuernii (19.87%), E. cylindrica (23.60%), E.ellipsoidalis (18.63%), whereas the lowest prevalence of E.subspherica (11.49%)was noted (Table 16). The counts were variable in different age groups and found to be decreasing in adult animals. There was inverse correlation of OPG and the age of animals.
The overall prevalence of coccidiosis was the highest during autumn (66.22%) followed by summer (59.66 %) then winter (51.77%) whereas the lowest in spring (38.22). The role of Meteorological data i.e. temperature, humidity and rain fall on the prevalence of disease was also studied. The bionomical showed that humidity and rain fall played a very important role in the causation and spread of disease and also help in the development of sporulated oocyst. Increased temperature showed higher prevalence of disease.
The results of histopatholgical studies showed that there was an increase cellular infiltration of leukocytes, cellular debris in most of intestinal portion.
Results of therapeutic trials by using toltrazuril, amprolium, sulphaquinoxaline, lasalocid are presented in table 17. The result of therapeutic trials showed that efficacy of toltrazuril was better than amprolium, sulphaquinoxaline and lasalocid. No clinical signs of disease were observed in treated animals while in diseased animals signs of disease were observed i.e. animals showed diarrhoea, loss of weight gain. From the results it was noted that efficacy of toltrazuril was better than other drugs . Statistically, there was no significant difference between efficacies of all four drugs. The efficacy of per oxygen based disinfectant was higher as compare to oocide while non- treated animals showed clinical signs of disease. Statistically, there was no significant difference between efficacies of both disinfectants
Result of chemo prophylactic products are presented in table 19. It was noted that sonicated vaccine showed high antibody titer as compare to non- sonicated vaccine.
Result of the challenge experiments revealed that the inactivated sonicated vaccines gave 100% protection to the challenge calves. Their faeces were normal and no clinical sign was recorded even 42 days post vaccination. Few remaining live oocysts were not able to produce the disease in calves.
The weight gain of treated animals was higher as compare to non-treated animals. The FCR value in treated animals was better than non treated animals
" Prevalence of coccidiosis was the highest during autumn followed by summer where as the lowest during spring. Farm wise prevalence of coccidiosis indicated that it was higher in Peri Urban Dairy Farms followed by Military Dairy farm where as the lowest at Government Dairy farm.
" Prevalence of coccidiosis was higher in calves below 9 months of age than above 9 months. All the animals examined for coccidian were naturally infected with coccidiosis. These animals were not experimental calves and prevelance of infection was based on random selection of animals. Overall Prevalence of coccidiosis was slightly higher in females than male. Species wise prevalence indicated that Eimeria bovis is more pathogenic than other species.
" Results of chemotherapeutic trials showed that among the four drugs used i.e. Toltrazuril, Amprolium, Sulfaquinoxaline and Lasalocid. Toltrazuril showed the highest efficacy followed by Amprolium, where as Lasalocid showed the lowest efficacy. No side effects of these drugs were noted when were given at their recommended dose rate and marked clinical improvement in animals was noted after treatment.
" Two disinfectants were tried. Per oxygen based disinfectant showed better results than. Oocide disinfectant.
" Histopathological studies showed inflammatory granulocytic infiltration of the mucosa and cellular debris in most of intestinal portions. There were necrosis of villi and degeneration of villi. Haemorrhages in mucosa and sub-mucosa were noted. Some of the glands in the sub-mucosa of intestine showed degeneration & necrosis.
" Indirect Haemagglutination (IHA) antibody titer was higher in calves vaccinated with inactivated sonicated vaccines as compared to the calves vaccinated with inactivated sporulated vaccine. Results of the challenge experiments revealed that the inactivated sonicated vaccines gave protection to the challenge calves. Their faeces were normal and no clinical sign of disease were observed even 42 days post vaccination.
" Weight in infected group was reduced. After treatment, high weight gain was reported in treated animals than control group.
Recommendations:
" Overcrowding should be avoided.
" Provide good hygienic and managemental conditions in farms.
" Proper drainage of rain.
" Feeders and wateres should be above the level of the ground.
" Regular use of coccidiostats is the need of the day.
" Diseased animals particularly with diarrhoea should be separated from healthy animals.
" Stocking density should be according to recommended of world Association of Parsitologists.
" Contaminated faeces should be properly disposed off.
" Grazing of animals during rainy season should be avoided.
" Animals should be provided well balanced nutritive food.
" Entry of visitors in the livestock farms should be restricted
Availability: Items available for loan: UVAS Library [Call number: 1281,T] (1).
Add to cart (remove)
Epidemiology And Economic Losses Of Trichostrongylid Parasites In Sheep
by Sarwar Khan, M | Dr. Muhammad Athar Khan | Dr. Haji Ahmad | Dr. Khalid Pervaiz | Faculty of Veterinary Sciences.
Material type: ; Format:
print
Publisher: 1997Dissertation note: The meteorological data recorded during the study period from 1.1.96 to 31.12.96 showed the maximum temperature in June as
36.5°C and minimum temperature in December as 6.8°C. Maximum and minimum Humidity was recorded in the month of September and April as 85% and 55% respectively. The maximum rainfall during the year was recorded in the month of August as 660 mm.
The faecal egg counts of sheep grazing on permanent pasture showed the minimum EPG during first week of January while maximum EPG on nid of September and first week of October.
Pasture larval counts were performed on permanent pasture and experimental plot for the recovery of trichostrongylid larvae. The maximum number of larvae was recovered on 16th September, 1996, while minimum number was recovered in January and February from permanent pasture and experimental plot respectively. Two species of trichostrongylids were identified i.e. Haemonchus contortus and Trichostrongvlus colubriformis.
The faecal and larval counts were very low in the months of January and February, the counts started rising in March. Peak counts were seen in the month of September. Decline in counts started in late October and reached to minimum in December.
Mature and immature worm counts of slaughtered sheep were performed at 15 days interval. The, overall prevalence oftrichostrongylid parasites was 34%. The maximum number of mature parasites were seen during first week of October which was886 whereas maximum number of immature parasites including hypobiotic was 326 on 1st of December. During this study the average fecundity/female of contortus and L colubriformis parasites were calculated as 721 and 209 respectively. A spring rise in worm egg counts was experienced in mid of March. A pen parturient rise in the worm egg counts of pregnant and lactating ewes indicated the maximum counts during lambing week.
An experimental group of sheep with mixed infection of trichostrongylid parasites showed the similar pattern of EPG counts as of naturally infected sheep.
A study was performed to evaluate any protection provided by a particular Flaemoglobin type to trichostrongylid infection hut not difference could be observed. The Asparate Aminotransferase (AST) and total protein levels of infected sheep were decreased as a result of increase in the intensity of infection.
A decrease in R.B.C. counts, Haemoglobin, Packed cell volume and lymphocyte counts was observed both in experimentally and naturally infected slaughtered sheep. However, an increase in total leukocytic count (TLC) alongwith an increase in the ratio of neutrophils, eosinophils and basophils was observed.
At the end of experiment infected sheep gained 5.71 Kg/head less body weight and produced 4 3 grn less wool as compared with non-infected group. Based on epidemiological information the suggestions for control of the, trichostrongylid infection are submitted alongwi th recommendations for further studies.
Availability: Items available for loan: UVAS Library [Call number: 0595,T] (1).
Add to cart (remove)
Epidemiology And Prophylaxis Of Babesiosis In Felidae
by Syed Saleem Ahmad | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr. Muhammad Arif Khan.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2011Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1425,T] (1).
Add to cart (remove)
Epidemiology Diagnosis And Chemotherpy Of Strangles In Equines
by Muhammad Ijaz | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr. Muhammad Arif Khan.
Material type: ; Format:
print
Publisher: 2010Dissertation note: Strangles is an infectious malady of equidae characterized by upper respiratory tract infection, dysponea, anorexia, regional suppurative lymphadenitis and causes high morbidity and low mortality. Considering the significance and utilization of equines in our country and the substantial losses rendered by Strangles, the present project was designed to study epidemiology, diagnosis and chemotherapy of strangles in Lahore and Sargodha districts of the Punjab province in Pakistan.
The present study comprised of five phases. In phase-I, epidemiology of the disease including prevalence, variations in SeM, SzPSe and Se18.9 proteins and mortality rate were studied in Lahore and Sargodha districts. For epidemiology, nasal swabs and pus samples from the affected lymph nodes of 500 equines (nr=250 horses, rutz250 mules) suspected for strangles were collected and cultured for identification of S. equl. The collected samples were processed at Medicine and Microbiology Laboratories of the University of Veterinary and Animal Sciences, Lhore, Pakistan and Gluck equine research center, Department of Veterinary Science, University of Kentucky, USA. Out of 250 horses and 250 mules, 113(45.2%) horses and 99 (3 9.6%) mules tested positive for S. equi. on the basis of culture. Number of S. equl isolates were significantly higher (P<0.05) in pus samples taken from sub-mandibular lymph nodes as compared to nasal discharge samples. The difference was significant (P<0.05) among mules of different age groups. The highest prevalence of strangles
was recorded in horses and mules less than 2 year of age as compared to those having age more than 2 years.
In the present study, prevalence of strangles round the year in horses and mules were also calculated and it was found to be the highest during the months of
February, March, April and May while few cases were seen during the months of January, June and July and no cases were observed during others months. The significant difference was observed (p<O.O5) among the prevalence levels of strangles in different months of the year. Similarly when compared the prevalence of strangles in different seasons of Pakistan i.e. summer, winter, spring and autumn. The highest prevalence rate was recorded during the spring season.
The prevalence on the basis of Polymerase chain reaction (PCR) of S. equi in horses and mules was also recorded. Out of 250 horses and 250 mules tested, 122(48.8%) horses and 113(45.2%) mules were positive for S. equi. When compared
the prevalence rate on the basis of PCR and culture of nasal and pus samples from affected submandibular lymph nodes it revealed that the sensitivity of Polymerase
chain reaction appears to be much greater than culture. The culture along with PCR is the best diagnostic technique for S. equi as PCR test does not differentiate between dead and live bacteria, hence a positive test may not correlate with active infection; therefore, a positive culture may be necessary to confirm the diagnosis.
In this phase of epidemiological study of disease, effect of selective pressure of allelic diversity in SeM of S. equi on immunoreactive proteins SzPSe and Se 18.9 was also studied. The aim of this study was to determine whether variations in SeM are accompanied by variations in the immunoreactive surface of exposed SzPSe and secreted Se18.9. Sequences of genes of 25 S. equi alleles isolated from different countries of the world over a period of 40 years were compared. Twenty different SeM alleles were identified including 6 not included in the data base (http:// pubmlst.org/szooepidemicus). Amino acid variation was also detected distal to the N- terminus of SeM. No variation was observed in SzPSe except for an Australian isolate which showed a deletion of one PEPK repeat. The Se 18.9 protein in all 25 isolates of S. equi did not exhibit any variation. Interestingly, only 2 SNP loci were detected in Se 18.9 compared to 93 and 49 in SeM and SzPSe respectively. The greater frequency of mutation in SzPSe compared to Se18.9 may be related to a high rate of recombination of SzPSe and the inclusion of exogenous DNA sequence based on the atypical GC percentage of its central hyper variable region.
In horses the mortality rate was recorded as 1.64% whereas the mortality rate in mules having less than 5 years of age was found to be 0.88%. No significant difference (P>0.05) in mortality rate among horses and mules of different age groups affected with strangles was observed.
In phase-I! of the present study, carrier status of the horses and mules were
studied. Out of 122 horses found positive to PCR, 20 horses (10<2 years and 10 between 2 and 5 years of age) were selected and monitored for 12 weeks. Their nasal
swab samples were used for identification of bacteria through culture and PCR on weekly basis. Till the end of 3rd week all horses <2 years of age remained positive but at the end of 4th to 7th weeks there remained positive only 5, 2, 1 and zero horses out of 10, respectively on the basis of culture whereas through PCR at the end of the 4th week all horse <2 years of age were found positive, but at the end of 5th to 10th weeks there remained 7, 5, 4, 2, 1 and zero horses out of 10, respectively. While all the horses aging between 2 to 5 year, were positive up to the 1St week but at the end of 2nd to 8th week out of 10 there were 9, 7, 6, 3, 1, 1 and zero horses respectively positive on the basis of culture but through PCR, all horses were positive till 4th week but at the end of 5th to 9th week number was reduced to 9, 7, 6, 3, 2 and zero. Similarly, out of 113 mules, 20 mules (10<2 year and 10 between 2 and 5 years of old) were also monitored for 12 weeks to study their carrier status. After the end of 2nd week all mules <2 years of age were positive but at the end of 3rd to 6th weeks there remained 7, 3, 1 and zero mules out of 10, respectively on the basis of culture but through PCR at the end of the 5th week all mules <2 years of age were positive, but at the end of 6th to 10th weeks there remained 9, 7, 3, 2 and zero mules out of 10, respectively. While in 2 and 5 year old mules, all were positive up to the 2nd week but at the end of 3rd to 7th weeks there were 6, 4, 2, 1, 1 and zero mules out of 10, respectively on the basis of culture but through PCR, all mules were positive up to 5th week but at the end of 6th to 10th weeks there were 8, 5, 2, 1 and zero. Horses and mules were declared free of infection on the basis of three consecutive negative samples through culture and PCR.
From the result of present study, it may be concluded that sensitivity of Polymerase Chain Reaction appears to be much greater than culture for study of carrier status of equines. Moreover, recovered animals should be kept in quarantine period at least upto 9th week because the recovered horses and mules remain carrier for prolonged period of time and can act as source of infection for susceptible animals through periodic shedding of S equi. (comprising 10 horses and 10 mules) for in-vivo trials. Efficacy of the antibiotics was assessed weekly on the basis of negative nasal swab culture. Results of in-vitro antibiotic sensitivity revealed that in horses and mules, S equi was most sensitive to Procaine penicillin followed by ceftiofur Na, cephradine, erythromycin, ampicillin, tetracycline, chloramphenicol, sulfamethoxazole, trimethoprim + sulfdiazine and gentamycin whereas the result of in-vivo antibiotic trials revealed that horses and mules suffered from strangles without abscess formation were most sensitive to Procaine penicillin followed by ceftiofur Na, cephradine and erythromycin whereas animals which developed abscess showed no response. It is concluded from the result of present study that Procaine penicillin is most effective in-vitro and in-vivo antibiotic followed by ceftiofur Na and cephradine. These antibiotics might be used for the treatment of strangles infection.
Phase-V, comprised over in-vitro trials of disinfectants. Efficacy of disinfectants, like povidone iodine, 0.6% H2S04, dettol and bleach was assessed. Phenol Co-efficient Test was applied, to ascertain efficacy of these disinfectants, used
in, in-vitro trials. Among four disinfectants, povidone iodine was found to be the best one with a phenol coefficient of 1.25 that is greater than phenol i.e. 1.00 while 0.6%
H2S04 showed similar phenol coefficient as that of phenol. The phenol coefficient of dettol and bleach were observed as 0.5 and 0.75 respectively. Therefore it is recommended that S. equi is highly sensitive to povidone iodine and 0.6% H2S04.
Availability: Items available for loan: UVAS Library [Call number: 1211,T] (1).
Add to cart (remove)
Epidemiology Of Bovine Tuberculosis And Its Public Health Significance In Peshawar
by Irfan Khatak (2011-VA-562) | Dr. Muhammad Hassan Mushtaq | Prof. Dr. Umer Sadique | Prof. Dr. Mansur-ud-Din Ahmad | Prof. Dr. Muhammad Sarwar Khan.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: A cross-sectional study was carried out to determine the prevalence of bovine tuberculosis (bTB)
and associated risk factors in cattle and buffalo in Peshawar, Pakistan. Cattle and buffalo,
randomly selected from all four towns of District Peshawar were screened for bovine
tuberculosis using comparative cervical intradermal tuberculin test (CCIT). For obtaining data on
risk factors, socio-demographic condition, animal characteristics and management, interviewer
administered pretested questionnaire to animal owners. Multivariable logistic regression models
were used to measure association between risk factors and comparative cervical intradermal
tuberculin reactors. A total of 556 cattle and buffalo were screened for bovine tuberculosis. Out
of 556 animals screened, 5.75% (3.9-8.0%) were found positive. The prevalence was higher in
old animals (P= 0.001) as compared to younger animals. Prevalence also varied with source of
animal (either raised on farm or purchased), stay of animals at night (indoor or outdoor) and herd
size. Farmer’s knowledge about transmission of TB from animals to human as well as signs and
symptoms of TB was extremely low. Only 3.6% farmers correctly stated the combination of
three major symptoms of TB. Results of the study call for immediate intervention to control bTB
in animals as well as its transmission to human population. Furthermore, it is suggested to
emphasize on local epidemiology of bTB and husbandry practices of cattle and buffalo during
the control program.
To assess the presence of Mycobacterium bovis (M. bovis) in milk sold at retail shops and find
the knowledge, attitude and practice (KAP) about tuberculosis (TB) in the high risk M. bovis
contaminated milk consumers, milk samples were obtained from 92 milk shops and analysed for
presence of M. bovis. Data on socio-demographic characteristics and KAP about TB was
Summary
152
obtained from 800 M. bovis contaminated milk consumers. Mycobacterium bovis was detected in
8.7% (8/92) milk samples. Although 97.4% of the participants had heard of TB but only 39.6%
knew that cough lasts for more than 3 weeks was one symptom. Only 79.2% have awareness that
TB can be prevented and the most frequently stated (48.4%) method of TB prevention was good
nutrition. Participants believed that TB can be cured by prayers/ eating well (41.8%) and also by
herbal cures/ consulting Hakeem (35.7%). Mean knowledge score for the participants was 12.1±
2.47 out of maximum 22. Mean knowledge score varied significantly with ethnicity, level of
education and residential status (Urban vs rural). Overall knowledge about TB was low.
Therefore community’s health education focused on increasing knowledge of TB must be
initiated.
This part of study was conducted to determine the occurrence of active pulmonary tuberculosis
due to M. bovis in abattoir workers, butchers, livestock farmers and veterinarians and to
document the Knowledge and practices of these professional regarding bTB. The cross sectional
study included 141 abattoir workers, 317 butchers, 50 livestock farmers, 5 veterinary doctors and
3 veterinary assistants. Sputum samples were collected from those respondents who had chronic
cough that last for more than 2 weeks. Four out of 16 suspected abattoir workers and 1 out of 50
livestock farmers were found positive for M. bovis by Polymerase chain reaction analysis.
Duration of work as abattoir worker was found significantly associated (p<0.05) with occurrence
of zoonotic TB. The knowledge of abattoir workers, butchers, livestock farmers and veterinary
assistants regarding transmission of bTB from animal to human and symptoms of TB in human
was very low. Most of these professional did not use protective material/ techniques and are
considered at high risk of acquiring zoonotic tuberculosis. This study declares zoonotic
tuberculosis a critical public health issue especially for professionally exposed groups in
Summary
153
Peshawar, Pakistan and warrant immediate intervention for control of bovine and zoonotic
tuberculosis.
The last part of study aims to determine the proportion of zoonotic TB cases out of overall
human TB patients and school children, drug resistance of M. bovis isolates and knowledge,
attitude and practices about TB. Total 300 human TB patients and 100 school children were
included in the study. Sputum samples were processed by PCR for presence of Mycobacterium
tuberculosis and M. bovis. Sputum samples from TB patients were cultured and M. bovis isolates
were subjected to drug susceptibility testing. Data on knowledge, attitude and practices were
obtained from TB patients by administering pre-tested questionnaire. Among TB patietns 4%
(12/300) were infected with M. bovis. None of the school children was positive for M. bovis.
Residence, occupation, presence of animals at home and sleeping in shed at night was found
significantly associated with occurrence of zoonotic TB. Except one all M. bovis isolates were
resistant to Pyrazinamide. Among other drugs resistance to streptomycin and isoniazid was high.
Low level of knowledge and practices were observed. The study concluded that considering
zoonotic aspect of TB during diagnosis and treatment of TB is necessary and recommends
national survey for true estimation of burden of zoonotic TB in Pakistan. Availability: Items available for loan: UVAS Library [Call number: 2540-T] (1).
Add to cart (remove)
Epidemiology Of Diarrheal Diseases Of Bovine Calves In Punjab
by Jawaria Ali Khan | Prof.Dr.Muhammad Sarwar Khan | Prof.Dr.Azhar | Prof.Dr.Muhammad Arif Khan.
Material type: ; Format:
print
Publisher: 2010Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1254,T] (1).
Add to cart (remove)
Epidemiology Of Giardia Duodenalis And Cryptosporidium Parvum Infections In Calves And Young Dogs
by Khalid Saeed | Dr. William P. Shulaw, Advisor | Dr. Margaret A. Masterson | Dr. Thomas E.
Material type: ; Format:
print
Publisher: 1998Dissertation note: In recent years Giardia duodenalis and Cryptosporidium parvum have been considered by some investigators to be important causes of diarrhea. The role of G. duodenalis as an enteropathogen in animals remains undetermined. Limited information is available concerning the effect of age and season on G. duodenalis and C. parvuni infection in calves. A year long prospective longitudinal study was conducted to determine the effect of age and a cross sectional study was conducted to determine the effect of season on infection rates and shedding intensity. Associations between Giardia and Cryptosporidium infections and abnormal stools were also determined. A separate case control study was conducted to investigate the association between Giardia, and Cryptosporidium infections and diarrhea in young dogs admitted to two animal shelters.
Giardia and Cryptosporidium cysts/oocysts were frequently identified in fecal samples from calves. Giardia cysts and Cryptosporidium oocysts were found in 54% and 24% of samples respectively from 1 day to 387 day-old calves. About 80% of individual calves had at least one positive sample for Giardia and Cryptosporidium infections.
Age was a significant factor in determining Giardia and Cryptosporidium infections and cyst/oocyst shedding levels (P< 0.01). The highest proportion of Cryptosporidium-positive samples was from 2 week-old calves. Giardia cysts were most frequently identified in samples from 8 week-old calves and about 80% of samples had cysts.
Giardia cysts were less frequently found in samples collected in winter than in other seasons (P <0.01). Detection of Cryptosporidium oocysts was not influenced by season. Among infected calves, Cryptosporidium oocyst shedding levels were higher in winter than in other seasons.
Giardia cysts were more frequently found in normal stools than in abnormal su)ols (P 0.01). Lrvptosporu.tiiein oocysts were more frequently identified in abnormal stools than in normal stools (0R3.5; P <0.001) and among infected calves higher oocyst shedding levels were observed in abnormal stools than in normal stools (P <0.01).
No association between Giardia cyst and Cryptosporidiuni oocyst shedding levels and diarrhea was observed in the young dogs studied. Giardia infections were more common in females than in male dogs (P- 0.03). Gender was not associated with i3pru,,poriduun infections (Pr- 0.32). but higher mean oocyst shedding was observed in males than in females (P < 0.01 ). Mean body condition scores of cases was slightly lower than that of control dogs (P= 0.04).
Availability: Items available for loan: UVAS Library [Call number: 0945,T] (1).
Add to cart (remove)
Epidemiology Of Influenza Virus H5n1 In Islamabad Capital Territory
by Zahida Fatima (2005-VA-246) | Prof. Dr. Muhammad Athar Khan | Dr. Khalid Naeem | Prof. Dr. Mansur Ud Din Ahmad | Prof. Dr. Khushi Muhammad.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The poultry sector in Pakistan is the second largest industry that contributes to the national gross domestic products (GDP) and remains a major source of nutrition (protein and energy) for human population in Pakistan. Highly Pathogenic Avian Influenza (HPAI) outbreaks due to H5N1 virus in poultry have been recorded in over 62 countries, indicating the contagious nature of the disease and its potential to infect various avian species. These HPAI outbreaks in poultry have lead to killing/culling of around 120 million birds in various countries. During 2009, the Avian Influenza continues to occur in poultry in China, Hong Kong, India, Egypt, Nepal, Bangladesh and Canada . In Pakistan, an HPAI outbreak due to H7N3 virus was first observed in 1994-95 and those due to H9N2 virus in broiler and layer chickens were recorded between late 1990’s and early 2000. During the period between 2006 and 2008, poultry heavily suffered due to multiple outbreaks caused by H5N1 virus.
The country experienced several and severe HPAI subtype H5N1 outbreaks during 2006-2008 in commercial poultry farms mostly, causing mass economic losses. In Pakistan all the four poultry production system exists being identified by FAO. The present study was conducted in peri-urban areas of ICT Islamabad, capital of Pakistan. The objectives of the present study were to investigate the outbreaks due to HPAIV H5N1 in 2006-2007 in ICT and identify the pattern and trends of these outbreaks. For this purpose descriptive epidemiological study was conducted and data was collected on a predesigned questionnaire regarding farm demography, culling, morbidity and mortality. The result statistical analysis showed a significantly (P< 0.05) higher morbidity, mortality, case fatality and culling rate in layers farms than breeders and broilers respectively. Layers and breeders of old ages were mostly affected with having higher mortality and culling in comparison to younger age layer and breeder commercial farms. The mean morbidity and mortality rates ranged 57–95% and 5-43% correspondingly.
After the HPAIV H5N1 first reported outbreak in Pakistan in 2006 culling strategy was adopted after devastating outbreaks regularly reported from throughout the country. The reasons behind these emerging epidemics were unknown and several hypotheses were given birth after these outbreaks. Knowledge regarding potential risk factors responsible for HPAIV H5N1 epidemics in commercial poultry farms in Pakistan was lacking. Therefore we conducted a longitudinal cross sectional survey (1:1 matched case control study) to identify potential risk factors at farm level responsible for 2006-2007 HPAIV H5N1 infection in poultry in ICT. Information on farm characteristics, biosecurity practices and farm management were collected. Logistic regression model on data was used to unveil the potentially associated risk factors with cases (farms confirmed HPAI H5N1 Positive). Several candidate variables were studied and investigated for association. The results multivariable logistic regression showed that farm location such as in urban area (P<0.05: OR=18.50), wild birds entry (P<0.05: OR= 12.66) and farms situated in highly dense poultry populated area (P<0.05:OR=4.50) were found significantly associated with outbreaks of HPAIV H5N1 infection in commercial poultry farms during 2006-2007 epidemics in the study area.
Live bird markets (LBMs) are essential for poultry marketing in developing countries like Pakistan. One year active disease surveillance for influenza viruses in avian species in LBMs in ICT area was conducted in 2011. LBMs in Pakistan are typically urban that brings together many avian species produced by different suppliers. Which make LBMs in Pakistan a potential source of HPAIV viruses as well as other emerging poultry pathogens i.e. new castle disease virus,infectious bronchitis etc. The results of the present surveillance data showed that seroconversion against H5N1 and H9N2 is present in LBMs bird species which were isolated from different samples like serum, cloacal, nasal samples and organ samples.This indicates the continuous threat of AIV viruses circulating in the live bird markets set up of Pakistan.
Findings of these studies will help to tailor control and prevention measure against devastating outbreaks in future regarding the local circumstances of commercial poultry farms as well as in LBMs. These studies also succeeded to unveil the true reasons behind these devastating outbreaks and their higher impact on poultry industry. Such type of surveillance programs will be useful in future to investigate several emerging diseases and outbreaks in Pakistan and other developing countries. Availability: Items available for loan: UVAS Library [Call number: 2700-T] (1).
Add to cart (remove)
Epidemiology Seriodiagnosis And Chemoprophylaxis Of Theileriosis In Cattle
by Aneela Zameer Durrani | Prof.Dr.Muhammad Sarwar Khan | Prof.Dr.Abdul Rauf Shakoori | Prof.Dr.Kahlid | Faculty of Veterinary Sciences.
Material type: ; Format:
print
Publisher: 2008Dissertation note: The field study was carried out in indigenous and cross bred cattle in three districts of Punjab namely, Lahore, Multan and Rawalpindi during the year from September 2006 to August 2007. A total of 1200 cattle were selected as reference population comprising of 600 Sahiwal and 600 Cross bred animals. 300 blood samples were collected during each season by taking 100 samples from each district. The results of field study on the basis of PCR showed that prevalence of Tannulata during summer was highest 46.7% in both breeds of cattle while lowest prevalence was recorded in winter, 4.6 % and autumn season 4.3% . The breed wise prevalence of Tannulata was lower, 11.5 % in sahiwal cattle compared with 20.2 % in cross bred cattle. The mortality rate of 2.8% was noticed only in cross bred cattle with highest mortality recorded in district Rawalpindi ,64.7% and lowest in district Multan,29.4% .The positive percentage of Tannulata was higher,61.5%(234/380) in females as compared to males ,38.4% (146/3 80) of both breeds. The positive percentage in much animals was highest, 32.4 %( 123/380) in both breeds while lowest was recorded in heifers, 11.1 %( 42/3 80). In males of both breeds 26.3% (100/3 80) positive percentage was seen in adults above 1 year of age while lower, 12.1% (46/3 80) was recorded in young animals up to 1 year of age. The prevalence of Tannulata was highest,l2.2% in district Lahore in both breeds while lowest prevalence, 9.33% was seen in district Rawalpindi.
The efficacy of PCR test was highest ,31.6% followed by microscopic lymph node smear examination,8.25% and microscopic blood smear examination,6% in diagnosis of field challenges of Theileria.
During the present study mixed infection with Babesia bigemina, 158%, was recorded in reference population. TLc breed wise prevalence of Babesia bigen'iina was higher in cross bred animals 33.33 % compared to 17 % in sahiwal cattle respectively along with 6% prevalence of the ileria specie on blood smear examination.
The overall economic losses of 3.39 million were calculated during the present study in three districts under study. The stocking pattern was highest (47%) for herd size of 1-2 animals while lowest herd size (12%) of 5-6 and above 6 was recorded.
The survey of ectoparasites showed the highest prevalence of ticks,66.7% recorded in district Lahore while prevalence of lice was highest,36.3% in district Rawalpindi and prevalence of mange mites was highest ,4% in district Multan. The highest prevalence of Hyalomma 12.0%, followed by Boophilus 8.1% Haemaphysalis 5%.and Rhipicephalus 3.1% were recorded. During the present study the species of Hyalomma identified were Hyalomma a. anatolicurn (65.2%) and Hyalomma n-zarginatum marginaturn (34.8%).The examination of salivary glands revealed that Hyalomma a. anatolicum (87%) and Hyalomma marginatum inarginatum (20.8%) were infected with T. annulata sporozoites. It was observed that the population of ticks was heaviest in the month of June, mid September to mid October with lowest infestation during the month of November. No ticks were noticed on animals from December to February.
The taxonomical study of Hylomma species showed the difference between both sexes and in different developmental stages. The two species of Hyalomnia in the present study were differentiated on the basis of structural features in adults. The pre-oviposition & oviposition periods recorded during spring were longest i.e 9 days and 12 days respectively. The incubation period of the ova of Hyalomma in summer and autumn was longest i.e 20 days. Mean survival period of unfed larva of Hyalomma was recorded as 56 days while for nymph it was 65 days. Larval and nymph engorgement period was longest in spring i.e. 9 days and 7days respectively while for adult the mena engorgement period in spring was longest i.e 9 days .The larval and nymph moulting period was longest in spring i.e 16 days and 17 days respectively . Amount of blood sucked in mg by first instar of Hyalomma ranged from 0.132 -0.126mg while for second instar it ranged from 140-79mg and for third instar it was 237-180 mg. The eggs were oblong in shape and measured 0.470 X 0.420 mm in size with weight of 0.041 rng on an average. It was observed that the maximum number of eggs laid by a single female tick in spring varied from 3720 to 3918, in summer from 2611 to 2961 and in autumn from 2423 to 2606.
The bionomical study showed effect of varying temperature and humidity on the development of different stages of Hyalomma tick. The effect of constant temperature (30°C) and varying humidity showed mean pre-oviposition period of mid October with lowest infestation during the month of November. No ticks were noticed on animals from December to February.
The taxonomical study of Hylomma species showed the difference between both sexes and in different developmental stages. The two species of Hyalomnia in the present study were differentiated on the basis of structural features in adults. The pre-oviposition & oviposition periods recorded during spring were longest i.e 9 days and 12 days respectively. The incubation period of the ova of Hyalomma in summer and autumn was longest i.e 20 days. Mean survival period of unfed larva of Hyalomma was recorded as 56 days while for nymph it was 65 days. Larval and nymph engorgement period was longest in spring i.e. 9 days and 7days respectively while for adult the mena engorgement period in spring was longest i.e 9 days .The larval and nymph moulting period was longest in spring i.e 16 days and 17 days respectively . Amount of blood sucked in mg by first instar of Hyalomma ranged from 0.132 -0.126mg while for second instar it ranged from 140-79mg and for third instar it was 237-180 mg. The eggs were oblong in shape and measured 0.470 X 0.420 mm in size with weight of 0.041 rng on an average. It was observed that the maximum number of eggs laid by a single female tick in spring varied from 3720 to 3918, in summer from 2611 to 2961 and in autumn from 2423 to 2606.
The bionomical study showed effect of varying temperature and humidity on the development of different stages of Hyalomma tick. The effect of constant temperature (30°C) and varying humidity showed mean pre-oviposition period of
that the values of TEC, TLC, and PCV and hemoglobin decreased considerably. Comparison of normal average with affected average values increased in Cross bred cattle while for Sahiwal cattle the values increased for lymphocytes and decreased for neutrophils, eosinophils, monocytes and basophils. The experimental study showed highest preyalence of disease in adult animals as compared to young animals by all diagnostic tests. The prevalence of disease in young animals at 12 months of age was highest (85.7% by MLE,71 .4% by MBE,85.7% by IFA & PCR in Sahiwal while 71.4% by MLE & MBE, 89% by IFA, 100% by PCR in cross bred animals. ) while lowest percentage of disease was seen at 3 months of age by all tests.The highest specificity and sensitivity ,96% and 75% respectively for PCR test was recorded while for MBE lowest specificity and sensitivity ,76% and 44% respectively were calculated. PCR analysis of the samples with 6u1 of MgCl2 gave successful results . It was found out that primers set A anneal at Tm 55 °C while Primer set B anneal at 60°C. The expected 721-bp fragment was generated from T. annulata DNA with primer set N5 1 6/N5 17721 -bp liagment with 0.00040% parasitemia, corresponding to 19 parasites per ml while primers 989 and 990 amplified the expected 1098 bp fragment of DNA. All animals that were positive by microscopic examination were also positive by IFA as well as PCR. The therapeutic trials showed efficacy of buparvaquone @ J/M 2.5 mg /kg body weight and Calotropisprocera @ 0.3mg! Kg dose orally.8 doses on alternate days was 60% and 100% respectively. After completion of treatment with Cal otropis procera no tick infestation was seen while ticks were present on the body of that the values of TEC, TLC, and PCV and hemoglobin decreased considerably. Comparison of normal average with affected average values increased in Cross bred cattle while for Sahiwal cattle the values increased for lymphocytes and decreased for neutrophils, eosinophils, monocytes and basophils. The experimental study showed highest preyalence of disease in adult animals as compared to young animals by all diagnostic tests. The prevalence of disease in young animals at 12 months of age was highest (85.7% by MLE,71 .4% by MBE,85.7% by IFA & PCR in Sahiwal while 71.4% by MLE & MBE, 89% by IFA, 100% by PCR in cross bred animals. ) while lowest percentage of disease was seen at 3 months of age by all tests.The highest specificity and sensitivity ,96% and 75% respectively for PCR test was recorded while for MBE lowest specificity and sensitivity ,76% and 44% respectively were calculated. PCR analysis of the samples with 6u1 of MgCl2 gave successful results . It was found out that primers set A anneal at Tm 55 °C while Primer set B anneal at 60°C. The expected 721-bp fragment was generated from T. annulata DNA with primer set N5 1 6/N5 17721 -bp liagment with 0.00040% parasitemia, corresponding to 19 parasites per ml while primers 989 and 990 amplified the expected 1098 bp fragment of DNA. All animals that were positive by microscopic examination were also positive by IFA as well as PCR. The therapeutic trials showed efficacy of buparvaquone @ J/M 2.5 mg /kg body weight and Calotropisprocera @ 0.3mg! Kg dose orally.8 doses on alternate days was 60% and 100% respectively. After completion of treatment with Cal otropis procera no tick infestation was seen while ticks were present on the body of animals treated with buparvaquone. With herbal treatment the animals showed diarrhoea for first 10-12 hours after administration of every dose on alternate days but animals recovered spontaneously without any antidiarrhoeal treatment. The results of CBC showed the characteristic macrocytic hypochrornic anemia in theileriosis was recovered by Calotropis procera treatment. The of result of LFT's and kidney function tests post treatment with Calotropis procera showed no toxicity of drug. In group C the characteristic signs of disease were noticed.
The results of prophylactive trials with both drugs showed delay of 23 days in the onset of clinical disease with buparvaquone while clinical disease was not seen in second group that was prophylactively treated with Calitropis procera. The in vitro trials with both drugs to check the acaricidal activity supported trials with Calitropis procera as having acaricidal within 3 hours while no such effect was noticed with bupasrvaquone in vitro trials.
Availability: Items available for loan: UVAS Library [Call number: 1033,T] (1).
Add to cart (remove)
Epidemiology Zoonotic Potential Haematology Amd Chemotherapy Of Sarcoptic Mange In Camel In Punjab
by Muhammad Irfan Zahid (2011-VA-800 | Prof. Dr. Azhar Maqbool | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr.Shazia Anjum | Prof. Dr. Kamran Ashraf.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2015Dissertation note: A camel is a very hardy ruminant animal, which can survive under harsh climatic
conditions very effectively by utilizing the marginal areas with excellent capabilities and produce
under such conditions (Hjort and Hussein, 1986; Abbas and Tilley, 1990). Camel is an important
animal as it is well adopted in unique manners in the hot, arid and semi-arid environments
(Schwartz, 1992). It can survive without water and food for many days and this unique ability of
camel makes it an ideal for such harsh conditions for which it is also commonly known as “The
Desert Ship”. In spite of the fact that camel is an important member of a group of animals which
produces food for human consumption in the shape of milk and meat, yet it is the most neglected
one in the field of scientific research. It may be due to the fact that camel belongs to such areas
of the world which are arid, semi-arid or rain fed in nature, having harsh climatic conditions,
where poor nutrition and poor management are the major issues (Sohail, 1983).
It is an established fact that diseases originating from parasites lead to the main health
hazard issues in animals. These parasites survive at the expense of the host animals causing lot of
health problems, like skin irritation, anemia leading to weakness and debility. Some of the
parasites have zoonotic importance and may become a source for the transfer of many contagious
diseases like scabies to the human beings (Dominguez et al. 1978). McClain et al. 2009,
observed the scabies as a major health problem globally both for humans and animal population.
Sarcoptes scabiei is an ectoparasite which is a cause of scabies, a skin problem in the human
beings worldwide and the similar species of mites do also produce a similar type of disease in a
large variety of wild and domesticated mammals (Pence and Ueckermann, 2002; Fitzgerald et
al. 2004). Fain, 1978, reported that more than fifteen (15) different species of Sarcoptes scabiei
morphologically and genetically distinct from each other have been identified in different hosts.
Introduction
2
Sarcoptic mange is the second important problematic disease of camel after
Trypanosomiasis (Nayel and Abu-Samra, 1986). Scabies caused by Sarcoptes scabiei var cameli
is a serious & highly contagious skin problem and also economically important disease of the
camels (Pegram and Higgins, 1992). Camels, which are reared with deficient nutrition, poor
management and under unhygienic conditions are mostly affected by this disease (Kumar et al.
1992).
A large group of people and communities living in arid diverse ecozones in the entire
world, particularly in harsh climates earns their livelihoods by depending on camels. This
dependence may spread to the utilization of camel milk, meat, wool and leather besides its use in
transportation, riding and sports (Wilson, 1984; Snow et al. 1992). In Pakistan camels are also
raised by the people for meat, milk, riding, transportation and sports purposes in the deserts, semi
desert & rain-fed / warm areas of the entire country being a hardy animal as it can tolerate easily
the rugged climate as well as extremes of temperatures of such areas.
The natural harsh and adverse climatic conditions, particularly during long dry seasons
lead to a paucity of feeding regimes resultantly the camels raised in such areas are subjected to
stress conditions which lower their resistance and make them easily vulnerable to diseases
(Abbas et al. 1993; Agab, 1993). Abbas & Tilley, 1990; Saint-Martin et al. 1992; Abbas and
Agab, 2002; Pathak and Chhabra, 2010; while reviewing the parasites & parasitic diseases of
camel population in India were of the opinion that Sarcoptic mange is a serious, debilitating,
dreaded and widely prevalent disease of camels in India.
Besides other infectious diseases of bacterial and viral origin, camels are exposed to a
wide range of internal & external parasitic infestations. Amongst other so many external
parasites to which camels are exposed, the Sarcoptic mange is recognized to be one of the most
Introduction
3
serious and damaging disease. This disease is caused by a mite known as Sarcoptes scabiei var
cameli which belongs to genus Camelus of SARCOPTIDAE family in Veterinary Entomology.
It is an extremely pruritic, contagious and debilitating skin disease which is very
frequently and sudden in onset. It is also ranked as one of the most serious and important disease
of the camels. Sarcoptic mange infestation is very common in the areas of thin skin, the head,
neck, flanks, medial aspect of thighs or inguinal region, mammary glands and prepuce. The head
is usually affected very rapidly as the animal uses its teeth for scratching the affected areas.
Besides linking the occurrence of the disease with poor camel management, malnutrition and
contact with infected objects, the stray & infected camels also often become a focus of infecting
the healthy animals when mingling with them particularly at watering places for drinking
purpose (Richard, 1987; Abdel-Rehman et al. 2001).
Sarcoptes is a burrowing mite as it penetrates deeply through the skin surface of the
infected camel. This burrowing of mites in the skin helps these parasites lead to intense pruritus
and exudative dermatitis. In pruritus, mites penetrate deep into muscular areas, damaging the
flesh and lowering the quality of meat. The early inflammatory reaction of the host body towards
the mites becomes evident in the shape of small popular elevations, invasion and injuries leading
to formation of hairless areas, scaly crust formation or scabs on the affected parts and the skin
become dark and thickened. Skin of mangy camel show hemorrhages, and subcutaneous odema
after the development of fissures in the underlying epidermis (Kumar et al. 1992; Amer et al.
2006).
The fertilized female mites create winding burrows or tunnels in the upper layers of the
epidermis of the skin of the host animal and feeding on the serous exudate, a liquid oozing from
the damaged tissues. The female mites lay about 40-50 fertilized eggs in these tunnels which
Introduction
4
hatch in 3-5 days into a six legged larvae. These larvae immediately crawl to the surface and
burrow themselves in the superficial layers of the skin and create small molting pockets. In these
molting pockets, the larvae molt to next stages of nymph and adult. The adult male then emerges
and seeks a female either in the molting pocket or on the surface of skin. After fertilization the
female produces new tunnels, either de novo or, by extension, of the molting pockets, lays eggs
in these tunnels and a new life cycle starts. The entire life cycle of Sarcoptic mange is completed
in 17-21 days.
New hosts can be infected through direct transmission by contact between the animals,
presumably from larvae, nymph or adult mites, which are commonly present on the skin surface
of the infected animal. Indirect transmission of infestation can also take place through the objects
or fomites having mange infection, which come into contact with the affected camel, such as
harnesses, blankets, baggage tack, tents and tree trunks (Richards, 1987). The pruritus increases
as the mites penetrate deeper in the skin (Al-Rawashdeh et al. 2000, Driot et al. 2011, Bekele et
al. 2012). Based on the rate of infection camels can be seriously disturbed by the Sarcoptic
infestation as they may stop grazing which can lead to a rapid fall in milk production, and
deterioration of health condition. With the increase in the irritation due to scabies, the camel
rubs, bites and scratches the affected areas in an attempt to reduce the itchiness. Due to rubbing,
biting or scratching, the mites move to the periphery affecting the healthy tissues and resultantly
affected area spreads. As the disease prolongs, the skin becomes excoriated, leading to hair loss
and the development of scabs. These scabs in turn may be rubbed away and a red surface
developed. The animal becomes restless due to severe Sarcoptic mange infestation and
involvement of most of the body surface. If the diseased animal is not treated in time, the animal
loses its health condition, become emaciated and within two, three weeks the acute stage of
Introduction
5
disease may give way to more chronic state (Gorakh et al. 2000, Abubakar et al. 2002, Driot et
al. 2011). Sarcoptic mites rarely survive long off the host under natural conditions.
A continuous direct contact of animal keepers with their camels can also lead to
transmission of diseased condition in human beings which is termed as pseudo scabies.
Transmission of infection from camel to man usually takes place during milking, handling or
riding. The main symptoms of pseudo scabies can therefore be seen in the inter digital spaces of
the hands, on the wrists, forearms, the elbows, the axillary folds and inner side of the thighs.
Once a herd is infected with Sarcoptic mange, continuous reinfection of the disease occurs
(Schillinger 1987, Singh & Veer 2005, Premalatha et al. 2010).
Sarcoptic mange is usually considered to be a seasonal disease and is often reported
severe during the winter months as in cold weather the disease had an acute course. However,
there is some evidence that in some countries hot weather predisposes to acute outbreaks of
camel mange and in the cooler, winter season the rate of mange infestations are at the lowest. In
the summer the activity of the mite seems to decline or disease becomes chronic. Dietary intake
is an important factor in mange infestation. Nomadic camels on a low nutrition plan, probably
carrying heavy worm burdens in hot desert conditions are likely, therefore, to be highly prone to
Sarcoptes at this time (Dinka et al, 2010). During such periods of great activity, the mites are
readily transmissible from one animal to other animals (Richards, 1987, Banaja & Ghandour,
1994, Tefera & Gebreah, 2001).
Mange can easily be diagnosed clinically from the occurrence of pruritus, depilation,
alopecia, thickened skin, folds around the joints and encrusted plaques being the main
characteristics of this parasitosis. In order to control this zoonotic disease, it is essential to treat
Introduction
6
both camel and man along with effective checks over other predisposing factors of the disease
such as hygiene and nutritional requirements of the animals.
The skin diseases like the scabies both in human beings and animals are being treated
with a variety of allopathic drugs now a day, but the role of herbal plants in use since centuries in
different shapes cannot be ignored at all, especially in the rural lifestyle. Further with the
continuous use of different acaricidal drugs, the issue of resistance development has come across
as a challenge for the researchers to find some alternatives for the purpose. Accordingly the
research work on the use of traditional herbal medicines is gaining attention day by day.
Although there are many reports and studies regarding the prevalence of Sarcoptic mange
in camel from different parts of the world, only few preliminary reports are available for Pakistan
and none of them provide detailed epidemiology of Sarcoptic mange and its effect on host
health. Therefore, keeping in view the importance of the mange problem in camel population of
the country, the present project was designed to determine the prevalence of Sarcoptic mange
infestation, factors in its occurrence its zoonotic importance, effect on blood physiology and
different treatment options in the camel population of Punjab, province in Pakistan. Availability: Items available for loan: UVAS Library [Call number: 2190,T] (1).
Add to cart (remove)
Epidemiology Zoonotic Potential Haematology And Control Of Amoebiasis In Dogs And Humans
by Muhammad Azhar Alam | Prof. Dr. Azhar Maqbool | Dr. Muhammad Lateef | Prof. Dr.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2130,T] (1).
Add to cart (remove)
Epidemiology, Molecular Diagnosis And Chemotherapy Of Giardiasis In Bovine
by Sultan Ayaz | Prf.Dr. Azhar Maqbool | Prof. Dr. Zafar Iqbal Chaudhary | Faculty of Veterinary Sciences.
Material type: ; Format:
print
Publisher: 2009Dissertation note: Giardia is a protozoan parasite of the small intestine that causes extensive morbidity worldwide. Dairy calves can excrete high numbers of the cysts of Giardia and the disease in cattle is clinically important and can reduce the growth performance of the ruminants. Giardia is the cause of non-viral diarrhoea in humans and is responsible for epidemics in the developed and developing countries. The cyst is the infectious form, is ingested in contaminated water or food or directly from faecal-oral contact. Giardia duodenal is the only species, which is found in both humans and animals including dogs, cats, bovines, pigs, sheep and equine.
The present study was conducted to determine the prevalence in bovines at Military dairy farm, Gawala dairy colonies, the Government dairy farm and Household dairies in Lahore. The effect of season, sex, and age on infection rate and shedding of the cysts were also noted, and association of the Giardia infection with normal and abnormal stools was also studied.
Overall 2160 bovine faecal samples (720 buffaloes, 720 cattle and 720 calves) were examined during the study period from August 2007 to July 2008, amongst calves 362/720 (50.27%) were found to be positive. The highest prevalence was recorded in the Government. Dairy farm (68.33%) followed by Gawala colonies (55%), then the Military dairy farm (44.33%) and the lowest (34.44%) was recorded in Household dairies. Overall, highest (61.6%) seasonal prevalence was recorded during autumn, followed by spring (60.83%), then summer (53.4%) and the lowest
(34.1%) was recorded during winter. The highest (65%) prevalence was reported during August and the lowest (3 0%) during December.
Females were found to be more susceptible (56.74%) than males (35.1%). The prevalence was significantly higher (71.52%) in younger calves than the adults
(36.11%) (P<0.05).
Overall prevalence in cattle was 28.05%. The highest (41.67%) prevalence was recorded at the Government dairy farm, followed by Gawala colonies (32.72%), then the Military dairy farm (22.72%) and the lowest (15%) was recorded in Household dairies. The highest (35%) prevalence was found during August and the lowest (21%) during January. A significant difference (P<0.05) was noted. Females were found to be more susceptible (29.21%) than males (18.75%). The young calves had significantly higher (3 8.88%) prevalence as compared to the adults (24.44%).
Similarly, the overall prevalence in buffaloes was found to be 20.11% percent. The highest (40.55 %), prevalence was recorded at the Government Dairy Farm, followed by Gawala colonies (30%) then Military Dairy Farm (21.11%) and the lowest prevalence i.e. 12.77% was reported in Household Dairies. A non significant difference was recorded P>0.05). The highest (46.66 %) prevalence was recorded during August, while, the lowest (6.66%) during November and December. Females were found to be more susceptible than males. Where as the prevalence in a younger buffalo was significantly higher as compared to the adults.
Comparison of direct microscopic examination and PCR based methods was made at the Government dairy Farm, Gawala colonies; Military Dairy Farm and
Household Dairies. By direct Microscopic examination prevalence was found to be 28.05% (202/720) in cattle whereas by PCR it was 31.11%. Statistically analysis showed that the prevalence by PCR was significantly (P<0.05) higher than the microscopic examination.
It was observed that the highest prevalence of Giardiasis in bovines (Calves, Cattle and buffalo) was noted during August when the average temperature was 31.48°C. However the maximum and minimum temperatures were 35.37°C and
27.6°C, relative humidity 7 1.28% and rainfall was 3.2mm. The results of therapeutic trials by using albendazole, metronidazole, and mebendazole in cattle were calculated on the basis of reduction in the cysts count in the faeces after treatment.
Efficacy of albendazole at three dose levels i.e. 1 Omg/kg.b.wt, 1 5mg/kg.b.wt, 2Omg/kg.b.wt was 86.33%, 98.5% and 100% respectively, on day 27 after treatment. Efficacy of the metronidazole at 5Omg/kg.b.wt, 1 OOmg/kg.b.wt, and 1 5Omg/kg.b.wt. Was 85.42%, 87.8% and 94.02% respectively on day 27. Efficacy of mebendazole at three dosage level i.e. 7.5rng/kg.b.wt, lOmg/kg.b.wt and 2Omg/kg.b.wt was 81.15 %, 87.32%, and 90.4% on day 27 after treatment. Among these drugs, albendazole at
1 5mg/kg.body.weight was found to be most effective drug in the elimination Giardia infection. The significant (P<0.05) decrease in the CPG count after treatment in all the three groups and dose levels was noted. A significant difference (P<0.05) was observed in the level of leukocytes and of eosinophisl of infected cattle at day 06 and day 13 post inoculation. The leukocytes/lymphocytes count of Giardia infected cattle was 58.09%. Whereas, eosinophils constituted of leukocytes 9.69%. The total proteins of the sample were studied by sodium doedocyl sulphate polyacrylamide gel ELECTROPHORESIS (SDS PAGE). The result indicated that 8 diffeent molecular weight peptide badns were identified with size ranges from 20 to 70 KDa and common bands reported at 20, 24 and 35 K Da
Availability: Items available for loan: UVAS Library [Call number: 1146,T] (1).
Add to cart (remove)
Epidemiology, Serodiagnosis And Chemotherapy Of Anaplasmosis In Cattle
by Farhan Ahmad Atif | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr..Muhammad Arif Khan.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2011Dissertation note: Anaplasmosis is globally distributed tick-borne disease of livestock with great
economic importance in cattle industry. The current project was designed to estimate the
prevalence of anaplasmosis, ticks and risk factors associated with seroprevalence of
Anaplasma marginale among cattle in Sargodha, Khushab and Rawalpindi districts,
Punjab, Pakistan. Moreover, haematological changes in A. marginale infected cattle and
efficacy of chemosterilization regimens were evaluated using locally available drugs for
the elimination of adult naturally infected carrier cattle.
A total of 1050 blood, serum and tick specimens were collected from randomly
selected small holders (n=90) and private livestock farms (n= 12) using multistage cluster
random sampling technique. A total of 30 union councils, 34 cattle farms (30 small
holders and 4 livestock farms) and 350 cattle were selected as primary, secondary and
elementary sampling units from each district. Sampling unit was indigenous and
crossbred cattle of both the sexes.
Microscopic examination of the Giemsa stained blood mears revealed an overall
prevalence of blood parasites as 21.14%. Anaplasma marginale was the highe t prevalent
(5.81 %) haernoparasite of cattle followed in order by Theileria sp. (5.14%) and Babesia
bigemina (4.76%), respectively. Crossbred cattle were more susceptible to TBDs as
compared to the indigenous cattle. Highest prevalence of TBDs was recorded in summer.
The prevalence of tick-transmitted diseases was higher in small holders (31.3%) than
private livestock farms (17.5%). Chi square analysis indicated a significant association
(P<0.05) among indigenous and crossbred cattle to selected TBDs. Wherea. non-
significant association between different age groups, seasons, sex and farm sizes were
revealed.
The overall seroprevalence of Anaplasma marginale in cattle using cELlSA was
31.05%. Seroprevalence was higher in crossbred cattle of more than 4 years of age and
there was a significant (P<O.OO I) association between different age groups and breed. The
seroprevalence was significantly (P<0.05) higher in summer season in Sargodha and
Khushab districts. Moreover, the seroprevalence was significantly higher in small holders
in all study districts.
The epidemiological data and relevant information regarding area, host and farm
management factors were collected on a questionnaire through interview from each dairy
farmer, attendant or manager from September, 2009 to August, 20 10. Multivariate
analysis of risk factors revealed that cattle of more than 4 year of age (OR=5.42), heavy
tick infested (OR =2.10), crossbred (OR = 1.59) cattle were significantly at higher risk for
seroprevalence to Anaplasma marginale. Presence of Rhipicephalus (Boophilus)
microplus (OR=3.70), use of ivermectin (OR=3.97), moderate interval of acaricide
frequency (OR= 16.50), stall feeding (OR=4.90) and use of unhygienic needles
(OR=24.00) were significantly associated with seroprevalence to Anaplasma marginale
in cattle (P<0.05). The Sargodha district was at higher risk (OR = 1.81) as compared to
Khushab and Rawalpindi.
The tick species identified from cattle were Hyalomma anatolicum anatolicum,
Rhipicephalus (Boophilus) microplus, Rhipicephalus sanguine us, Rhipicephalus
(Boophilus) annulatus and Haemaphysalis sp. The overall prevalence of tick infestation
among cattle was 54.76%. The highest prevalence (57.71%) of cattle tick infestation was tick infested sites in cattle followed by dewlap (92%), inner thighs (90%), neck & back (54%), tail (26%), ears (13%), around eyes (10%), flanks (4%) and legs (2%).
The haematological changes were studied at different levels of parasitaemia " 7%, >7-15% and> 15%) in Anaplasma marginale infected Sahiwal and crossbred cattle. There was a significant difference (P<O.OS) among total erythrocyte count (TEC), total leukocyte count (TLC), haemoglobin (Hb), packed cell volume (PCV), mean corpuscular
haemoglobin (MCH), mean corpuscular haemoglobin concentration (MCHC) at different levels of rickettsemia in both breeds. ignificant difference (P<O.OS) was noticed among RBCs, PCV and MCH blood parameters between Sahiwal and crossbred cattle.
A total of sixty Anaplasma marginale seropositive adult Sahiwal cattle were selected having their ages between 3-4 years ranging in weight from 246-341 kg. The animals were divided in four groups designated as OXY -group-I, E RO-group-II, IMC- group-III and control-group-IV, comprising IS animals each. The seropositive animals received oxytetracycline (22 mglkg IV once in a day for five days), enrofloxacin (S mglkg IV once in a day for five days) or imidocarb (S mglkg 1M twice, 7 days apart). Re ult of chemosterilization study indicated that oxytetracycline 13/1S (86.67%) and irnidocarb
dipropionate II/IS (73.33%) eliminated Anaplasma marginale infection in adult naturally infected carrier cattle on S6th day. The carrier clearance was confirmed by cELISA followed by subinoculation of blood in seronegative splenectomized calves.
It was concluded that TTBDs are widely distributed in Punjab, Pakistan. Host. management and area factors are involved with the seroprevalence of Anaplasma marginale in cattle. Haemolytic anaemia is the major haematological finding of Anaplasma marginale in cattle. Oxytetracycline is more effective and safe In chemosterilization of persistent Anaplasma marginale infection in cattle. There is a need for country wide epidemiological studies on ticks and TBDs using advanced serological
and molecular techniques. Moreover, the identification of the potential vector of anaplasmosis should be required for the effective prevention and control of anaplasmosis in Pakistan.
Availability: Items available for loan: UVAS Library [Call number: 1368,T] (1).
Add to cart (remove)
Epidemiology, Serodiagnosis, Therapy And Control Of Schistosomiasis In Buffloes
by Ghulam Murtaza Arshad | Prf.Dr. Azhar Maqbool | Pof. Dr. Haji Ahmad Hashmi | Prof.Dr.Muham | Faculty of Veterinary Sciences.
Material type: ; Format:
print
Publisher: 2008Dissertation note: Schistosomiasis is one of the major diseases of public health and socio-economic importance in the developing countries of the world. Among human parasitic diseases, Schistosorniasis ranks second to malaria in tern-is of world wide public health risk. Keeping in view the importance of disease, the study was conducted to record the month wise and season wise prevalence of Schistosorniasis in buffaloes in four districts of the Punjab, province ie., Lahore, Sargodha, Kasur and Sheikhupura. The present study comprises of four parts.
Part I: deals with epidemiology of Schistosomiasis in buffaloes. Overall prevalence of Schistosomiasis in buffaloes, different farms of Punjab province indicated that infection was the highest (17%) at Kasur district followed by Sheikhupura (14.83), then Lahore (14.6%) and the lowest (13.66%) at Sargodha. The highest month wise prevalence was recorded during August (25.5%) followed by July where as the lowest during December and January.
Infection in buffaloes was higher in animals over two years of age (1 9%) than animals below two years of age (5%) in all the four districts of Punjab. The prevalence was higher in females (15.98%) than male (9.48%). There is variation in the prevalence as there is difference in the environmental and managemental condition of the area. For the serodiagnosis i.e. ELISA was used, the results indicated that the prevalence was lesser than the faecal examination because this was more specific and sensitive than the faecal examination.
Part 2: deals with the prevalence and ecology of snails. Various species of snails which act as the intermediate host of the Schistosomes were collected from the study area. The e of infection in the snails and role of cercariae in transmission of the disease was studied. A total of 10418 snails were collected of these 13.51 per cent were found to be infected. Among these 2350 were collected from Kasur district with infection rate of 14.51 percent followed, by Sheikhupura 2882 (13.6%) then Sargodha 2709 (13.40%) and the lowest at Lahore 2477 (12.51%). At Kasur district, genus wise prevalence of snails with infection rate indicated that Oncomelonia, indoplanorbis and Bullinus are the predominant genera with infection rate of 31.79, 17.10 and 14.46 percent respectively. However the highest number of the snails collected belonging to the genera Indoplanorbis. At Sheikhupura district, genus wide prevalence of snail indicated that Bullinus, Lymnaea, Indoplanorbis and Physa are the four prominent snails with infection rate of 24.74, 20.57, 14.66 and 13.84 percent respectively. At Sargodha district, genus wise prevalence of snails indicated that Lymnaea, Indoplanorbis, Bullinus and Physa are the four prominent snails with infection rate of 25.09, 14.29, 14.28 and 16.77 percent respectively. At Lahore district, genus wise prevalence of snails indicated that Bullinus Lymnaea, Physa and Indoplanorbis are the four prominent snails with infection rate of 23.37, 18.96, 13.97 and 12.70 percent respectively.While the prevalence at the snail level the Chi square value is 242.944 and the P-Value is 0.0000 1 which is highly significant.
Part 3: deals with the meteorological data ie, temperature, humidity, rainfall and pan evaporation with prevalence of snails and parasites. The temperature and rain fall play very important role in the spread of disease. The ideal temperature ranges form 22-25 °C where development within snail takes place in an efficient manner similarly humidity
f ranges from 55-70% is ideal for the development of the snail and the parasite. Rainfall is very important for the spread of the disease. There is a positive correlation of disease incidence to maximum and minimum temperature, humidity, and rainfall and pan evaporation. It was seen that during summer and autumn, optimum temperature, relative
humidity and rainfall play an important role for rapid propagation of the parasitic life
Part 4: deals with therapeutic trials against Schistosomiasis in buffaloes. A total of 150 animals (140 infected and 10 animals, normal) age ranged 5-9 years and of both sexes naturally infected with Schistosorniasis were used in thirteen controlled experiments. The efficacy of certain indigenous drugs, including Nigella sativa (Kalongi) , Caesalpinia
Crista (Karangwa), Lagenaria siceraria seeds (Kadoo ke Beej), Sausseria lappa (Qushte-e-Shreen) and Praziquanlel was compared with each other and control. Efficacy was quantified by determining the difference of egg per gram faeces (EPG) pre and post treatment. After the single dose of 50, 75 and 100 mg 1kg body weight of Nigella sativa (Kalongi) reduced EPG by 65.85, 68.29 and 71.79 per cent, respectively. After the second dose the respective reduction in EPG was 85.36, 92.68 and 94.87 percent. Caesalpenia crista at three dosage levels i.e.50, 75 and 100 mgI kg body weight caused 46.34, 53.65 and 59.52 percent reduction respectively while the reduction in EPO after second dose was 82.92, 90.24 and 92.85 percent respectively. Lagenaria siceraria Seed at three dosage levels i. e., 50, 100 and 150 mg/ kg body weight caused the reduction in EPG reduction 47.61, 52.63 and 64.10 percent respectively, while after second dose, counts as the reduction 80.95, 86.84 and 92.30 percent respectively. Sausseria lappa at three dosage levels i.e., 100, 150 and 200 mg/ kg body caused EPG reduction as under 50.00, 53.48 and 56.09 percent respectively, while after second dose the reduction in EPG count was 71.42, 81.39 and 85.36 percent respectively. Where as Praziquantel at the dose of 10 mg/body weight caused reduction in EPO 66.66% while after the second dose the reduction in EPG count was 97.43 percent. The efficacy order was Praziquantel, Nigella saliva, Caesalpinia crista, Lagenaria siceraria and Sausseria lappa. No side effects with any drug were noted. All animals showed clinical improvement after the treatment.
Availability: Items available for loan: UVAS Library [Call number: 1150,T] (1).
Add to cart (remove)
Epidemiology, Zoonotic Potential, Haematiology And Therapy Of Toxocariasi In Dogs And Humans.
by Nisar Ahmad | Prof. Dr. Azhar Maqbool | Prof. Dr | Prof. Dr. Kamran Ashraf.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2010Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1505,T] (1).
Add to cart (remove)
Epidemiology, Zoonotic Potential, Molecular Characterization And Therapeutic Trial Of Leptospirosis In Horses
by Muhammad Luqman Sohail (2007-VA-94) | Dr. Muhammad Avais | Dr. Muhammad Yasir Zahoor.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Leptospirosis is an important zoonotic disease. It affects a wide range of mammals, fish and even a few reptiles. It is caused by Leptospira interrogans, having more than 250 serovars, distributed geographically throughout the world. In horses, Leptospira interrogans causes liver and renal abnormalities, ERU, and reproductive disorders in mares like abortion, perinatal death and still birth. It is transmitted to human beings, working with live or dead tissue of infected horses and through surfaces contaminated with urine of carrier or infected animals. In humans, it causes influenza like illness and death in severe cases. Serological testing, bacterial culture and molecular techniques are used for the diagnosis of disease. This study was aimed at estimating the seroprevalence of Leptospira spp. in horses and humans of three climatically distinct regions of Punjab, Pakistan. Furthermore, molecular biology techniques were employed for the confirmed diagnosis of equine leptospirosis and therapeutic efficacy of ampicillin and adhatoda vasica was analyzed against disease. It was the very first study in Pakistan conducted to explore equine leptospirosis in the country.
During this study, 384 horse blood samples and epidemiological data were collected from three climatically distinct regions, viz;Rawalpindi, Lahore and Bahawalpur (128 from each study area) and were subjected to ELISA to determine seroprevalence of Leptospira. Results showed overall prevalence of 33.85% in Punjab with highest prevalence in Rawalpindi (40.62%) which experienced highest rainfall, followed by Lahore (38.28%), and least in Bahawalpur (22.65%). Risk factor analysis showed that age, gender, living area, herd size, water source, exposure to rodents and floods, feeding practices and usage of animals were found significantly associated with the disease. To study the seroprevalence of human leptospira, 360 human blood samples were collected (120 from each study area). Epidemiological data on pre-structured questionnaire
Summary
140
were collected from all the participants of study. All the samples were subjected to ELISA and results showed overall prevalence of 40.83%, with highest seroprevalence in Rawalpindi (50.83%), followed by Lahore (38.28%) and least in Bahawalpur (27.50%). Age, gender, occupational and living area, water recreational activities, occupation, exposure to floods, educational status and history of wound were significantly associated risk factors while use of PPE during work was deterrent.
During this study, 65 ELISA positive horse samples were subjected to molecular biology diagnostic technique PCR for the molecular characterization of equine leptospirosis in country. After DNA extraction, PCR was performed using primer sets specific for 16S rRNA gene, which yielded a fragment of length 306bp after gel electrophoresis. Out of 65 tested samples, 20 samples (30.76%) were PCR positive and was further sequenced and phylogenetic tree was constructed. Dendogram showed the sequenced samples were related to pathogenic Leptospira interrogans, revealing potential of 16S rRNA primer sets for the detection of eqine leptospirosis in country. Dendogram further showed closed resemblance of analyzed samples with serovar Icterohemmorhagae, Australis and Autumunalis which are dominant serovars in India, Iran and China, the neighboring countries of Pakistan. Therapeutic efficacy of ampicillin and AV was studied by analyzing the hematology, liver function test, renal function tests and serum mineral levels at day 0 (pre-treatment), 7, 21 and 35 (post-treatment). Results showed that all the tested parameters were changed significantly during infection and significant improvement was observed after treatment. Ampicillin was instrumental in revealing hematological abnormalities while AV played important role in normalizing the liver and renal insufficiency. After treatment ampicillin treated 58.33% of animals and AV treated 41.66% of animals.
Summary
141
This first ever study of equine leptospirosis in country uncovers the high prevalence rates in horses and humans and raises a need for control strategies to prevent the transmission and spread of the disease. It also highlights the potential of molecular biology techniques for the confirmed diagnosis of equine leptospirosis and explores options for designing better specie specific treatment regimes for the disease. Availability: Items available for loan: UVAS Library [Call number: 2660-T] (1).
Add to cart (remove)
Epidemiology, Zoonotic Potential, Molecular Diagnosis And Chemotherapy Of Cryptosporidiosisin Bovine
by Sabiqaa Masood | Prof. Dr. Azhar Maqbool | Dr. Aftab | Prof. Dr. Zafar Iqbal Choudhry.
Material type: ; Format:
print
Publisher: 2011Dissertation note: Cryptosporidiosis is an important parasitic infection of cattle, buffaloes, goats, sheep, horses, cats, human beings and other vertebrates. Prevalence of Cryptosporidiosis in selected animals and human beings carried out on the basis of microscopic examination and polymerase chain reaction (PCR). Percent prevalence of Cryptosporidiosis determined on the basis of conventional identification method was highest in calves (23.1) followed by cattle (10.5) and buffaloes (8.47). Percent prevalence of Cryptosporidiosis in calves, cattle and buffaloes was higher at Government dairy farm (38.33, 20.55 and 16.66) followed by Gawala colonies (26.1, 12.77 and 9.44), Military dairy farm (18.3, 6.11 and 4.44) and then House hold dairies (10, 3.88 and 3.34). Percent prevalence recorded in calves having age less than six months was higher (26.45) than those with 7-12 months of age (16.6). Percent prevalence of Cryptosporidiosis in cattle having age of 2-3 years was higher than those cattle having 3-7 years of age. Similarly, infection rate was higher in buffaloes with 2-3 years age (11.8) than 3-7 years (9.8). Cryptosporidiosis percent prevalence recorded in female calves was higher (24.04) than male calves (18.2). Percent prevalence of Cryptosporidium oocysts observed in feces of male cattle was little higher (11.25) than female cattle (10.4). Cryptosporidiosis percent prevalence recorded in female buffaloes was higher (13.3) than male buffaloes (8.3).
The data was analyzed monthly for the purpose to trace out the specific period of the year having the highest prevalence rate of Cryptosporidium infection. The highest percent prevalence of Cryptosporidiosis recorded in fecal samples of calves was during summer (27.5) followed by autumn (25.8), spring (20.3) and the lowest in winter season (14.5). Overall the highest percent prevalence of Cryptosporidiosis in cattle recorded was during summer (15), followed by spring/autumn (10.88) and the lowest in winter (6.6%). The highest percent prevalence of Cryptosporidiosis recorded in buffaloes was during summer (12) followed by autumn (20), spring (7.5) and the lowest in winter season (4.5). In human beings patients suffering from diarrhea were examined by microscopy and percent prevalence calculated was 40 in present study.
Molecular percent prevalence rate determined was 12.22 in cattle. Percent prevalence recorded using PCR was the highest at Government dairy farm (22.7), followed by Gawala colonies (14.41), Military dairy farm (7.7) and the lowest at House hold dairies (5). The highest season wise percent molecular prevalence was observed during summer (16.6) followed by autumn/spring (13.3), the lowest in winter (7.7). The higher molecular percent prevalence in young cattle (2-3 years) was higher (23.7) than those having age between 3-7 years (10.7). Molecular percent prevalence of Cryptosporidiosis in selected cattle was lower in females (13.6) than males (15).
The efficacy of albendazole observed was 43.05, 58.7 and 64.6 percents on 13th, 20th and 27th day post treatment. The efficacy of albendazole determined on this dose was 34.8, 57.1 and 62.9 percents on days 13, 20 and 27 post therapy. Efficacy of drug calculated on days 13, 20 and 27 was 32.8, 53.3 and 56.6 percent, respectively. Percent efficacy of used drug was 55.04, 68.5 and 79.4 on days 13, 20 and 27 post treatment, respectively. At 50mg/kg body weight dose rate of paromomycin significant decrease in OPG count was recorded from 6th day post treatment and onward (P<0.05). On days 13, 20 and 27 percent efficacy of used drug determined was 48.1, 65 and 69, respectively.
Availability: Items available for loan: UVAS Library [Call number: 1678,T] (1).
Add to cart (remove)
Epidemiology, Zoonotic Potential, Serodiagnosis And Chemotherapy Of Sheep Fasciolosis In Different Ecological zones of balochistan
by Masood Ul Haq Kakar | Prof. Dr. Azhar Maqbool | Dr. Muhammad | Prof. Dr. Yasmeen Nawaz.
Material type: ; Format:
print
; Nature of contents: ; Literary form: Publisher: 2012Dissertation note: Various epidemiological aspects of human and sheep fasciolosis were investigated in four districts of Balochistan (Pakistan) having different ecology i.e. district Bolan from (Plain zone), Lasbela (Coastal zone), Qilla Saifullah (sub humid and semi arid sub zone of Upland zone) and district Pishin from (Arid sub zone of Upland zone). Sheep samples were examined through Coprological examination showed overall prevalence of 10.26% in one year study period from June 2010 t0 May 2011. The uppermost prevalence was recorded in district Bolan (14.79%) followed by Lasbela (10.63%), Qilla Saifullah (8.75%), and the lowest in district Pishin (6.88%). Overall the highest prevalence by season was recorded in autumn (25.31%) followed by winter (9.22%), summer (6.41%) and lowest in spring (5%). Amongst the month the overall highest prevalence was recorded in the month of September (30.63%) and lowest in the month of May (1.88%). Sex wise prevalence was found highest in female more susceptible to infection (11.22%) than male (8.48), but sex wise difference was non-significant statistically. Amongst the age group significantly higher prevalence was recorded in adults young than adult of age group (5.91%).
During one year study period prevalence (%) of human fasciolosis in some districts of Balochistan was recorded (0.42%), with overall district wise prevalence in Qilla Saifullah and Bolan (0.83%) and (0%) in Lasbela and Pishin. Overall season wise prevalence was noted the highest in autumn (1.25%) followed by summer (0.63%) and 0% prevalence in winter and spring. Month wise results showed 2.5% prevalence only in the month of August and October while 0% in the other months. Gender wise prevalence 0.42% was
found only in male, no female samples were collected due to some religious, traditional and community problems. Prevalence by age was recorded the highest in above 20 years of age group (0.74%) while this value decreased to zero in below 20 years of age group.
Antibodies against fasciolosis in serum samples through indirect (ELISA) were recorded 13.13% (63/480) in sheep and 0.42% (2/480) in human indicates the higher prevalence (%) as compared to fecal examination. Likewise district, age and sex wise seroprevalence (%) of fasciolosis was reported higher than coprological examination in case of humans as well as in sheep.
In sheep positive correlation was noted between fasciolosis and relative humidity while negative correlation with temperature (ºC) and rainfall (mm). While in humans prevalence positive correlation was observed with temperature (ºC), relative humidity (%) and rainfall (mm).
Overall 1123 snails belonging to different 5 genera were collected from different district from different agr-ecological zones of Balochistan from June 2010 to May 2011. Amongst the snails the highest prevalence (37.04%) was found for Indoplanorbis, followed by Bulinus (32.15%), then Lymnea (20.66%), Melanoides (5.52%) and the lowest Physa (4.63%).
Comparative study for coprological and serological tests (ELISA) was conducted for four districts from different agro-ecological zones of Balochistan i.e. District Bolan from (Plain zone), Lasbela (Coastal zone), Qilla Saifullah (sub humid and semi arid sub zone of Upland zone) and district Pishin from (Arid sub zone of Upland zone) for one year i.e. from June 2010 t0 May 2011. Overall prevalence of sheep and humans was 0% and 8.13% by coprological examination and 13.13% and 0.42% by indirect ELISA tests. Prevalence by ELISA was found higher than fecal examination when analyzed statistically. Similar seroprevalence for month, districts, age and sex was noted higher than coprological examination for sheep and humans. ELISA Sensitivity (%) and specificity (%) was recorded >97.0% and 95% and 100%, 100%, respectively for sheep and humans.
Indigenous plants i.e., Saussurea lappa (roots), Fumaria parviflora (aerial) and Caesalpinia crista (seeds) were used at dose level of 60, 70 and 80 mg/kg body weight against naturally infected sheep with fasciolosis and their effectiveness was compared with triclabendazole (10mg/kg body weight). Triclabendazole was found 100 % effective after second dose whereas all herbal medicine it reached up to this mark after administration of second dose of 80 mg/kg body weight. From this study we can conclude that these herbal medicines can safely replace the triclabendazole, which is not, only cost effective but have no side effects.
Availability: Items available for loan: UVAS Library [Call number: 1587,T] (1).
Add to cart (remove)
Epidemmiology Of Foot And Mouth Disease In Buffaloes Of Punjab Province
by Farhat Nazir Awan | Prof. Dr. Khushi Muhammad | Prof. Dr. Muhammad Akram Muneer.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2009Dissertation note: This study indicates that the ranking order of buffalo diseases, with respect to their incidence in descending order in Punjab province is Foot and Mouth Disease, Mastitis, Diarrhea, Haemorrhagic Septicemia, Sudden Death Syndrome and haemoglobinuria. Similarly the disease ranking order in cattle in descending order is FMD, Mastitis, Diarrhea, Hemorrhagic Septicemia, Haemoglobinuria and Sudden Death Syndrome. FMD is top most economic important disease both in buffaloes and in cattle in the province.
Morbidity rate in the adult cattle and buffalo was higher as compared to the younger stock. However, the mortality rate was higher in young stock as compared to the adult animals of both the species. Moreover, adult and young males of both the species were more susceptible to the disease as compared to females.
Cross-sectional survey revealed the economic loss of Rs. 41.32 million due to loss of milk, cost of dead animals and treatment cost of sick and complicated cases of FMD. The loss due to milk reduction was 57.3% of the total losses followed by mortality loss (26.4%), morbidity effect expenses (15.2%) and treatment charges in FMD complicated cases (1.0%). The findings of present study clearly indicate the association of age, feeding pattern, vaccination status and season as risk factors in the incidence of FMD in Punjab.
Data obtained from the EPI-Unit Lahore showed that 719 FMD outbreaks occurred in the district of Punjab during 2007-2008. The highest number of outbreaks (212) was recorded in Rahim-Yar-Khan followed by Bhakkar (118), T.T. Singh (81) and Faisalabad (72). Of the total 309 disease outbreaks in buffalo, 174 (56.3%) were recorded in adults, whereas this number in cattle was 169 (61%). The incidences of the outbreaks increased gradually following the post-monsoon period. The greatest number of outbreaks was observed during the winter season, from December to February. Data from FMD Research Center, Lahore revealed the involvement of only FMDV serotype "O" in all the outbreaks during 2007-2008.
Studies of the factors (age, feeding pattern, stage of pregnancy and species) on the immune response of local trivalent FMD vaccine revealed that buffaloes of all age groups responded well to vaccination against disease. It was also observed that 7-9 months pregnant buffaloes elicited significantly lower antibody response to vaccine as compared to the control groups. Similarly, buffaloes on grazing have shown lower anti-FMD-CF GM titer as compared to buffaloes on manger feeding. Sheep and goat were found to be late and poor responder to vaccine as compared to cattle and buffalo.
Analysis of 300 serum samples from FMD affected buffaloes of 12 districts of the Punjab indicated the highest incidence of serotype "O" (62.3%) followed by Asia-1 (32.4%) and "A" (3.30%) in the population tested.
FMD virus was inactivated at 61 ºC within 15 minutes and at pH 4, 8, and 10 within 24 hours. However, ultraviolet radiation was unable to inactivate the virus even after 45 minutes. The disinfectants/chemicals evaluated in this study including sodium hydroxide, sodium carbonate, citric acid, acetic acid, formalin, sodium hypochlorite, virkon-s, aldekol and Gas-G were effective in inactivating the FMDV at recommended concentration levels of 2%, 4%, 0.20%, 4%, 0.15%, 3.0%, 1.0%, 0.50% and 0.1% after 60, 30, 60, 60, 30, 30, 30, 60 and 30 minutes, respectively, at 300C. Sodium hypochlorite and Gas-G were equally good in inactivating the virus at half (1.5% and 0.05%) of the recommended concentration.
Efficacy trial of local and imported oil based trivalent FMD vaccine in six villages, of the Faisalabad district clearly showed that 81.8% of FMD cases were prevented by the local inactivated vaccine in vaccinated animals whereas; this percentage was 70.6 in case where imported vaccines were employed. Moreover, efficacy of the local vaccine was higher than the imported vaccines.
Availability: Items available for loan: UVAS Library [Call number: 1537,T] (1).
Add to cart (remove)
Epidemological, Serological, Heamatological And Therapeutic Studies On Ovine Nematodiasis In Three Ecological Zones of Balochistan
by Abdul Razzaq | Prof. Dr. Kamran Ahraf | Prof. Dr | Prof. Dr. Azhar Maqbool.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2012Dissertation note: The main area of research in this study was to assess the prevalence, hematological and serological aspects of ovine nematodiasis. Four main experiments were conducted to highlight the objectives of the present research study.
First experiment was conducted to find out the prevalence of sheep major nematodes for one year (January-December 2011). For this purpose three sheep breeds i.e., Balochi, Babrik and Harnai (either sex and between 1-5 years age groups)were selected randomly from three sites i.e., Quetta, Ziarat and Loralai. Faecal analyses of these sheep showed overall higher (40.25%) nematodes prevalence at Loralai followed by Ziarat (29%) and Quetta (23.92%). Five nematodes infection were recorded at three experimental sites. Among these, H. contortus (5.58 to 10.42%)and was the higher prevalent followed by N. battus (6.92 to 9.33%), S. papillosus (4.42 to 9%), T. colubriformis (2.33 to 7.33%) and T. ovis (1.83 to 6.83%).The nematodes prevalence was higher in one and five years old sheep. The female-sheep were infected with higher nematode prevalence higher the than male once and sometimes non-significant difference. These five nematodes were prevalent almost throughout the year; however, a peak infection was recorded during August/September. The high temperature, rainfall and humidity during these months may be predisposing factor of higher prevalence.
Second experiment was on diagnosis of sheep nematodiasis through Enzyme-linked immunosorbent assay (ELISA). For this purpose H. contortus and T. ovis positive samples (200) based on coprological examination were also indicated 100% positive sensitivity by the ELISA based on crude somatic antigen, while on excretory antigen based showed lower (92%) sensitivity. The sera (n=200) of non-infected sheep (based on coprological examination) showed marked difference results. Such as 168 (84%) and 166 (83%) samples were found positive with H. contortus and T. ovis, respectively. While, based on crude somatic antigen 158 (79%) and 144 (72%) samples were found positive with H. contortus and T. ovis, respectively.
Third experiment was conducted to determine the hematological values and total serum protein indices in healthy and nematodes infected sheep. The statistically significant (P<0.05) difference in PCV, Hb, RBC, WBC, Eosinophil, ESR and Total serum protein values was observed among healthy and nematode infected sheep groups. While, there was no statistically significant (P<0.05) difference in TLC, Lymphocytes, Neutrophil, Monocytes and Basophils counts in healthy and nematodes infected sheep groups.
Fourth experiment was conducted on assessing the comparative efficacy of synthetic (Oxfendazole and Ivermectin) and locally manufactured herbal medicine (Deedani, Kirmar and Atreefal Deedan) anthelmintics against sheep nematodes at AZRC/PARC Range-livestock Research Station Sanjavi district Ziarat. The present study results regarding the comparative efficacy showed that, Atreefal deedan among herbal products (Deedani and Kirmar) and Ivermectin than Oxfendazole was found effective against sheep nematodes. The sheep treated with Ivermectin showed highest (96%) FEC reduction, followed by Oxfendazole/Atreefal deedan (86%), Kirmar (60%) and Deedani (32%).
Availability: Items available for loan: UVAS Library [Call number: 1613,T] (1).
Add to cart (remove)
Evaluation Of Different Extenders For The Cryopreservation Of Buffalo Bull (Bubalus Bubalis) Semen
by Dawar Hameed Mughal | Prof. Dr. Ijaz Ahmad | Prof. Dr. Muhammad Aleem.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2011Dissertation note: Buffalo is playing an important role in our country's economy by producing milk, meat and draught power. Genetic potential of low producing animals can be improved by using artificial insemination technology. Unfortunately, less number of elite bulls are available and low fertility rate of buffalo by using cryopreserved semen has been obtained. Semen is exposed to osmotic and oxidative stresses during processing, cryopreservation and thawing before insemination. Fertilizing ability is lost due to spermatozoa damage and it ultimately results in poor conception rates in buffalo. In order to protect spermatozoa from these stresses and improve fertility in buffalo, five osmotic pressure based concentrations of three extenders i.e. Citrate egg yolk extender (CEYE), Tris egg yolk extender (TEYE), and Lactose egg yolk extender (LEYE) were prepared by varying the quantity of the solutes to obtain an osmotic pressure of 255, 265, 275, 285 and 295 mOsm/kg. Osmotic pressure was measured by an osmometer.
In the first experiment, equal volume of semen obtained from four Nili-Ravi buffalo bulls was pooled and used to study the effects of osmotic pressure on post thawed semen characteristics. For this purpose, three basic media: citrate fructose media, tris citric acid fructose media and lactose media were prepared and divided each media in to five equal parts to maintain osmotic pressures of 255, 265, 275, 285 and 295mOsm/kg. These basis media were stored in a biomedical freezer, which were later used in preparing three semen extenders i.e. Citrate egg yolk extender (CEYE), Tris egg yolk extender (TEYE), and Lactose egg yolk extender (LEYE). During each collection, fifteen extenders (each of three extenders having five osmotic pressures i.e. 255, 265, 275, 285 and 295mOsm/kg) were used to extend the semen. After freezing, semen characteristics like sperm motility rate, viability rate, acrosomal integrity rate, plasma membrane integrity (PMI) rate, MTT reduction rate, sperm DNA integrity rate and lipid peroxidation were noted. Post thaw sperm motility rate in (%) CEYE was significant (P<0.05) at 295mOsm/kg compared to 255, 265 and 275mOsm/kg. However, sperm motility rate of different osmotic pressures of TEYE and LEYE was non-significant (P>0.05). Sperm viability rate (%) was non-significant (P>0.05) in all three extenders. Sperm acrosomal integrity rate was non-significant in CEYE and LEYE. However, it was significant (P<0.05) at 265, 275 and 295mOsm/kg in TEYE. Sperm PMI rate, MTT reduction rate, sperm DNA integrity rate and lipid peroxidation were non-significant (P>0.05) in CEYE, TEYE and LEYE.
On the basis of the individual and overall comparison of different semen characteristics of three extenders and their osmotic pressures, LEYE with 295mOs.kg was considered to be continued in the next experiment to upgrade the extender by adding taurine (TA) at 0.0, 30, 50 and 70 mM and trehalose (TR) at 0.0, 20, 40, 60 mM concentration. Semen collection, processing, freezing etc were done as per experiment-1 and same post thaw tests were carried out. Post thaw sperm motility rate was significantly (P<0.05) higher at TA-0.0 and TA-20mM and all concentration of TR. Sperm viability rate, acrosomal integrity rate, PMI rate, MTT reduction rate and lipid peroxidation at different concentrations of TA and TR were recorded non-significant (P>0.05). However, sperm DNA integrity rate was significant (P<0.05) higher at TA-0.0 and TR-0.0mM.
On the basis of comparison of different semen characteristics under various concentrations of taurine or trehalose, supplemented in semen extenders. Concentration of TR-70mM was considered to be continued in the next experiment to test fertility of the optimized extender.
Semen straws of LEYE supplemented with TR-70mM were used to inseminate the 50 buffaloes in heat (Supplemented group), while, traditionally used tris based buffalo bull semen extender was used (control group) to compared pregnancy rate (PR) of this experiment. Pregnancy rate in control and supplemented group was 38 and 54% respectively, which was statistically non-significant (P>0.05).
Availability: Items available for loan: UVAS Library [Call number: 1538,T] (1).
Add to cart (remove)
Expression And Mutational Analysis Of Breast Cancer Susceptibility Gene 1 (Brca1) And Cyclooxygenase-2 (Cox-2) Gene In Feline And Canine Tumours
by Haleema Sadia (2007-VA-567) | Dr. Muhammad Wasim | Prof. Dr. TahirYaqub | Dr. Abu Saeed Hashmi.
Material type: ; Literary form:
not fiction
Publisher: 2014Dissertation note: Cancer is the first cause of death in cats and dogs while in human it is the second most cause of death (Jemal et al. 2008). According to an estimation, cancer related deaths in the world are 13% and 70% of these deaths are in poor countries (World Health Organization 2012). Such natural cases of cancers in cats and dogs especially, in dogs offer an opportunity to use the dogs for comparative cancer studies and as an animal model for anticancer drug development (Pawaiya 2008). Inu a series of more than 2000 autopsies, it was found that almost forty five percent dogs that lived for ten or more years expired because of cancer (Bronson 1982). Dogs are affected by skin cancer 35 times more often than humans. They are also affected 4 times more often by mammary gland cancer, 8 times more often by bone cancer, and twice more often by leukemia, than humans (Cullen et al. 2002). The regulation of cell proliferation, genome stability and programmed cell death are important for systemic homeostasis.
1.1Historical perspective on cancer causation
Hippocratic and Galenic medicine attributed the spread of black bile (one of the four humours) in the tissue as the cause of the cancer (Diamandopolus 1996) is an idea survived intact through the Middle Ages and Renaissance. With the discovery of the lymphatic system by Gasparro Aselli in 1662, the black bile theory was superseded by the idea that cancer was an inflammatory reaction to extravasated lymph; a theory modified 150 years later by John Hunter who introduced the notion that contaminated coagulating lymph was the origin of the cancer (Kenneth 2003). A German pathologist Johannes Muller first time demonstrate that cancer is made up of cells (1838) but he also gave an idea that cancer cells were originated from a bud called Blastema instead of normal cells (Kardinal and Yarbro 1979). Following Schleiden and Schwann's cell theory of tissues,it was Rudolf Virchow (Muller’s student) who in 1855 demonstrated that every cell was derived from another cell (omnis cellula e cellula), including cancer cells (Mazzarello 1999; Porter 1999). In 1867 Wilhelm Waldeyer supported the theory of the normal cell for the origin of cancer and he believed that metastasis resulted from transportation of cancer cells by blood or lymph (Porter 1999).
Around the turn of the twentieth century the beginning of tumour transplantation experiments led to the new view of the cancer cell as an autonomous cell. The first successful tumour transplants were described in 1876 by the Russian veterinarian Mstislav Aleksandrovich Novinski (Novinski 1876). He reported in his thesis entitled “On the Question of the Inoculation of Malignant Neoplasms” the first successful serial passage of tumours through transplantation in dogs. Novinski's transplantation experiments were based on the inoculation of canine transmissible venereal tumour (CTVT) in puppies. Novinski stated that successful tumour transplantation depends on the inoculation of a living element of the tumour and that the transplantation of the element of a cancerous tumour to healthy tissue acts as an infecting agent. In 1888 Wehr repeated Novinski's transplantation experiments in dogs with similar results (Shimkin 1955). It is interesting to note that the dogs used for transplantation of CTVT did not come from a single breed and were therefore not highly inbred. The allo-transplantation of tumours seemed less surprising in the late 19th Century than it does today with our modern knowledge of histo-incompatibility.
The successful results obtained with CTVT served as model for tumour transmission in other animals. Hanau in 1898 inoculated two rats with vulvar epidermoid carcinoma and observed growth of the tumour in the recipients (Shimkin 1955). In 1901 Leo Loeb supported the transplant ability of tumours in rats (Witkowski 1983; Brent 1997). In 1903 a Danish veterinarian Carl O. Jensen determined the successful growth of transplanted tumours in mice by heredity (Brent 1997). The discovery that the tumour could be successfully transplanted into (Witkowski 1983; Brent 1997) other mice, led the scientists to use rodent system to supply tumours for experiments. The observation that a single tumour could be expanded through many generations exceeding the life span of the laboratory mouse led Leo Loeb to the "cancer immortality" concept (Witkowski 1983).
The earliest observations reported by John Hill in 1759 and by Percival Pott in 1775 on the association of a specific tumour to a specific profession or work, led to the idea that some chemicals can cause cancer (Greaves 2000). In 1918 Yamagiwa and Ichikawa induced cancer by applying coal tar to rabbit skin(Greaves 2000; Luch 2005). After the discovery of the X rays by Wilhelm Conrad Roentgen in 1895, Frieben published data in 1902 indicating that cancer rates were increased among persons working with X-rays (Cassileth 1983; Greaves 2000)
1.2 Tumour Progression
The first detailed characterization of the dynamic nature of cancer was described by Leslie Foulds (Foulds 1949). Foulds showed that tumours progress (evolve) through different stages, characterized by the acquisition of different phenotypic traits such as increased growth rate, hormone dependence, invasiveness, formation of metastasis (Foulds 1949; Fould 1954; Foulds 1957). With the progress of molecular biology the phenotypic view had been replaced with the somatic mutation theory, where cancer evolved through the accumulation of different mutations in several genes (Greaves 2000). The accumulation of mutations in somatic cells implicated the presence of different cells bearing different mutations and also the presence of natural selection, which selected the cells with advantageous mutations. One of the questions arising from the somatic mutation theory was whether a tumour had a single or a multiple origin.
This observation was supported by a karyotype analysis in chronic myelogenous leukaemia (CML) by Peter Nowell and David Hungerford in 1960 (Nowell 2002). They described the presence of an unusually short chromosome 22 in all CML tumour cells analyzed, and the absence in the normal cells from the same patients. This observation suggested that this mutation was a somatic mutation that occurred in one cell in the bone marrow, which gave it a selective advantage to expand as a clone. Nowell postulated that a tumour develops by a Darwinian evolutionary process, where cells with mutations conferring a growth advantage are selected and expanded (Nowell 1976; Greaves 2002). In 1954 Peter Armitage and Richard Doll analyzed human cancer incidence over the age, and showed that chances of cancer increased in older people (Armitage and Doll 1954).
The concept that cancer might be contagious also recurs throughout the past 300 years.In the 17th and 18th centuries, physicians Daniel Sennert and Zacutus Lusitanus supported the hypothesis that cancer was contagious. In fact in 1779 a hospital in Paris was directed to move the cancer patients from the city (Cassileth 1983; Kenneth 2003).
1.2.1 Exogenous and endogenous factors
In 1844 the Italian physician Domenico Antonio Rigoni-Stern noted that cancer of the cervix was frequent among married ladies, rare among unmarried ladies and absent in Italians nuns. In contrast, breast cancer was more frequent among nuns (Greaves 2000). These observations led to the hypothesis that cervical cancer was sexually transmitted, and we now know that the cause is a papilloma virus (Hausen 2002).In 1908 Wilhelm E and Olaf B, transferred the leukemia in chicken by tissue filterates (Wyke 2003). In 1911, Peyton Rous demonstrated that viruses were the cause of solid tumours (Sarcoma) in chickens but it took many decades before his data were accepted (Dulbecco 1976). The notion that viruses can cause cancer was a discovery that brought back the fear that cancer was a contagious disease.
There are many exogenous and endogenous risk factors that affect the tumor suppressor genes and oncogenes (Todorova 2006). Tumour viruses (Bishop 1980), chemical carcinogens (Loeb et al. 2000), natural chemicals, (Ames et al. 1990), herbicides (Glickman et al. 2004), physical carcinogens like radiation (Upton 1978) are exogenous factors while inherited genetic defects, immune system (Rosenthal 1998) and hormonal factors (Rodney 2001) are among endogenous risk factors.
Although tumour cells are generally described as independent evolving units, recent results suggest that tumour cells are able to stimulate stromal cells to produce growth factors that increase tumour proliferation (heterotypic stimulation) (Kinzler and Vogestein 1998; Skibe and Fuseing 1998; Iyengar et al. 2003). It has been demonstrated that cells involved in the immune response to tumours may produce factors such as inflammatory chemokines that may also promote the tumour proliferation (Pollard 2004; Wyckoff et al. 2004)
1.2.2 Two hit hypothesis
Retinoblastoma is a tumour that becomes manifested early in life. Retinoblastoma can be inherited or sporadic. According to the two hit hypothesis in the inherited form a single mutation in the Retinoblastoma (Rb) gene is present in the germ line which gives the genetic predisposition to develop cancer, but a second mutation in the normal Rb allele which occurs in the retinoblast must be acquired to develop cancer (Knudson 2001). In the sporadic form the two mutations in the Rb alleles occur in the somatic cells. Although the epidemiological and molecular observations have consolidated the multistage theory of cancer, the number of mutations and in which sequential order they have to be acquired to develop cancer is still an open question (Hanahan and Weinberg 2001; Hahn and Weinberg 2002b).
1.2.3 Oncogenes
Early experiments involving transforming retroviruses and the transfer of genes from tumour cells into established rodent cells allowed the identification of several cancer causing genes called oncogenes. The result of these experiments suggested that cancer could be induced by the mutation of one proto-oncogene. However, the rodent cells used as recipient in the gene transfer experiments were not normal, but were immortalized, thus acquiring the ability to proliferate indefinitely. When the normal rodent cells were used, the transfer of a single oncogene failed to induce transformation, while the transfer of two oncogenes resulted in transformation. Human cells require more mutations than rodent cells and that there are differences also between cell types within the same species (Rangarajan et al. 2004).
1.3 Cancer Hallmarks
Despite the enormous variety of tumours affecting different types of tissues in animals and humans, research over the past 50 years has revealed that all malignant cancers share the same essential alterations (Hanahan D and Weinberg RA 2000).
These hallmarks include:
Immortalization
Evasion from programmed cell death (apoptosis)
Independence from growth stimulation
Resistance to growth inhibition
Angiogenesis
Invasion and metastasis
Genetic instability.
These hallmarks are briefly described below.
1.3.1 Immortalization
Telomeres contain DNA sequence repeats and protein. The repeat sequence consists of hexameric motifs such as GGGTTA in humans, extended for 10 –20 kilobases. The 3’ end has a 100-400 nucleotide over-hang (Mathon and LIoyd 2001). Telomeric DNA is generated by an enzyme called Telomerase Reverse Transcriptase (TERT) which has two subunits, RNA and catalytic protein subunit. This RNA binds the telomeres DNA ends thus acting as template for telomere elongation. The chromosome ends are protected by several proteins: TRF-1, TRF-2, and POT–1 (Mathon and LIoyd 2001; Hahn and Weinberg 2002a). Several experiments have shown that senescence is activated when the telomeres are shortened down to 5 kb and that senescence is triggered by the shortest telomere present in the cell (Hemann et al. 2001).
Many reports have suggested that the replicative senescence is not activated by the erosion of the double strand repetitive sequence, but by the degradation of the 3’end single strand overhang, resulting in loss of protective capping (Stewart et al. 2003). Telomere length is maintained by the activation of telomerase or by an alternative mechanism called alternative lengthening of telomeres (ALT), where the telomeres are regenerated through recombination-based inter chromosomal exchange of sequence information (Bryan et al.1997; Dunham et al. 2000). In the normal cell telomerase is transiently expressed, since it can be detected only in S phase, but in neoplastic cells its expression is increased and is detectable throughout the cell cycle (Mathon and Lloyd 2001). In tumour cells the senescence and crisis barriers are avoided by the activation of telomerase regenerating the telomeres and by the inactivation of tumour suppressor and pro-apoptotic genes (Hanahan and Weinberg 2000; Hahn and Weinberg 2000b).
1.3.2 Apoptosis.
The sensors detect the intra- and extra-cellular signals. The intracellular signals include DNA damage, hypoxia and oncogene overexpression (Evan and Littlewood 1998). The extracellular signals monitor the cell-cell and cell-matrix homeostasis (Aoshiba et al. 1997; Prince et al. 2002; Alberts et al. 2002a). The signals detected by the sensor are mainly conveyed to the mitochondria, where a series of cytoplasmatic proteins of the Bcl2 family control the release of cytochrome C from the mitochondria (Alberts et al. 2002a). The release of cytochrome C activates an array of intracellular proteases called caspases causing protein and DNA degradation (Hanahan and Weinberg 2000). The caspases can be directly activated by extracellular proteins such as FAS ligand, which binds to the death receptor FAS (Houston and O’ Connell 2004).
Once the caspase cascade is triggered it cannot be inactivated (Alberts et al. 2002a). It has been reported that the tumour suppressor p53 can trigger the caspase cascade by the overexpression of the Bax protein, a member of the Bcl2 family, which in turn increases cytochrome C release thus inducing apoptosis (Hanahan and Weinberg 2000). In CTVT it is likely that expression of c-myc is up-regulated, due to insertion of a LINE-1 element as discussed later. Ectopic c-mycexpression can promote tumour growth and survival, as seen, for instance, in immunoglobulin gene c-myc chromosome rearrangements in Burkitt's lymphoma (Hemann et al. 2005).
1.3.3. Independence from growth stimulation
1.3.3.1. Growth factors
Thus the proliferation of a cell is dictated by the needs of the cells around it (Hanahan and Weinberg 2000). In contrast, a tumour cell escapes from the external dependence to become an autonomous evolving unit, by producing its own growth signals.
1.3.3.2 Growth factor receptors
Another mechanism selected by tumour cells is the overexpressions of growth factor receptors, which induce the tumour cells to become sensitive to concentrations of growth factor that normally, do not trigger proliferation (Hanahan and Weinberg 2000). Proliferation can also be induced by a mechanism independent of the growth factor, for example the alteration of the cytoplasmic tail of growth factor receptor causes self-activation of the receptor, which therefore becomes independent from the external microenvironment (Alberts et al 2002b).
1.3.4 Resistance of growth inhibition
Like growth signals, the anti-proliferative signals derive from soluble factors or surface proteins that are produced by neighbouring cells, or are induced by components of the extracellular matrix (Hanahan and Weinberg 2000; Alberts et al. 2002d). These external inhibitory signals activate different intracellular pathways that regulate the cell cycle (Alberts et al. 2002c).
The Rb protein and its related proteins, p107 and p130 play a key role in controlling this transition (Weinberg 1995). The association of Rb with the transcription factor E2F inhibits the transcription of genes involved in the G1-S progression (Alberts et al. 2002c). The hyper-phosphorylation of the Rb protein induces the dissociation with E2F, therefore allowing progression to S phase (Alberts et al. 2002c). Normally complexes of cyclin and cyclin dependent kinase (CDK) induce the phosphorylation of the Rb protein (Alberts et al. 2002c). Many tumours can avoid the antigrowth signals by altering Rb activity or the proteins involved in Rb phosphorylation (Mittnacht 2005).
1.3.5 Angiogenesis
Although the majority of the new vessels in adult tissues are derived by sprouting from existing vessels, many evidences indicate that progenitor endothelial cells are derived from the bone morrow contributing to the vessel growth (Zhang et al. 2000; Contreras et al. 2003; Nishimura and Asahara 2005; Religa et al. 2005). Although endothelial cells are highly proliferative in response to several angiogenic factors, they have long half-lives up to several years (Carmeliet 2003). In order to adapt the vascular system to the tissue's requirements, several mechanisms regulate the process of angiogenesis (Carmeliet 2003). A key molecule involved in the angiogenesis process is the vascular endothelial growth factor (VEGF) (Carmeliet 2003). In addition it has been demonstrated that tumours can activate or inactivate pro- and anti-angiogenic factors respectively present in the extracellular matrix by producing several proteases (Gately et al. 1997; Harlozinska 2005).
1.3.6 Metastasis
In cancer during tumour progression, some tumour cells acquire the ability to migrate and form new colonies at secondary sites and these cells then make new tumour cells (Hanahan and Weinberg 2000). It has been estimated that 90 % of mortality associated with cancer is due to metastasis (Sporn 1996). Results show that few cells in the primary tumour acquire the ability to grow in the secondary sites and that the tendency to metastasise is acquired in the early steps of tumour progression (Van’t Veer and Weigelt 2003).
Progressive alteration of normal tissue homeostasis by tumour and stromal cells, allow tumour cells to move throughout degraded matrix, and to invade surrounding tissues (Hanahan and Weinberg 2000). Tumour cells are also aided to migrate by soluble factors (chemotaxis) and bound adhesion molecules (haptotaxis) (Nguyen 2004). In order to invade new organs, circulating tumour cells need to stop and exit the systemic circulation. In an unspecific manner, the extravasation may be due to the fact that large arteries progressively narrow in to arterioles and then capillaries and tumour cells can be trapped in this small vessel, thus allowing the migration in the new organ (Nguyen 2004). Although the exact mechanism behind the tumour homing is not completely understood, recent results suggest that the selective homing of cancer cells may be due to three mechanisms: 1) presence in the target tissue of specific growth factors or appropriate extra-cellular matrix that favour the selective tumour growth, 2) presence in the target organ vessel endothelium of specific adhesive proteins that interact with the tumour cells, favouring the tumour invasion, 3) production of a chemotaxis soluble factor by the target tissue that attract the tumour cells ( Fidler 2003).
1.3.7 Genetic instability
Over the past 25 years numerous genetic alterations have been described in human and animal tumours. These genetic alterations can affect the DNA sequence and the chromosomes (Lengauer et al. 1998). The mutations of DNA include: substitution, deletion, translocation and insertion and they can affect one or more nucleotides. The necessity to transmit genetic information faithfully between generations demands genetic stability (Eisen and Hanawalt 1999)
In normal conditions the genome is affected by spontaneous mutations caused by physiological DNA instability and by imprecision of the DNA polymerase proofreading activity during the DNA replication (Alberts et al. 2002e). In eukaryotic cells, several enzymes have been described with DNA polymerization activity, and five are the most important DNA polymerases involved in DNA replication and repair, alpha, beta, gamma delta and epsilon. To date the only polymerase involved in mitochondrial DNA replication is polymerase gamma. In vitro studies on the fidelity of DNA duplication has shown that the nucleotide mis incorporation rate varies among polymerases, with one in 5000 bases for beta and one in 10 000 000 for delta and epsilon polymerases (Umar and Kunkel 1996; Loeb and Loab 2000). To avoid non-complementary nucleotide incorporation, polymerase delta, gamma and epsilon contain a proofreading activity (Kunkel and Alexander 1986). Normally DNA replication is carried out by delta polymerase, but recent reports show that in some tumours this priority is shifted in favour of less accurate polymerases, thus increasing the mutation rate (Loeb and Loeb 2000). Environmental agents such as ultraviolet light, ionizing radiations and toxic substances in the dietary uptake can induce mutations (Loeb and Loeb 2000).
1.3.7a Single Base Excision Repair
When a mutation effects on a single nucleotide then base excision repair take place. BER employs enzymes called DNA glycosylases, which are specific in removing a specific mutated base (Krokan et al 2000).
1.3.7b Nucleotide excision repair
The nucleotide excision repair (NER) system is able to repair DNA damage induced by UV. In contrast to BER, the NER system recognizes altered nucleotides by scanning the DNA for a conformational alteration (bulky lesion) (Wood 1996).
1.3.7c Mismatch repair
The mismatch repair (MMR) pathway includes a series of proteins that are involved in correcting errors that escape the DNA polymerase proofreading activity during DNA replication. They are also involved in suppressing recombination between non-identical sequences both in mitosis and meiosis (Kolodner and Marsischky 1999). Unlike BER and NER, MMR does not act on damaged or mutated sequences, but it targets only the newly synthesized DNA strand.
Inactivation of the MMR system produces microsatellite instability (MSI) (Atkin 2001).
1.3.7d. Homologous recombination
Homologous recombination repairs double strand breaks by using an intact and homologous DNA molecule as a template. In eukaryotes several proteins are involved in the homologous recombination process (Kanaar et al. 1998; Haber 2000).
1.3.7e. Non-Homologous End Joining
Non-Homologous End Joining (NHEJ) is the more important repairing mechanism when there is break in DNA double strand and it is very important mechanism in mammals (Khanna and Jackson 2001). During the NHEJ process small deletions are generated. Given that majority of the mammalians genome is composed of non-coding regions, the probability that in normal situations the NHEJ process induces mutation in genes is low (Alberts et al 2002e). However, if there are multiple break points NHEJ increases the occurrence of illegitimate recombination
(Rothkamm et al 2001).
1.3.7f Chromosome Instability (CIN)
The cell reproduces by a series of events that allow DNA replication and cell division in a process known as the cell cycle. In order to check the correct order of events that take place in the cell cycle, a complex cell-cycle control system has evolved (Alberts et al 2002c). This system checks normal cell cycle progression by a series of stage-specific sensors known as checkpoints that are able to induce the arrest of the uncompleted stage until it is completed.
The two fundamental processes in the cell cycle are the duplication and the division of the chromosomes, which take place during the Synthesis (S) and Mitosis (M) phase respectively. To prevent the possibility that two daughter cells have non-identical genomes, there are two checkpoints known as DNA replication and DNA damage checkpoints before mitosis, and one known as spindle-attachment checkpoint during mitosis (Alberts et al 2002c).
Chromosome instability (CIN) is also associated with structural alteration of chromosomes, which include reciprocal and non-reciprocal translocations, amplifications, deletions and insertions (Cairns 2005). Structural chromosome instability, resulting from DNA breaks and rearrangements, is due to alteration of cell cycle checkpoints, DNA damage response and telomere integrity (Gollin 2005). Structural alterations may results in altered gene expression or produce fusion or chimeric proteins with dysregulated or new properties (Greaves and Wiemels 2003). Studies have shown that a large proportion of human tumours with chromosome instability have a high rate of loss of heterozygosity (Rajagopalan and Lengauer 2004). Therefore it has been argued that chromosome instability could accelerate the rate of inactivation or activation of tumour suppressor genes or oncogenes respectively (Rajagopalan and engauer 2004).
CIN-associated genes can be classified on the basis of the mutations (Michor et al. 2005). Class I genes of CIN, e.g Mitotic Arrest Deficient gene (MAD-2 ) boost up CIN in case one allele is mutated or deleted. Class II genes of CIN e.g. Human Budding Uninhibited by Benzimidazoles (hBUB-1) gene boost up CIN if mutation is in one allele in a dominant negative fashion. Both Class I and Class II genes are required at the spindle assembly checkpoint (Amon 1999; Hoyt 2001). Class III genes of CIN e.g. Breast cancer gene BRCA1 and another Breast cancer gene BRCA2 boost up CIN if both alleles are mutated. BRCA genes have very important role at checkpoint and it is involved in DNA repairing and recombination (Yarden et al. 2002).
1.4 Evolutionary Dynamics of Tumour Development
According to clonal evolution theory, cancer is the result of somatic mutations selected during tumour evolution (Nowell 1976). It has been argued that tumour cells cannot acquire the mutations needed for tumour progression at a physiological mutation rate, but that the tumour cell must acquire an increased mutation rate (Cairns 1998; Loeb and Loeb 2000).
In order to induce cancer the mutations must affect a variety of genes that restrain somatic conflict (Frank and Nowak 2004). These genes are known as cancer related genes and can be subdivided in three categories: Gatekeeper, Caretaker, and Landscaper (Michor et al 2004). Gatekeeper mutations increase the cellular proliferation rate by the alteration of oncogenes, tumour suppressor genes and apoptotic genes (Michor et al 2004). Caretaker mutations increase genome instability by inactivating genes involved in maintaining genome integrity (Lengauer et al 1998). Landscaper mutations increase tumour proliferation by affecting genes involved in regulating the external cellular microenvironment (Bissel and Radisky 2001).
While mutations affecting oncogenes behave in a dominant way, because only one mutated allele can induce a tumour phenotype, mutations affecting tumour suppressor genes can be neutral if the normal allele compensates the mutant allele, disadvantageous if the mutant allele triggers apoptosis, and advantageous if the mutated allele is inactivated and the second allele is insufficient to balance the wild type allele (Michor et al. 2004). In small compartments the inactivation of the two alleles of a tumour suppressor gene, is unlikely, unless the mutation rate is increased by genetic instability (Nowak et al. 2005). Loss of heterozygosity increases with chromosome instability (Michor et al. 2004).
1.5 Tumours of Feline and Canine included in this study
1.5.1Mammary Tumours
Mammary gland tumours are most frequent in dogs (Moulton 1990) while in cats it is third in prevalence, after haemopoietic and skin tumours (Misdorp et al. 1999). The average age of peak prevalence of tumours in cats is approximately 9.3 years (Roccabianca et al. 2006). Mammary tumours can also affect male cats and dogs, with the average age for them being 12.8 years (Rutterman et al. 2000). Siamese has twice the risk in comparison to other breeds of cat (Weijer et al. 1972). Same predisposition was observed with our data, that all five cases collected in this study were belonging to Siamese breed. Mammary tumours are more prevalent in Pakistan and all the cats and dogs were between 5-11 years old. This suggests that there are more chances of mammary tumours in older cats and dogs. Mammary tumours included in this study were 23% all 22 tumours studied.
1.5.2 Canine Transmissible Venereal Tumours (CTVT)
Canine transmissible venereal tumours first reported by Blaine in 1810 (Blaine, 1810) is a transmissible cancer in dogs. Studies found that CTVT was transmitted by transplantation of living cells (Novinski 1876), confirming it as a transmissible cancer. CTVT is of clonal origin, originating from a founder dog 11,000 years ago (Katzir et al. 1985; Murgia et al. 2006; Rebbeck et al. 2009; Murchison et al. 2014). It is one of only two transmissible cancers known (Murchison 2008) and is spread by allogeneic transfer of cells between dogs, usually during coitus. It manifests as a tumour, associated with the external genitalia of both male and female dogs, although tumours can also arise in the mouth, nose or skin. It is purported to be of histiocytic origin (Mozos et al. 1996; Mukaratirwa and Gruys 2003), and usually remains rather localised, except for rare cases of metastatic spread.
Recorded cases of metastasis include involvement of the lymph nodes (Higgins 1966), skin (Dass 1986) and eye (Barron et al. 1963), among others. Experimental transplants of CTVT tumours into subcutaneous sites in experimental dogs are characterized by progressive and regressive phases. This is seen as a rapid volume increase, followed by tumour shrinkage, and eventually complete regression accompanied by serum-transferable immunity to reinfection (DeMonbreun 1934). In this project we collected 6 samples for BRCA1 and COX-2 studies in different tumours while 16 more samples for Department of Veterinary Medicine, University of Cambridge, UK. Although the prevalent rate of CTVT is in second number, many attentions were paid to collect CTVTs. For BRCA1 and COX-2 studies the 28% were CTVT out of 22 different tumours.
1.5.3 Perianal adenomas/Adenocarcinomas
There are many glands present around the anus of dogs. These are sebaceous and non-secretary glands, while anal sac glands are positioned at 4 and 8 o clock to the anus and secrete their secretions into the lumen of theanal track (Yang Hai-Jie et al. 2008). Perianal adenomas are more frequent than adenocarcinomas (malignant form). In this study 3 tumours were collected which were 14% of total canine tumours collected. These tumours are mostly common in medium to older age dogs.
1.5.4 Granuloma
Granuloma is also called as lick granuloma in dogs it is a type of skin cancer It typically results from the dog’s urge to lick the lower portion of one of her or his legs. This study reported 9% of total tumours included in this study.
1.5.5 Oral Tumours (Squamous cell Carcinoma)
Oral tumours are 4th common cancers in canines. Male dogs have 2.4 times greater risk of developing oral tumours than female dogs (Dorn et al. 1968). This study reported 9% oral tumours in a period of 2 years.
1.5.6 Lymphoma
Lymphoma is the second most prevalent intra –ocular tumours of dogs. Basic cause of lymphoma in dogs is unknown but genetic (chromosomal segregation), environmental and infectious factors such as retroviruses play vital role in developments of this cancer (Fighera et al. 2002). This study reported 9% Lymphomas of total collected tumours.
1.6 Rationale behind selection of genes
1.6.1 BRCA1 gene
BRCA1 gene is tumour suppressor gene, it is involved in repairing the DNA double strands breaks and in case of failure it leads the cells towards apoptosis (Starita. 2003). BRCA1 forms BRCA1 Genome Surveillance Complex (BASC) when it combines with different types of tumour suppressor genes, DNA damage sensors and signal transducers (Wang et al. 2000). It is involved in Ubiqutination, transcription regulation (Friedenson 2007; Friedenson 2008). In humans BRCA1 was first identified at chromosome 17 (Hall et al. 1990) and it was isolated in 1994 (Miki et al. 1994). It is present at 17q21 with a length of 100 Kb. In canine it is located on chromosome 9. BRCA1 has 22 exons in canines and felines; it encodes a protein of 1882 amino acids in canine and 1871 amino acids in feline. Many scientists from different research showed that women who have famililal mutations in the BRCA1 or BRCA2 (BRCA1/2) genes have increased risk of breast cancer (Struewing et al. 1997).
Fig 1: BRCA1 mechanism in DNA repairing. http://www.publichealthunited.org/leading-by-example-angelina-jolie-and-the-brca1-gene-mutation/
1.6.2 Cyclooxygenase-2 Enzyme (Prostaglandins, COX-2).
Cyclooxygenase-2 enzyme (Cox-2) is also called as Prostaglandins Endoperoxide synthase (PTGS). It is involved in the synthesis of prostaglandins which act as biological mediators in many body functions. It was first isolated from prostate gland that’s why it is called as Prostanglandin. Cyclooxygenase enzymes have two types, cyclooxygenas-1 and cyclooxygenase-2. Cyclooxygenase-1 is constitutively produced in the cell while cyclooxygenas-2 is inducible and it is constitutively produced only in kidneys, seminal vesicles and central nervous system. Its high expression has been recorded in many different types of tumours, it has been involved in anti-apoptosis, cell proliferation, tumour angiogenesis, cell invasion and immune suppression activities. In canine COX-2 is present on chromosome 7 having 604 amino acids and 10 axons. This correlation of cyclooxygenase-2 in cancer development suggests using new therapeutics against it. Studies have shown cycoloxygenase-2 high expression in number of different tumours (León-A 2008), such as intestinal, pancreatic, ovarian, prostatic, nasal cavity, oral cavity and mammary tumours of dogs (McEntee et al. 2002; Mohammed et al. 2004; Borzacchiello et al. 2007; Eplattenier et al. 2007; Mullins et al. 2004; Pireset al. 2010; Dore et al. 2003).
Fig 2:COX-2 mechanism of actionhttps://www.google.com.pk/search?q=cox+2+mechanism+of+action.
1.6.3 DLADQA1 (MHCII gene) (Additional work performed at Department of Veterinary Medicine, University of Cambridge, UK).
The Major Histocompatibility Complex (MHC) is a cell-surface protein mediating immune recognition through its interactions with T cells (Fig 3). There are three classes of MHC molecules in mammals - the classical MHC-I and II, and non-classical MHC-III Table 1). MHC-I interacts with CD8+ cytotoxic T cells, whilst MHC-II binds to CD4+ helper T cells. MHC molecules mediate antigen presentation to T cells. MHC-I typically presents self- peptides, whilst MHC-II presents foreign peptides. MHC molecules are extremely variable and polymorphic across the population, with a huge number of alleles at each MHC locus.
This allows MHC molecules themselves to behave as antigens in transplant rejection, with the graft MHC peptide recognized as non-self by the recipient, and thus rejected. It would be expected that CTVT, an allergenic graft, should be rejected for two reasons: host MHC will present tumour antigens as foreign non-self to the host immune system, and tumour MHC will present a mismatch to the host immune system as a foreign antigen itself (Fig 3). This project focuses on the DLADQA1 locus (Wagner et al. 2002), a classical MHC-II gene on dog chromosome 12. There is high level of MHC allelic variability in any population (Niskanen et al. 2013).
Fig 3:MHC is involved in graft rejection.
This rejection (represented by the red arrow) occurs according to two principles. Firstly, host T cells may recognize the host MHC presenting a foreign peptide that should activate an immune response. Secondly, host T cells would also be able to recognize the tumour MHC presenting any peptide as foreign, since it is not self-MHC. It is thus surprising that CTVT is able to persist as an allogeneic graft. MHC expression was previously characterised molecularly by Murgia et al through RT-PCR of a MHC-I (DLA88) and MHC-II (DLADRB1) gene (Murgia et al. 2006). They found that there was downregulation of expression of both these MHC genes. DLA88 showed low levels of tumour-specific expression, whilst there was no detectable tumour expression of DLADRB1. Murgia et al. also performed MHC genotyping for a number of CTVT samples and confirmed that all CTVTs shared the same haplotype (Murgia et al. 2006). They identified two clusters at the DLADQA1 locus, with some CTVTs appearing to be haploid the locus, whilst others remained diploid. This is in contrast to evidence that suggests the DLADQA1 locus had undergone a copy-neutral loss of heterozygosity (LOH) (Murchison et al. 2014).
1.6.4 Technologies used in this research work.
Different technologies are being used in cancer research such as PCR, flow cytometry, immunohistochemistry (IHC), in- situ hybridization (FISH, CSH) and microarray for diagnosis (Pawanet al. 2010). Here, I used Real time PCR for gene expressional analysis of BRCA1 and COX-2 and DLADQA1 (MHCII). Histopathology (Hematoxyline and Eosin staining) was performed for the diagnosis of tumours. CTVT diagnostics qPCR was also performed to measure the allele’s quantity of LINE-myc gene and CDKN2A gene. Conventional PCR measures at End-Point, while Real-Time PCR collects data during the PCR shows the data and quality of data during exponential growth phase also it has increase dynamic range of detection, it is very sensitive and no need for post PCR processing. Immunohistochemistry was performed to find out the expression of MHCII antigens in CTVTs. The serum protein electrophoresis and serum biochemistry was also measured. Western blotting was performed to detect antibodies in CTVTs (protein expression). It is a very good technique to measure the gene expression at protein level in fluidic material of cells. We performed capillary electrophoresis to find the mutations/SNPs in our genes of interest (BRCA1, COX-2 and DLADQA1). Genetic analyzer was used to find the sequence variations in our genes of interests. Other methods used for sequence variation studies, like SSCP, DGCG and HPLC miss the mutations (Rassi 2009). So the sequencing by capillary electrophoresis was the best option for this study.
Availability: Items available for loan: UVAS Library [Call number: 2250-T] (1).
Add to cart (remove)
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice
by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr.
SUMMARY
132
Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited
SUMMARY
133
elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).
Add to cart (remove)
Factors Affecting Biomass Producation Of Baby Hamster Kidney Cell Line In Roller Bottle Culture System For The Production of Foot and Mouth Diseas Virus
by Qaiser Akram | Prof. Dr. Khushi Muhammad | Prof. Dr. Masood Rabbani.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2012Dissertation note: Foot and Mouth Disease (FMD) is endemic in Pakistan and killed virus vaccines against prevalent serotypes are used for the control of disease. Baby Hamster Kidney (BHK-21) cells as monolayer culture are routinely used for the propagation of FMD viruses. Various nutritional factors: amount of growth medium and serum concentration as well as physical conditions: seeding density, rolling speed, growth time, and incubation temperature for the propagation of BHK-21 cells on roller culture bottles were optimized. The roller culture bottles having surface area of 480 cm2 were used for the propagation of cells. Feeding of cells with 100 ml of growth medium per bottle and supplementation of 5% serum supported the growth of the cells in optimum way. Seeding of ten million cells per bottle resulted into the development of complete monolayer with maximum cell density within 48 hours. The cultured cells remained confluent up to 60 hours while a rapid decline in the number of harvested cells was recorded after 72 hours of incubation. Growth rate of the cells was slower at 33° C that increases at 35° C, reaching to its maximum at 37° C while cells could not tolerate the temperature of 39° C. The bottles kept at rolling speed of 3 rpm yielded maximum amount of cells while higher or lower rotation speed negatively affected the cell proliferation.
Antibody response of buffalo calves to different levels of FMD virus immunogen in trivalent vaccine was investigated. The vaccine containing 106.2 units of immunogen/TCID50 of each of the three serotypes of FMD virus induced log2(1.3± 0.4) units of anti-FMD "O" Complement Fixing Cumulative Geometric Mean antibody (FMD"O" CFT-CGM) titer, log2(1.4±0.3) units of anti-FMD"A" CFT-CGM titer and log2(2.0±0.7) units of anti-FMD"Asia-1" CFT-CGM titer. The vaccine containing 2x106.2 units of immunogen of each of the three serotypes of FMD virus induced log2(2.2±0.2) units of anti- FMD"O" CFT-CGM titer, log2(2.1±0.25) units of anti- FMD"A" CFT-CGM titer and log2(3.4±0.8) units of anti-FMD"Asia-1" CFT-CGM titer. The vaccine containing 3x106.2 units of TCID50 of each of the three serotypes of FMD virus induced log2 (5.3 ± 2.0) units of anti-FMD"O" CFT-CGM titer, log2 (4.6±1.9) units of anti-FMD"A" CFT-CGM titer and log2 (5.0±2.2) units of anti- FMD"Asia-1" CFT-CGM titer. The vaccine containing 4 x 106.2 units of TCID50 of each of the three serotypes of FMD virus induced log2(5.5±1.5) units of anti-FMD"O" CFT-CGM titer, log2(4.4±1.9) units of anti-FMD"A" CFT-CGM titer and log2(5.2±1.9) units of anti-FMD"Asia-1" CFT-CGM titer. Moreover, buffalo calves (n=3) which were primed and boosted with 60 days interval using vaccine containing 2x106.2units of immunogen of each serotype of FMD virus, showed log25.0 and log26.3 units of anti FMD"O"-CFT-GMT antibody titer, log24.6 and log2 6.0 units of anti FMD"A"-CFT GMT antibody titer, log25.6 and log26.0 units of anti FMD"Asia-1"-CFT GMT antibody titer, on 30 and 120 days post boosting.
Each serotype of the virus grew well on BHK-21 cell line. The virus showed poor TCID50 (log 103.2±0.2) in BHK-21 cells having Glasgow Minimal Essential Medium (GMEM) without Fetal Calf Serum (FCS). Addition of FCS in the medium at the rate of one percent increased log 107.1±0.2 units of virus TCID50. Incubation temperature of 350 C and 370 C supported the multiplication and maintenance of BHK-21 cells and yielded log106.6±0.1 and log107.0±0.2units of virus TCID50, respectively. Each serotype of FMD virus showed log106.29±0.07 units of virus TCID50 in the stationary monolayer of BHK-21 cells in Roux flask (75cm2), log107.66± 0.02 units of virus TCID50 in roller bottles (490 cm2) and log108.34 ± 0.07 units of virus TCID50 on 0.2 g of micro-carriers suspending in 200 ml of the growth medium in stirring bottle. The infectivity titer/TCID50 of each of the virus serotypes was significantly higher in roller bottles than that achieved in Roux flasks (p<0.05) and was significantly higher in stirring bottle containing micro-carriers suspending in the growth medium than that of harvested in roller bottle (p<0.05). It is concluded that the infectivity titer of the virus is directly proportional to number of BHK-21 cells in the culture system.
Availability: Items available for loan: UVAS Library [Call number: 1554,T] (1).
Add to cart (remove)
Feeding Management For Optimum Growth, Reproduction And First Lactation Performance In Sahiwal Heifers
by Muhammad Fiaz | Prof. Dr. Muhammad Abdulla | Prof. Dr.Masroor Elahi Babar.
Material type: ; Format:
print
Publisher: 2010Dissertation note: Sahiwal is well known dairy cattle breed in the tropical and subtropical regions of world for its excellent heat and tick resistance. The value of adequate nutrition and management of replacement heifers is mostly overlooked and production losses linked with slow growth rate are not entirely realized. Efficient utilization of nutrients like energy during pre pubertal and gestation periods is needful for melioration. The study included two experiments. The aim in first experiment was to investigate the effect of varying dietary energy levels on pre pubertal growth and age at puberty in Sahiwal heifers. Twenty Sahiwal heifers (Age = 12 ± 2 month and avg. wt = 125 kg) were assigned to four dietary treatments having five animals on each treatment. Isonitrogenous (CP=13.7%) diets having varying energy levels, viz; A=100% (Control), B=88%, C=112% and D=124% of NRC recommended level for small breed non bred heifers were fed to the respective groups until onset of puberty.
Dry matter and protein intakes were not influenced by varying dietary energy levels during pre pubertal period. However, metabolizable energy (ME) 124% of NRC recommendation enhanced average daily gain (ADG) up to 571±15 g/d which was higher than all other dietary energy levels, whereas it was similar between ME 100% and ME 112% (442±11 and 450±05 g/d, respectively) but lower in ME 88% (397±07 g/d). The improvement in ADG of heifers fed ME 124% of NRC might be attributed to availability of excess energy nutrient for heifers to fulfill not only maintenance requirements but also to grow and develop body reserves. Provision of extra dietary energy improved efficiency of diets which might be attributed to availability of surplus dietary energy enabling heifers to convert feed into live body mass more efficiently. The 13 to 18 months of age was found optimum time period to have significantly highest ADG in Sahiwal heifers. This might be attributed to propitious physiological conditions under which heifers grow at faster rate.
The optimum increase in body structures (Body length, height and heart girth) was achieved in ME 124% of NRC recommendations. The phase from 13 to 18 months of age was found optimum possessing significantly highest values of increase in body length and heart girth, whereas phase from 19 months to age at puberty was optimum to achieve significantly highest body height. The optimum increase in heart girth during first two phases (13 to 19 months of age) might be attributed to relatively faster muscle growth in body than bone growth. The digestibility percentages of nutrients (DM, CP, NDF and ADF) were not influenced by different dietary energy levels. No influence of dietary energy levels on digestibility of nutrients in the present study might be attributed to best adaptability of Sahiwal heifers to utilize diets even with low energy under local environment.
Similarly, age at puberty was also not affected by dietary treatments and overall average was 833 ± 10 days. The optimum performance in terms of age at puberty at lower dietary energy level might be attributed to lesser energy requirements of Sahiwal under tropical and subtropical environment condition as elaborated by NRC (2000) that maintenance energy requirements of Bos indicus breeds including Sahiwal are about 10% lower. The similar pattern of influence was observed in serum progesterone concentration. The average of progesterone detected during a month before puberty was 0.44±0.005 ng/mL and during a month after onset of puberty was 1.48 ± 0.03 ng/mL serums. The similar rogesterone concentration among dietary treatments might be attributed to similar age at puberty in Sahiwal heifers.
It is concluded from results of first experiment that higher dietary energy level (ME 124% of NRC) enhanced growth parameters and feed efficiency but reproductive performance of Sahiwal heifers in terms of age at puberty was optimum even at lower dietary energy level (ME 88% of NRC recommended level) under local environment conditions of Pakistan.
The aim in second experiment was to study the effect of feeding varying dietary energy levels during last trimester of pregnancy on 1st lactation performance in Sahiwal heifers. Five to six months pregnant Sahiwal heifers (n=16) were assigned four dietary treatments having four heifers on each treatment. Iso-nitrogenous (CP=14.1%) diets having varying energy levels, viz; A=100% (Control), B=88%, C=112% and D=124% percent of NRC recommended level for pregnant heifers were fed to the respective groups until calving. After calving, all heifers were fed a similar diet having CP (16.2%) and ME (1.72 Mcal/kg).
Dry matter and CP intakes were similar across the dietary treatments. Pre calving ADG was not different among heifers fed ME 112 and ME 124% (486 ± 13 and 497 ± 05 g/d, respectively) but higher than other diets, whereas it was also higher (444 ± 07 g/d) in ME 100% than 397 ± 08 g/day in ME 88% of NRC recommendation. Feed efficiency was similar between ME 124 and ME 112% but higher than other diets, whereas ME 100% was also more efficient than ME 88% of NRC recommendation. The higher feed efficiency in higher dietary energy levels might be attributed to availability of surplus dietary energy enabling heifers to convert feed into live body mass more efficiently. Better body score through higher pre calving dietary energy level might be attributed to availability of energy for animal in surplus to its requirements of maintenance and pregnancy. Higher level of energy at this stage enabled pregnant heifers to develop extra body reserves needed in early lactation period to fulfill high demand of lactogenesis. The similar birth weight of newly born calves might be attributed to the factor that needs of conceptus (growth of fetus, fetal membranes, uterus and mammary glands) are accorded high priority by the homeorhetic controls it transmits to the dam.
Extra energy levels beyond NRC recommendation during prepartum period were not advantageous to increase milk yield in 1st calf heifers. The performance of 1st calf heifers in terms of milk yield was only optimum through pre calving feeding according to NRC recommendations. The lesser milk yield in diets having higher energy levels than recommended by NRC might be attributed to more availability of mammary fat pad which may limit further parenchymal tissue development and consequently decrease milk yield during subsequent lactation. However, milk fat percentage increased as pre calving dietary energy level was increased, whereas milk protein, lactose and SNF percent among animals fed different experimental diets did not differ. It is concluded from results of second experiment that the optimal performance of pregnant Sahiwal heifers was achieved through provision of pre calving extra dietary energy (ME 112%) beyond the NRC recommendation but first lactation yield was found optimum in heifers fed diet having energy level as per recommendations of NRC.
Availability: Items available for loan: UVAS Library [Call number: 1230,T] (1).
Add to cart (remove)
Fiber Levels Durig Different Physiological Stages In Nili Ravi Buffaloes
by Saeed Ahmed | Prof. Dr. Makhdoom Abdul Jabbar | Prof. Dr. Anjum Khalique | Prof. Dr. Khalid.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1779,T] (1).
Add to cart (remove)
Genetic And Evolutionary Characterization Of Pakistani Pigeons And Parrots Through Mitochondrial D-
by Sehrish firyal | Dr. Ali raza awan | Prof, Dr. Aftab | Prof, Dr. Tahir yaqub.
Material type: ; Format:
print
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1873,T] (1).
Add to cart (remove)
Genetic Evaluation Of Teddy Goats In Pakistan
by Zulfiqar Hussan Kuthu | Prof. Dr. Khalid Javed | Prof. Dr. Masroor Ellahi Baber.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2012Dissertation note: Data available on 20455 kidding and performance records of 5545 Teddy goats and progeny of 406 sires maintained as separate flocks at three different locations i,e (I) Livestock Experiment Station Rakh Ghulaman, District Bakkhar (1983-2008) (II) Livestock Experiment Station, Rakh Khariewala District Layyah (1971-2008) and (III) Livestock Experiment Station Chak Katora, District Bahawalpur (1975-2008) Punjab, Pakistan were analyzed for documenting both genetic and environmental sources which influence growth and reproductive traits. Breeding values of sires and does were estimated and genetic and phenotypic trends for various performance traits were drawn. The data was analyzed using the GLM procedure (General Linear Models) of the Statistical Analysis Systems (SAS, 2004) to study the influence of environmental sources of variation on various growth and reproductive traits. The genetic parameter estimation was done using REML procedure fitting an Individual Animal Model. Estimates of breeding values for various performance traits were also calculated by using BLUP. For these purposes WOMBAT software was used.
The Least squares means for Age at first service, Age at first kidding, Weight at first service, weight at first kidding, services per conception, service period, kidding interval, birth weight, weaning weight, weight at six months, weight at nine months, yearling weight, pre-weaning daily gain, post-weaning daily gain at six months, post-weaning daily gain at nine months and post-weaning daily gain at twelve months the least squares means were 245.65±0.73 days, 14.07±0.01 kg, 394.14±0.76 days, 18.06±0 kg, 1.24±0.004, 153.58±0.73 days, 327.53±1.12 days, 1.66±0.03 kg, 9.59±0.01 kg, 11.70±0.02 kg, 16.69±0.02 kg, 21.03±0.03 kg, 70.21±0.16 grams, 31.39±0.08 grams, 45.25±0.03 grams and 45.95±0.02 grams, respectively. The percentage of single births was 43 percent, while multiple births were 57 percent. The sex ratio was 51:49 males and females.
Year, sex, flock, and type of birth were main sources of variation on all the growth traits. The influence of season of birth was significant on yearling weight; however its effect on weight at six and nine months was non-significant. A significant influence of (p<0.01) birth and weaning weight was noticed on weight at 6, 9, 12 months and on post-weaning daily gain at 6,9 and 12 months. A significant effect (p<0.01) of year, birth weight and weight at service were observed on age of does at first service, while the seasonal and flock effect on the trait was non-significant. The influential environmental sources of variation on weight of does at first service were year, season and age at first service(p<0.01). A significant effect (p<0.01) of year, season, type, age and weight at service on age and weight at first kidding was noticed. The influence of year of service, flock, age and weight at service on services per conception was significant (p<0.01); however, effect of season of service on the trait was non-significant. A highly significant effect (p<0.01) of year and season of service, services per conception and weight at service were observed on service period. A significant effect (p<0.01) of year and season on kidding interval was noticed. The effect of flock was non-significant on the trait, however, age and weight at kidding had a significant effect (p<0.05) on the service period and kidding interval.
The heritability estimates for birth weight, weaning weight, weight at six, nine and twelve (yearling) months, pre-weaning daily gain, post-weaning daily gain at six, post-weaning daily gain at nine, post-weaning daily gain at nine, post-weaning daily gain at twelve months, age at first service, weight at first service, age at first kidding, weight at first kidding, services per conception, service period and kidding interval were 0.28±0.23, 0.23±0.32, 0.19±0.42, 0.09±0.01 and 0.12±0.01, 0.21±0.32, 0.17±0.42, 0.12±0.02, 0.15±0.01, 0.19±0.22, 0.21±0.01, 0.19±0.04, 0.20±0.04, 0.07±0.01, 0.06±0.05 and 0.05±0.03, respectively. The repeatability estimates for birth weight, weaning weight, services per conception, service period and kidding interval were 0.53±0.02, 0.38±0.01, 0.02±0.05, 0.01±0.04 and 0.05±0.03, respectively.
The estimates of genetic, Phenotypic and environmental correlations between birth weight and other growth traits were; weaning weight 0.61, 0.20 and 0.19, with weight at six months 0.39, 0.24 and 0.23, with weight at nine months 0.25, 0.38 and 0.36, with yearling weight 0.29, -0.01 and -0.02 and with pre-weaning daily gain 0.55, 0.31 and 0.29, respectively, while corresponding values for correlations between weaning weight and other growth traits were; with weight at six months 0.29, 0.19 and 0.17, with weight at nine months 0.23, 0.27 and 0.25, with yearling weight 0.45, 0.29 and 0.27 and with pre-weaning daily gain 0.97, 0.68 and 0.65, respectively, while the corresponding values for these correlations between weight at six months and other growth traits were; with weight at nine months 0.71, 0.27 and 0.25 with yearling weight 0.64, 0.21 and 0.19 and with pre-weaning daily gain were 0.31, 0.33, 0.31, respectively. The values for these correlations between weight at nine months and other traits were; with yearling weight 0.79, 0.23 and 0.21, with pre-weaning daily gain 0.25, 0.39 and 0.37, with post-weaning daily gain at six months 0.72, 0.81 and 0.79, respectively, while the estimates of these three correlations between yearling weight and other traits were; with pre-weaning daily gain 0.47, 0.41 and 0.42 and with post-weaning daily gain at six months 0.65, 0.10 and 0.08, while the corresponding values between pre-weaning daily gain and other traits were; with post-weaning gain at six months were 0.34, 0.15 and 0.13, with post-weaning gain at nine months 0.22, 0.13 and 0.12 and with post-weaning daily gain at twelve months were 0.54, 0.17 and 0.14, respectively.
The estimates of genetic, Phenotypic and environmental correlations between age at first serviceand other traits were; with weight at first service 0.22, 0.79 and 0.76, with age at first kidding 0.76, 0.97 and 0.91 and with weight at first kidding 0.34, 0.14 and 0.11, respectively, while the corresponding values for these correlations between weight at first service and other traits were; with age at first kidding 0.39, 0.81 and 0.80, with weight at first kidding 0.35, 0.22 and 0.21 and with weight at first kidding 0.82, 0.18 and 0.16, respectively.
Analysis of pedigree records for coefficient of inbreeding revealed that number of animals being 4465 (42.61 percent) with an average inbreeding of 2.43 percent and the highest level being 46.48 percent. The number of non-inbred animals was 6014 (57.39%). Out of the total of 406 sires used 23 were found inbred having an average inbreeding coefficient of 3.125 percent. Most frequent value for this category of animals was zero. The highest number of animals 1531 (14.61 percent) had an inbreeding percentage between 0.1 to 3.125, while only 104 animals (0.99 percent) were found with inbreeding of more than 25 percent. Most of the growth traits were statistically better in non-inbreds as compared to inbreds except yearling weight and post-weaning weight gain at twelve months, in which the means of both the traits were similar in both the groups. Among reproductive traits, age at first serviceand kidding, services per conception, service period and kidding interval were also statistically better in non-inbreds as compared to inbreds, while weight at first service and kidding interval were similar in both the groups.
The ranges for estimated breeding values for different traits were, birth weight (-0.18 to 0.08 kg), weaning weight (-0.61 to 0.40 kg), weight at six months (-0.27 to 0.11 kg), weight at nine months, (-0.07 to 0.09 kg), yearling weight (-0.12 to 0.18 kg), pre-weaning daily gain (-0.30 to 1.20 grams), post-weaning daily gain at 6 months (-0.74 to 1.27 grams), post-weaning daily gain at 9 months (-0.32 to 0.57 grams), post-weaning daily gain at 12 months (-1.08 to 1.57 grams), age at first service(-43.23 to 58.06 days), weight at first service (-0.55 to 1.07 kg), age at first kidding (-53.31 to 48.34 days), weight at first kidding (-1.19 to 3.50 kg), services per conception (-0.18 to 0.16), service period (-7.07 to 9.80 days) and kidding interval (-13.23 to 20.89 days), respectively. The genetic trend in both birth weight and weaning weight showed an increasing trend during the period of study, while the genetic trend in weight at six, nine and twelve (yearling) months had no significant trend and fluctuated in the vicinity of zero.
It is envisaged from the present study that over the 34 years period selection remained ineffective to bring the desired changes and it will remain so if random use of breeding animals is practiced. The possible use of ineffective selection could be unavailability of efficient techniques for the evaluation of animals and incorrect performance recording etc. It is therefore, necessary to correct all these discrepancies by taking corrective measures as discussed above. The following corrective measures may be a first step towards a goal oriented breeding policy.
1. The animals kept mainly for producing meat, the single most important factor is reproductive rate, which contributes to the efficiency of production (Shelton 1978). The most striking feature of sheep and goat enterprise is the ability to breed, off-season. Teddy goat is a non-seasonal breeder as kidding was observed throughout year with 36%, 19%, 25% and 20% kiddings recorded during spring, summer, autumn and winter, respectively, therefore a controlled breeding programme being practiced at times (as was observed during the present study at all the three stations) should not be advocated in any form at all and the desirable trait of non-seasonality should be the main pillar of a meat goat enterprise.
2. Although a higher percentage of abortions (70%) was observed in summer months but the percentage of dead births and mortality was almost equally distributed throughout the year, which indicates that better management of the flock during extremes of weather will results in less abortions and reduced mortality.
3. The high percentage of multiple births (57%) as against single births (43%) in teddy goats found in present study has backing of several studies, which showed that although there was slow growth rate in multiple births, yet they performed better by producing more total weight of kid weaned. Therefore prolificacy becomes a very important reproductive criteria and therefore emphasis should be selection of those animals with higher percentage of multiple births.
4. Environmental effects on productive and reproductive traits were significant; therefore through better management there are ample chances of improvement in these traits.
5. Low to medium heritability was recorded in all the growth traits, which offers scope for genetic selection.
6. Selection of animals to be the parents of future flock must be based on EBVs of growth traits.
7. Reproductive performance in present study was more than satisfactory. Early maturity which has been the main characteristic of Teddy breed was better as compared to many other breeds of the tropics (Beetal, Kamori, Jamunapari and Sirohi). Teddy goats were efficient than other breeds of the region when the means of the other reproductive traits like services per conception, service period and kidding interval were taken into consideration, however, room for improvement is still there.
8. Inbreeding in present study showed some increasing trend during the last five years and the percentage of animals kept on increasing during the last decade, therefore to control inbreeding a breeding plan with introduction of new blood from time to time is of utmost importance.
Availability: Items available for loan: UVAS Library [Call number: 1582,T] (1).
Add to cart (remove)
Genome-Wide Association Mapping To Approach The Candidate Gene Having Potential Role In Dairy Bull Fertility
by Asif Nadeem | Prof.Dr.Masroor Elahi Babar | Dr.Atif Hanif | Prof.Dr.Muhammad Abdullah.
Material type: ; Format:
print
Publisher: 2011Dissertation note: Reproductive efficiency is a most important determinant of dairy profitability. Fertility in
the herd is absolutely critical for both male and female animals. Fertility studies in dairy
cattle were directed toward the female side and very little importance has been placed on
the influence of the service bull. In this study association mapping was carried out Cor
fertility trait in Holstein dairy cattle bulls using high-throughput and a high-density SNi>
genotyping array. Single nucleotide polymorphisms (SNPs) were associated with dair,
cattle bull fertility. Associated SNPs were queried in the bovine genome. Seven SNPs
were found within the genes and fourteen were within 10 kh o! a gene. Seven gl'nes.
namely LEPRELl, MOBKL3, CD247, LRRC8J\, LRFN5, IT] I [J and [·.NTP[) J were
seleeted as candidate genes. Resequencing and fine mapping of selected candidate genes
were performed and identified SNPs were associated with dairy cattle hull fertility. This
is the first GWA study for dairy bull fertility using the Illumina Bovine S~ P50 Bcadchip
containing 54001 S Ps powered by I1lumina lnfinium-Il assay.
Availability: Items available for loan: UVAS Library [Call number: 1354,T] (1).
Add to cart (remove)
Genotyping Of Echinococcus Granulosus And Its Comparative Prevalance In Camels And Human Beings
by Azam Ali | Prf.Dr. Azhar Maqbool | Dr.Kamran Ashraf | Faculty of Veterinary Sciences.
Material type: ; Format:
print
Publisher: 2008Dissertation note: Hydaiidosis is caused by metacestode of the dog worm Echinococcus granulosus. It is a serious problem br both Public health and livestock economy. Echinococcus granaiiosu.s has number of genetically distinct strains which are known to differ morphologically and epidemiologically. Out of 100 camels examined only 25 Samples of hydatid cysts were collected from different organs i.e. livers, kidneys, lungs and hearts from Lahore abattoirs. Fertility and viability of the cysts was observed microscopically. Genotyp ing of Echinococcus granulosus was performed through Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP). Seroprevalence of hydatidosis in 25 butchers working in abattoir was also determined by the use of Latex agglutination test (LAT) kit for detection ob hydatidosis.
Considerable information is available about genetic variants of E. granulosus around the world. Ten genotypes of E. granulosus have been described, which exhibit a diversity of morphology, development, and host range, as contrmed by various studies. In the Mediterranean area, the CI or common sheep strain, G2, Camel strain G6, and the equine strain G4 have been found in Spain, Italy, Lebanon, and Syria
To date, molecular studies using mainly DNA sequences have identitied G-6 strain of E. granulosus. This categorization follows very closely the patterns of strain variation emerging from biological and epiderniological traits.
In this study we perform serum analysis of butchers to detect antibodies against Echinococcus so that the prevalence of Echinococcus can be checked; the data available indicated that 14% of butcher's population is infected with Echinococcus. In order to confirm the strain of Echinococcus in camels the PCR-RFLP analysis were performed. The data obtained was analysed and it was concluded that the G6 strain of Echinococciis is prevalent in camels in Pakistan. The results demonstrated that PCRRFLP analysis of samples of patients suspected for Echinococcus is a promising diagnostic method and also confirms the type of Echinococcus prevalent in that area and also enables an early direct detection of parasite DNA. This will help to curtail this drastic malady at an early stage and will help to devise the strategy to minimize the losses due to this disease.
It is hoped that the findings of the present study will be helpful for further planning about the control of the disease and correlating the prevalence in camels and butchers from the zoonotic point of view.
Availability: Items available for loan: UVAS Library [Call number: 1010,T] (1).
Add to cart (remove)
Hatching Performance Of Different Broiler Breeder Strains At Four Production Phases With Three Different Egg Weights
by Hafiz Muhammad Ishaq | Prof. Dr. Muhammad Akram | Dr.Abdul waheed sahota | Prof. Dr.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1940,T] (1).
Add to cart (remove)
Identification And Expression Analysis Of Genes Involved In Obsessive Compulsive Disorder In Pakistani Population
by Javeria (2008-VA-627) | Prof. Dr. Masroor Ellahi Babar | Dr. Muhammad Wasim | Prof. Dr. Muhammad Abdullah.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The background of this study is that WHO reports that psychiatry disorders affect worldwide 0.8 to 2% population. Anxiety illnesses are a class of illness associated with unreasonable and disturbing sensation of fear and tension. There are several types of anxiety disorders, such as panic disorder, agoraphobia, specific phobia, social phobia, OCD. Obsessive-compulsive disorder is a chronic disabling condition. OCD is characterized by repetitive, intrusive thoughts, images, and impulses and by repetitive, ritualistic physical or mental acts performed to reduce the attendant anxiety. The severity of OCD depends on the amount obsessions and compulsions. The Yale-Brown Obsessive Compulsive Scale (Y-BOCS) is a reliable and consistent scoring system that can be used to categorize OCD. The major genes involve in OCD are SLC6A4, BDNF, SLC1A1 and COMT genes.
The study was enrolled patients treated for OCD. Blood samples have been collected from the patients. DNA extracted from fresh blood. Primers were designed. Then DNA amplification have done by Bio-Rad thermal cycler. Then gel electrophoresis was done for PCR product quantification. PCR products precipitated and sequenced. SNPs were identified. Real-time quantitative RT-PCR was performed for each sample with TaqMan Universal PCR mastermix which showed down regulation of COMT gene in OCD patients in Pakistani population.
The aim of this study was SNP identification in Pakistani Population in Obsessive Compulsive disorder and to analyze the gene expression of COMT gene involved in OCD in Pakistani Population.
Availability: Items available for loan: UVAS Library [Call number: 2620-T] (1).
Add to cart (remove)
Identification And Genotyping Of Vp1 Genses Of Fmd Viruses
by Atia Bukhari | Prof. Dr. Irshad Hussain | Prof. Dr. Khushi Muhammad.
Material type: ; Format:
print
Publisher: 2009Dissertation note: Within two decades after its first report in 1954 from Pakistan, Foot and mouth disease has become endemic in the country and poses a serious threat to large as well as small ruminant population. Foot and Mouth Disease (FMD) is prevailing in cattle and buffaloes and is caused by either 0, A, Asia-i serotype of the FMD virus in Pakistan. The present study was undertaken to study the mutation rate of FMD virus and also molecular typing of the strains prevalent in Pakistan was done.
A total of 60 samples from buffalo and cattle were collected from five districts of Punjab including Lahore, Faisalabad, Sialkot, Okara and Sheikhupura. Soon after extraction of their RNA, all of them were reverse transcribed and then subjected to amplification by using different sets of the primers including universal as well as serotype specific primers. Then their VPI portions were amplified by using VP1 specific primers. Among 60 samples, 48 were positive with universal primers. Other 12 samples were not amplified with these primers hence not processed.
Among 48 FMD positive samples, 24 were positive with serotype 0 specific primers, 16 with serotype Asia-i and remaining 8 were positive with serotype A specific primers. After their amplification, the amplicons were run on the gel. These amplicons were extracted by using DNA extraction kit. After their purification, they were sent to Macrogen® (Seopl, Korea) and Centre of Excellence for Molecplar Biology, Pakistan (CEMB) for sequencing. Each amplicon was sequenced thrice and the consensus sequence was established eliminating sequencing errors.
Sequence identity and multiple sequence alignment of molecular sequences (nucleotide and amino acids) were performed with Clustal W algorithm (Thompson et al., 1994). Neighbour joining trees were constructed by using MEGA version 4.0 (Kumar et al., 2004). Nucleotide distance matrices were computed by Kimura two parameter algorithm based on the total nucleotide substitutions and evolutionary trees for VP1 genes were constructed.
For FMDV serotype '0' phylogenetic analysis, 14 VPI sequences from various field isolates were compared with some previously published Pakistani FMD 0 type VP1 specific sequences available with GeneBank and some recently published VP1 sequences reported by countries bordering with Pakistan including India, Iran and Afghanistan Similarly, 12 VP 1 sequences of FMDV serotype Asia-I isolates of this study were compared with previously published sequences and their phylogenetic relationship was established. However, the sequencing results of serotype A were inconclusive and were not included for phylogenetic analysis. Three sequences of three locally available FMD vaccines were also studied and compared with the outbreak strains.
Polymerase chain reaction was optimized with respect to MgCI2, buffer pH, annealing temperature, primer concentration, template concentration, and Taq polymerase. A concentration of 2.5 mM of MgCl2 resulted in the best amplification of the target sequences (Figure 1). The buffer with pH 8.8 yielded the best results (Figure 2) Although, the suggested annealing temperatures for various primers (of various serotypes) ranged from 48 °C to 63 °C, however, a temperature of 56 °C was found to be the best with all sets of primers (Figure 3). The best intensity DNA bands were observed with 0.3 pM concentration of the primers (Figure 4). Moreover, the best cDNA template concentration giving optimum amplification was found to be 3.0 p1 per reaction (Figure 5). Lastly, a concentration of 0.5 U of Taq polymerase was not sufficient for amplification of cDNAs, however, 1.0 U of enzyme was found to yield better amplification (Figure 6).
VP 1 DNA sequences of six previously published Pakistani FMD serotype 0 strains were analyzed phylogenetically with VP 1 DNA sequences of 14 isolates of the study. Serotype 0 isolates of this study distributed themselves into two distinct clusters (Figure 19). First cluster comprised of Sheikhupura 1 and 2, Muridkey 1, Raiwind 1, Nankana 1, Gujranwala 1 and Gujrat I isolates (Figures 19 and 20), whereas the second cluster included Depalpur 1, Sahiwal 1, Okara I, Multan 1, Toba 1, Faisalabad I and Pattoki 1 isolates (Figures 19 and 21). The first cluster was found to be associated with previously published Pakistani isolates of 2006 mostly. However, it also showed association with Afghanistan's isolates of 2004 (Figure 20). The second cluster seemed to be mostly related to previously published Pakistani isolates of 2003 (Figure 21). The overall grouping of the 14 sequences, when compared with each other, depicted a three clustered phylogram (Figure 22). Serotype 0 isolates from Depalpur, Sahiwal, Okara, Multan, Pattoki, Toba Tek Singh and Faisalabad grouped together into a clan and had more than 85% sequence similarity with each other. The second cluster consisted of isolates of Sheikhupura, Nankana, Raiwind and Muridkey. These sequences had more than 86% similarity with each other. The third cluster consisted of only two isolates which were 100 % similar to each other. However the third cluster had only 74 % sequence similarity to cluster I and 73 % sequence similarity when compared with cluster 2.
When the phylogenetic relationships with previously reported isolates of Asia 1 was evaluated, FMD Asia I isolates of this study were found to be scattered into two distinct groups (Figure 16). Group one consisted of isolates of Lodhran, Toba and Hafizabad that were more closely related to Indian isolates sharing more than 98% identity with each other and more than 94 % sequence identity with isolates of Indian 2001 to 2004 (Table 5 and Figures 16 and 17). However, they shared more than 86% sequence similarity with Pakistani isolates of 2002-2005 (Table 5). Group two comprised of isolates of kasur, Lahore, Pakpattan, Okara, Faisalabad, Jhang, Rahim Yar Khan, Bahawalpur and multan alongwith vaccine A and B (Figure 16). The isolates of group 2 were found to be closely associated with previously published isolates of Pakistani and Afghani origin of year 2003 and 2004 (Figures 16 and 18). Collectively, they shared an overall 70% sequence identity with each other. However, isolates of Bahawalpur, Rahim Yar Khan and Multan shared more than 98% similarity with each other, a measurement of close relationship denoting a likely common origin as one clan or dade. Similarly, isolates of Pakpatan, Faisalabad, Okara, Kasur, and Lahore shared 88% sequence identity with each other and qualified as one clade.
Although, overall amino acid sequence similarity of our isolates was not strikingly different from that of the published isolates, however, amino acid substitutions with dissimilar properties were found with a scattered pattern of distribution. For example, 15th amino acid residue which is hydrophilic in the previously published isolates had a substitution with a hydrophobic amino acid residue in our three isolates namely Sheikhupura 2, Muridkey I and Raiwind I (Figure 25). Similarly, 14th amino acid residue which is hydrophobic in nature was found to be replaced with a hydrophilic one in our last five isolates. Amino acid residue number 13 (Figure 25) had a substitution with a hydrophobic residue in some of our isolates etc. etc. It is interesting to note that such substitutions with amino acids having dissimilar properties have also been found, albeit at lower rate, in previously published sequences by many researchers (Figure 25).
A comparison of the deduced amino acid sequences in the critical VP I region of FMD serotype Asia I revealed that most of this study isolates shared very high homology with sequences of Vaccine A. However, the sequences of isolates of Lodhran, Hafizabad and Toba did not match much with that of either vaccines, A or B (Figure 23). Sequences of Vaccine A had a "K" which seemed to be replaced by a "T" in the sequences of most of the isolates. Considering the properties of various amino acids, this change does not signify a major shift in the three dimensional picture of the protein as K is a lysine, a positively charged amino acid, whereas a T is threonine, a hydrophilic amino acid in nature. Next substitution in most of the isolates is a "P" for "A" in comparison to the vaccines. Again, it is not a significant change as both P and A share the same property, hydorphobicity. Similarly a K with an R can be substituted without much change in the overall shape of the protein molecule. Next amino acid substitution is a leucine instead of methionine. Again both are hydrophobic in nature; hence their impact on the overall picture is minute, if at all. However, glycine and arginine are two very different amino acids; the former is a hydrophobic amino acid whereas the latter is positively charged one. Such amino acid substitutions may have the potential to make a major impact in terms of the epitopic differences in the capsids of vaccinal and field viruses. A comparison of the deduced amino acids of FMD serotype 0 isolates also exhibited such changes with the vaccinal virus (Figure 24).
Of the three hyper immune sera raised against three different vaccines in rabbits, only one vaccine induced a measureable immune response yielding good precipitation line against various FMD virus antigens.
In summary, RT-PCR for diagnosis of serotypes A, 0 and Asia 1 of FMDV was optimized and could be used for prompt and precise diagnosis of FMD in the country. Although, RT-PCR data pertains to bovines in the current project, but PCR optimization parameters are equally applicable to FMDV infections in other FMD susceptible animal species such as sheep and goat. The combination of PCR and sequencing of the VP1 gene to detect and analyze FMDV in disease outbreaks is fast (less than 6 hours for PCR and about 24 hours for sequencing), and it can give an accurate immunologic characterization of the virus, thus providing a rational basis for choice of vaccine. In fact, the molecular epidemiology of field isolates is a powerful tool to monitor the circulation of viruses (Saiz et al., 1993).
Secondly, various isolates of serotypes 0 and Asia 1 were sequenced along with some vaccinal strains. Sequence similarity tree analysis indicated that most of our isolates were closely related to previously reported Pakistani isolates and to those of neighboring countries such as India, Afghanistan and Iran. Additionally, amino acid sequence similarity data of major immunogenic site that forms 13G-13H loop in FMDV serotypes revealed that serotype Asia 1 vaccinal strain and Asia 1 isolates of this study possessed high degree of similarity suggesting a likely host immune response against the vaccine that may afford some protection against most field isolates of serotype Asia 1 type. Lastly, of three vaccines tested, only one was found to afford protection against field isolates of FMDV suggesting more work on vaccine issue in the country.
Availability: Items available for loan: UVAS Library [Call number: 1179,T] (1).
Add to cart (remove)
Identification Of Molecular Markers In Bmp15 Gene Of Different Pakistan Sheep And Goat Breeds
by Ahmad Nawaz | Prof.Dr.Masroor Elahi Babar | Prof. Dr | Prof. Dr. Khalid Javed.
Material type: ; Format:
print
; Nature of contents: Publisher: 2011Dissertation note: Genetics of prolificacy in sheep and goat emphasize the importance of main genes which have been made known to affect litter size and rate of ovulation through various mechanisms. Natural mutations in prolific sheep and goat breeds have shown that the transforming growth factor beta (TGF-?) super family ligands such as bone morphogenetic protein 15 is crucial for ovulation and as well as for increasing litter size. Keeping in view the importance of prolificacy in sheep and goat, a research project was planed to identify the polymorphism, its association with fecundity and uncovering the nucleotide picture of BMP15 fecundity gene in sheep and goat breeds of Pakistan. In the research finding, various polymorphism, insertion and deletion of nucleotides in goat and sheep breeds of Pakistan were identified and associated with fecundity and secondly, some novel polymorphism in Pakistani goat and sheep breeds were identified which are different from the goat and sheep breeds of the world. This is the first report of the whole nucleotide of BMP15 gene in the sheep. A lot of work has been reported on these genes but total nucleotide picture in the sheep is not reported. Sequences of Bmp15 gene from sheep and goat breeds of Pakistan has been submitted to the NCBI GenBank database libraries,USA under accession numbers JN655669, JN655670, JN655671 and JN655672. It will result in fast vertical expansion of small ruminants to increase the mutton production and uplift the socio economic condition of small ruminant's farmers in the country.
Availability: Items available for loan: UVAS Library [Call number: 1421,T] (1).
Add to cart (remove)
Immune Response Of Buffaloes To Foot And Mouth Disease Virus Vaccine
by Munir Ahmad Tariq | Prof.Dr.Khushi Muhammad | Prof.Dr.Muhammad Akram Muneer | Faculty of Veterinary Sciences.
Material type: ; Format:
print
; Nature of contents: ; Literary form: Publisher: 2007Dissertation note: Foot and Mouth Disease (FMD) is a highly contagious infection of cloven-footed animals such as buffalo, cattle, sheep, goats and camels and FMD is characterized by high rise of temperature, salivation, smacking of mouth, vesicular lesion in the buccal cavity, inner flares, coronary band and interdigital spaces, memory glands etc. In Pakistan FMI) disease is caused by "0", "A" or "Asia-i" type of the virus of an Aphthovirus of Picornaviridae. The vaccinal serotypes of FMD virus were characterized as "A", "0" and "Asia-i" by virus neutralization test using imported mono-specific rabbit antiserum. Each of the serotypes multiplied rapidly on monolayer of Baby Hamster Kidney -21 (BHK-21) cells.
The BHK-2 I cells were propagated in carrel and roux flasks in MEM 199 containing 10% fetal bovine serum. Heat treated goat serum was equally effective as growth promoter for BHK-21 cell line. The cells rapidly multiplied and formed a monolayer within 72 hours at 37 °C. The cells were harvested using trypsin (0.025%) without affecting the cell viability that was observed by cytometeric as well as by colorimetric assays. The cells were stored in cryogenic containers and revived successfully on 12 months post storage.
The FMD virus isolate ("0", "A" and "Asia-i") grew well on the monolayer of BHK-21 cells and produced more than 106, and i04 units of the Tissue Culture Infective Dose-50 (TCID50) on 5th passage, respectively. Each of the virus serotypes was effectively inactivated using 0.12 % formaldehyde, or 0.004 M of Binary Etyhieneimine (BET).
The inactivated virus suspension was admixed with either oil base, lanolin or aluminium hydroxide gel and homogenized to get stable vaccine preparation. The adjuvant containing vaccines induced detectable level anti-FMDV-VN antibodies titer in buffalo calves on 19 days post-priming. Oil and gel based FMD vaccines induced detectable geometic mean titer (GMT) of the anti-FMDV-CFT antibodies (2-3 and 7-8) on 19 days post vaccination, respectively. The oil and gel based vaccines induced 1: 64 and 1:80 GMT titer of the anti-FMDV-CFT antibodies on 128 and 64 days post-vaccination, respectively and the titer declined there after as 1: 9 and 1: 3.3 on 258 days post vaccination. From this study it can be concluded that oil based vaccine induces the antibody response in buffalo latter than that of gel adsorbed vaccine. Higher titers of the antibodies are retained for comparably longer period of time by oil based vaccines. Moreover, age of buffaloes, animal species and vaccine storage at 4 C exhibited undetectable effects on the antibody response to the vaccine.
The study has indicated that vaccination programs against field infection of FMD in all the domestic cloven footed animal species could be effective way of immunoprophylaxis.
Availability: Items available for loan: UVAS Library [Call number: 0973,T] (1).
Add to cart (remove)
Immuno Pathological Effects Of Neem (Azadirachta Indica) In Commercial Broiler Chickens
by Zahid Jawad | Prof. Dr. Muhammad Younus | Dr. Muti-ur-Rehman | Prof. Dr. Azhar.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2012Dissertation note: These experiments were conducted to study the effects of Azadirachta indica admixed in poultry feed on weight gain performance, haemtological values,immune modulations, and toxic effects in broiler chickens. A total number of 144 commercial broiler 1-day old chicks were reared in the experimental sheds of the Department of Pathology, University of Veterinary & Animal Sciences, Lahore, The birds were fed with balanced commercial feed and water ad libitum. The birds were divided into 3 groups; A, B and C having fourty eight chicks each. Birds of all groups were sub divided into four groups of each i.e. A1, A2, A3 and A4; B1, B2, B3 & B4 and C1, C2, C3 and C4, respectively. Each of the sub groups containd 12 birds. Sub groups A4, B4 and C4 were control group with no medication. The birds of groups A, B and C were fed with poultry feed containing dry powder of neem leaves @ 2 gm, 4 gm and 6gm per kg of feed respectively. The birds of groups A1, B1 and C1 were treated with the herb from day 0 to 42 of their life. The birds of groups A2, B2 and C2 were given the neem from day 14 to 42 of their life, whereas the birds of groups A3, B3 and C3 were treated with the herb from day 28 to 42 of their life. Difference between weekly weight gain in the birds of groups A1, B1 and C1 was non significant (P>0.05) however the difference between weight gain in the treated and control groups was significant (P<0.05). The birds treated with the herb from day 0 of their life showed more weight gain. There was no difference in the haematological indices between all of the treated groups and the control groups. The neem treated birds showed increased antibody titers against ND and IBD viruses as compared to control groups. The values of ALP and ASTshowed decreasing trend when the level of neem leaf meal was increased in the ration. Serum creatinine and serum uric acid values posed a slight declining trend in the neem fed birds. There was a decrease in serum cholesterol level in the neem treated bird groups, the higher the concentreation of the herb, the lower the cholesterol value. The organ body weight indices showed that there was no significant difference in liver, spleen and thymus weights among treated groups as well between treated and control groups. There was absence of prominent gross pathological lesions in liver, spleen, kidneys and thymus, however some treated groups showed mild hypertrophied liver and kidneys as did the organs of the birds in control groups. No histopathological changes except a few mild changes were observed in liver, spleen, kidneys and thymus in the birds of experimental groups.
Availability: Items available for loan: UVAS Library [Call number: 1774,T] (1).
Add to cart (remove)
Immunobiological And Molecular Characterization Of Pasteurella Multocida From Buffaloes
by Muhammad Kamran | Prof. Dr. Mansur-ud-Din Ahmad | Dr. Aftab Ahmad Anjum | Prof. Dr. Azhar.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2012Dissertation note: Hemorrhagic septicemia is an acute bacterial disease of buffaloes and cattle caused by Pasteurella multocida. In the present study, 400 samples (200 from carriers and 200 from sick animals) from Sargodha division were collected. Among four districts of the division, 15 samples were positive by API Kit, 13 by conventional biochemical tests and eleven were found positive for P. multocida through serological and molecular characterization. Biochemical profile index obtained with API kits had lesser accuracy than conventional and serological profiles for the identification of P. multocida. Passive mouse protection test and AGPT were used for serological confirmation. Different molecular techniques like SDS-PAGE, PCR and RFLP were used to investigate variation at the molecular level in field and vaccinal strains. There were no significant variation between field isolates and vaccinal strain in sick animals and carriers, or in isolates of different districts. Five major and three minor polypeptide bands were observed by SDS-PAGE. Genetic relatedness among the isolates was assessed by cluster analysis using Fingerprint Analysis of Missing Data (FAMD) of 12 isolates. The12 isolates clustered into 5 groups namely I, II, III, IV and V. Group I and II consisted of only one isolate in each (8.33%) of the total designated BKC-01 (S5) and KBO-01 (S1), respectively. Group III composed of 2 isolates (16.67%) namely KBC-02 (S4) and MNO-01 (S2). Group IV had the highest numbers of isolates (50%) designated as KBC-02 (S3), MNO-01 (S6), BKO-02 (S7), MNC-02 (S8), SGO-02 (S9) and V. Only two isolates were typed in group V (16.67%) named as SGO-01 (S10) and BKO-01 (S11).
The size of amplified gene was 460 bp. HindIII I endonuclease cleaved bacterial genome at four sites as compared to other four enzymes (DNase1, PstlI, EcorI and BamHI) change the writing of these enzymes which cleaved at two sites. The isolates were also subjected to ten routinely used antibiotics for sensitivity testing and found enrofloxacin as drug of choice with 90.91% sensitivity, followed by gentamycine, chloramphenicol, ciprofloxacine and norfloxacine (72.73%), ampicillin and amoxycillin (45.45%), amikacin (36.36%) and lowest to sulfadiazine and erythromycine (18.18%).
Availability: Items available for loan: UVAS Library [Call number: 1767,T] (1).
Add to cart (remove)
Immunoprophylaxis Of Tick Infestation In Bovine
by Zakir Ali | Prof. Dr. Azhar Maqbool | Prof. Dr | Prof.Dr. Khushi Muhammad.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2010Dissertation note: A study to investigate prevalence of different genera of hard ticks was carried out in three districts of the Punjab province, Pakistan (Faisalabad, Jhang and Khanewal). Overall prevalence of Hyalomma species is the highest at 61 % as compared to other genera of hard ticks. In sex-wise distribution, it was found that female Hyalomma species were the highest at 85% followed by A mblyomma species at 81 %, whi Ie Rhipicephalus (Boophilus) species and Haemaphysalis species were at 77%. Infestation rate in cattle at 70% was higher as compared to buffaloes at 34%. In tick infestation level study, high infestation level in cattle at 59% was higher as compared to that of buffalo population at 18%. In cattle population, peR results showed the prevalence of T annulata in H anatolicum and Hidromedari ticks as 50% and 40% respectively. No theilerial organism was detected in Himarginatum, Rhipicephalus (Boophilus) annulatus and Amblyomma variegatum ticks. Three different types of vaccines were prepared from different organs of ticks i.e., salivary gland, intestine or whole ticks of the same species of Hyalomma and they were injected to rabbits. It was found that vaccine prepared by grinding whole tick produced the higher level of antibody as compared to two other vaccines. Each of the whole tick homogenate vaccine prepared from either of the species of Hyalomma, Rhipicephalus or Amblyomma and injected to rabbits. These vaccines produced antibody as well and cross reacted with each other showing each of the hard ticks were antigenically similar. Efforts were made to prepare oil based whole Hyalomma tick vaccine with three different antigen concentration 5.0 mg, 7.5mg and 10.0 mg and evaluated its potency in buffalo calves. It was found that the vaccine dose containing 5.0 mg antigen per dose did not produced detectable antibody in buffalo calves while the vaccine containing 7.5mg or more antigen produced detectable antibody. Moreover, we concluded that montanide based bard tick homogenate vaccine with more than 7.5mg protein per dose is effective in producing antibodies against tick infestation in the dairy animals. The antibody level in vaccinated buffaloes as well as invaccinated rabbits reached to peak level on day 45 post vaccination and started declining thereafter. Capacity of vaccine in controlling tick infestation was assessed in 12 cross-bred calves. It was found tbat rejection percentage in immunized group was higher as compared to control group. There was no difference of engorgement period between immunized and control group. Reproductive index in immunized group was lower as compared to control group. The efforts were made to grow midgut cells insect culture media after isolation them from Hyalomma Ticks.. The purpose of this experiment was to grow midgut cell and then use these cells as a source of was found that the vaccine dose containing 5.0 mg antigen per dose did not produced detectable antibody in buffalo calves while the vaccine containing 7.5mg or more antigen produced detectable antibody. Moreover, we concluded that montanide based bard tick homogenate vaccine with more than 7.5mg protein per dose is effective in producing antibodies against tick infestation in the dairy animals. The antibody level in vaccinated buffaloes as well as in vaccinated rabbits reached to peak level on day 45 post vaccination and started declining thereafter. Capacity of vaccine in controlling tick infestation was assessed in 12 cross-bred calves. It was found tbat rejection percentage in immunized group was higher as compared to control group. There was no difference of engorgement period between immunized and control group. Reproductive index in immunized group was lower as compared to control group. The efforts were made to grow midgut cells insect culture media after isolation them from Hyalomma Ticks.. The purpose of this experiment was to grow midgut cell and then use these cells as a source of contamination for the tick cell culture which are extrinsic as well extrinsic. The growth rate of these cells in our study was not optimal so the media was not splitted to get more cells.
Availability: Items available for loan: UVAS Library [Call number: 1416,T] (1).
Add to cart (remove)
Implications Of Varying Electrolytes (Sodium Potassium And Chloride And Their Balance On Growth Performance and Physiologcal Responses of Broilers
by Mirza Muhammad Haroon | Prof.Dr.Talat Naseer Pasha | Dr. Saima | Prof. Dr. Muhammad | FAPT.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2010Dissertation note: A series of experiments were envisaged to evaluate the effect of supplementation of dietary electrolytes with applicability of dietary electrolyte balance by using different salts on growth and carcass responses, body physiological responses and litter condition of modern day broiler chickens under phase feeding system.
Day-old straight-run Hubbard broiler chicks were randomly allocated to eight dietary treatments replicated four times in such a way that a floor space of 0.09 m2 was provided to each bird. Birds were housed in environmental control system. Continuous light was provided 24 hours for the first 3 day and thereafter a light pattern of 23L:ID was adopted for the entire experimental. In each experiment, a basal diet was formulated having lowest level of each electrolyte. In experiment 1, Na and DEB in the basal diet were maintained at 0.08% and 160 mEq/kg, respectively. This basal diet was then supplemented with sodium bicarbonate (NaHCO3) and disodium sulphate (Na2SO4) to maintain four levels of Na (0.17, 0.26, 0.35, and 0.44%) by fixing K and Cl with DEB 200, 240, 280 and 320 mEq/kg, respectively. In experiment 2, a basal diet was prepared to contain the lowest level of K and DEB i.e. 0.70% and 160 mEq/kg, respectively. This basal diet was supplemented with potassium sulphate (K2S04) and potassium carbonate (K2C04) by fixing Na and Cl. So, four levels of K (0.86, 1.02, 1.18, and 1.34%) were maintained in eight dietary treatments. In experiment 3, a basal diet was prepared to contain the lowest level of Cl and DEI3 i.e. 0.17% and 320 rnEq/kg, respectively. This basal diet was supplemented with ammonium chloride (NH4CI) or calcium chloride (CaCl2), so that, in each diet, we can have the increase of 40 mEq/kg DEB at 0.3 I, 0.45, 0.59 and 0.73% of Cl at DEB 280, 240, 200 and 160 mEq/kg, respectively, by fixing Na and K.
At the end of each phase (pre-starter, starter, grower and finisher); data of feed intake, weight gain, feed to gain ratio, mortality, water intake, water intake-to-feed intake ratio and litter quality were collected and evaluated. At the end of each experiment, two birds were slaughtered for their carcass and body physiological responses. Blood was also collected from these same birds for blood pH. glucose and serum mineral analyses. For statistical analyses, four (4) levels of electrolyte were used with two (2) sources of salt in a factorial arrangement of 4 x 2 under completely randomized design using GLM.
In experiment 1, highest weight gain and feed intake were found in birds consuming 0.17% (NaHCO3) and 0.44% (Na2SO4) dNa, respectively during d 1-10. However during d 11-20, weight gain and feed:gain were reduced with same levels of dNa. Maximum weight gain was found in diets containing 0.17 and 0.24% dNa during d 21-33 and 34-42, respectively. Improved FG was the result of diets containing 0.20% (NaHCO3) and 0.37% (Na2SO4) dNa during d 2 1-33. Linear rise in water intake was observed in birds with increasing dNa during d 1-42. Minimum litter dampness was seen at 0.37% (NaHCO3) and 0.2 1% (Na2SO4) during d 1-10. Minimum and maximum mortality were observed at 0.37% level of dNa in case of supplementation of NaHCO3 and Na2SO4, respectively. Significantly increased pH and kidney weight while reduced dressing percentage were observed by amount and salt of dNa. Increased breast, thigh and gizzard weights were observed with increasing sodium. Weights of pancreas, gall bladder, bursa, and lungs, and shank length were affected by interaction of amount and salt of dNa.
In experiment 2, BWG (P0.03) and feed:gain (P0.05) was improved at 1.20% dK during 32 to 42 d of age. K2S04 supplemented diets increased feed intake during I to 10 d (P<0.05), water intake during 34 to 42 d (P0.04) and mortality during 1 to 42 d (PE0.02). Water intake was increased linearly with increasing dK when supplemented by K2C03 whereas this was decreased linearly with increasing dK with that of K2S04 during 11 to 20 d (P0.002). The K2S04 supplemented diets lowered the blood pH (P0.00l), dressing (P0.04), abdominal fat (P0.03) weights and shank length (P0.02). A significant salt x dK effect was observed where low levels of dK with K2C03 and high levels with K2504 exhibited lower litter moisture during all phases. Increasing concentration of serum cations was observed by increasing dK, by balancing of increasing serum HCO3 with decreasing Cl at the end of the experiment.
In experiment 3, body weight gain and water consumption were optimized at 0.73%, and 0.73% (CaCI2) and 0.45% (NH4CI), respectively, during d 1-10. During d 2 1-33, maximum weight gain and feed intake were observed at 0.42%, and 0.63% (CaCI2) and 0.63% (NH4CI), respectively. Highest weight gain (0.60% dcl), feed intake (0.61% CaCI2 0.42% NH4CI) and mortality (0.73%) while improved feed:gain (FG; 0.38% dCl) were obtained by interaction effects of amount and source of dCl during d 34-42. Fl (0.60%), feed:gain (0.3 8%) and litter moisture (0.31% NH4CI; 0.35 CaCl2) was affected during I -42d by amount of dcl. Increased blood pH, serum glucose and dressing percentage were found by dCl and replacing CaCI, with NH4C1. Improved breast meat, thigh meat and shank length while reduced abdominal fat were observed by replacing salts (CaCI2 withNH4Cl).
It is concluded that birds showed better growth performance and reduced mortality against high levels of dietary sodium in Na2SO4 than NaHCO3 supplemented diets, while significant rise in pH, breast and thigh meat yield while reduced dressing percentage were observed with increasing dietary sodium. The importance of high concentration of dK for better weight gain and feed efficiency was depicted in later stages of production. K2C03 increased survivability and dressing responses but both dK levels and salts played important role for water intake, litter condition, carcass characteristics and serum mineral concentration. Birds were also suggested to be more sensitive to amount and source of dC1 in later part of their life.
Availability: Items available for loan: UVAS Library [Call number: 1212,T] (1).
Add to cart (remove)
Improving Nutritional Value And Acceptability Of Dairy Products With Lower Contents Of Saturated Fatty
by Muhammad Nadeem | Dr. Muhammad Ayaz | Dr. Imran Javed | Prof. Dr. Muhammad.
Material type: ; Format:
print
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1742,T] (1).
Add to cart (remove)
Influence Of Early Weaning On Growth Performance, Plasma Metabolites And Rumen Fermentation Indices In Neonatal
by Muhammad Afzal Rashid | Prof. Dr. Talat Naseer Pasha | Prof. Dr. Makhdoom Abdul Jabbar.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2013Dissertation note: Rearing of young calves is a labor intensive and costly segment of livestock production. From birth to weaning, young calf undergoes a transition from monogastric to adult ruminant. The concept of weaning from milk at an early age is based on early development of functional rumen enabling calves to utilize low quality roughages. In current study, a series of experiments were conducted to refine the more effective weaning regime for buffalo calves and use of by-products of the ethanol production industry in early weaned cattle calves.
Conventionally, buffalo calves are kept with the dam, allowed to suckle a little amount of milk along with seasonal green forages, and weaned around the age of one year. To date, limited published work was available on growth performance and economics of buffalo calves weaned from milk at an early age. Therefore, the experiment was conducted to reduce the weaning age and evaluate the growth performance of male Nili-Ravi buffalo calves. Twenty-four male buffalo calves were assigned to one of the three treatments: continuous milk feeding (CMF), limited milk feeding (LMF), and early weaning (EW). After colostrum feeding, calves were individually fed whole milk at 10% of their BW, adjusted weekly until 6 wk of age. Thereafter, milk allowance was gradually tapered to zero in CMF, LMF and EW treatments at 12, 10 and 8 wk of age, respectively. Calf starter feed was provided ad libitum from wk 2 through wk 12 and individual intakes were recorded daily. Blood sampling was carried out form wk 6 through 12, on a weekly basis. The BW and structural measurements (HG, WH, and HW) were carried out at the start of experiment and later on a weekly basis. In young buffalo calves, the regimen of weaning at 8 weeks of age was more effective. The early weaned calves showed similar growth rate to those in the CMF and LMF by consuming more calf starter and saving a substantial amount of high priced milk. On the basis of the results of this experiment, buffalo calves successfully adapted to early weaning that might help to mitigate issues like poor growth and low returns associated with traditional calf rearing practices. Furthermore, this study effectively reduced the weaning age from 1 year to 8 weeks of age. Hence, reducing weaning age did not affect the growth performance of Nili-Ravi buffalo calves by 12 weeks of age.
Early development of the rumen is the main objective of a successful early weaning program which depends upon the amount of starter intake, VFA production, and ruminal papillae development. Studies have shown that grains in starter feed can be replaced by DDGS up to 28% of DM without compromising the growth performance and rumen development. Second experiment was planned to evaluate the effects of replacing grains and soybean with DDGS and ammonia treated DDGS at 25% of DM. Study was conducted in collaboration with dairy science department SDSU (USA). Twenty one neonatal male Holstein calves were assigned to one of the three of dietary treatments: C = 0% DDGS, DDGS = 25% DDGS, CAFEX-DDGS = 25% CAFEX treated DDGS. In a 10 week experiment, calves were fed 680 g MR through 4 week, reduced to half during wk 5, and weaned at the end of wk 5. Starter intakes were conducted daily; whereas, body weights, structural measurements were conducted at the start of experiment and then on a weekly basis. Jugular blood samples were taken on a weekly basis using EDTA and NaFl coated evacuated tubes. Rumen samples were collected from a subset of 15 calves (n=5 calves/ treatment) at wk 5, 7 and 10. At the end of experiment, four calves from each treatment were also slaughtered to determine rumen morphometric measurements (PL, PW, RWT and PC). Experiment illustrated that weight gain, structural measurements, total starter intake, DMI and feed efficiency were not affected by the inclusion of DDGS and CAFEX treated DDGS at 25% of DM in starter feeds. CAFEX treatment of DDGS improved the CP contents of DDGS from 29.5% to 40%; however, inclusion of CAFEX-DDGS in starter reduced feed intake during the pre-weaning period. Whereas, overall starter intake was higher in calves fed DDGS based starter feed indicating the effect of ammonia treatment on palatability. Lower pre-weaning starter intake, slow rumen fermentation of CAFEX-DDGS resulted in lesser BHBA concentration leading to lesser development of rumen papillae growth (PL and PW). However, there was a tendency for higher weight gain in calves fed DDGS based starter due to increase in starter intake. In the light of these results it is concluded CAFEX-DDGS can be included in starter feeds at 25% of DM without affecting the growth performance. However, further research is required to evaluate the digestibility of DDGS after CAFEX treatement. Similar, growth performance indicates that CAFEX-DDGS can replace the corn and soybean meal in starter feeds.
In third experiment, microbial diversity in developing rumen and intestine of young calves fed DDGS and CAFEX treated DDGS at 25% of starter was investigated. Experiement was carried out at SDSU dairy research station (USA). Fifteen calves with n=5 per treatment, fed according to protocols described in Experiment II. Calves were sampled for rumen contents at wk 5, 7 and 10 of age; whereas, intestinal contents were collected at the time of slaughter. The DNA was extracted subjected to PCR-DGGE and dendogram was constructed using cluster analysis software. Results revealed that microbial population was highly different from each other at wk 10 indicating the effect of age and dietary treatment on rumen micro flora. Whereas, intestinal and rumen bacterial diversity at wk 5 and 7 of age was not affected by inclusion of DDGS and CAFEX-DDGS in starter feed. The changes in intestinal microflora of DDGS and CAFEX-DDGS fed calves compared with control group showed that the effect of dietary treatments on post-ruminal availability of nutrients and microbial proteins. In conclusion, rumen bacterial population changes with the advancing age and the type of ingredients used in the diet. Further, research is required to identify the effect of feeding DDGS on growth of particular bacteria like methanogen and their impact on methane production and feed efficiency.
Availability: Items available for loan: UVAS Library [Call number: 1595,T] (1).
Add to cart (remove)
Isolation And Characterization Of Clostridium Perfringens From Domestic Animals An Man In Punjab
by Waheeda Raana | Prof. Dr. Muhammad Akram Muneer | Dr. Khushi Muhammad | Prof. Dr | Faculty of Veterinary Sciences.
Material type: ; Format:
print
Publisher: 2007Dissertation note: The objectives of present investigation were to isolate the Cl. perfringens from the domestic and zoo animals and human beings; characterize it through biotyping and pathogencity observation, and to develop a vaccine- from the common CI. perfringens isolate. For this purpose a total of 1240 samples of morbid tissues (faecal samples from animals and gangrenous tissues from humans). From cattle (n=180), goats (n=180), horses (n=250), camel (n=250), deer (n=28), wild beast (n=07), monkeys (n16), zebra (n10), elephant (n01), yaks (n=09), foxes (n07), jackals (n=08), baboons (n=08), and bears (n08) were collected and processed for isolation of CI. perfringens. In addition a total of 100 human cases; 83 wound swabs and 17 gas gangrene were also collected and analyzed bacteriologically. This study has indicated that Clostridium (Cl.) perfringens causes multiple clinical problems in animals and human beings as was indicated by good rate of its isolation from the examined morbid tissues and fecal samples. Of the total 1240 samples from various types of animals 297 (23.95%) indicated the presence of CI. perfringens. The overall isolation percentages of various types of CI. perfringens from the cattle, sheep goat, horses, camel, wild beast, deer, bear, jackal, zebra, monkeys, yak, elephant, baboon, foxes, and humans were 22.2, 12.2, 57.2, 8.0, 21.6, 57.1, 30.76, 37.50, 50.0, 50.0, 37.50, 33.33, 100.00 75.00, 57.14 and 18.00, respectively. Of the tested population of domestic animals, goats indicated the highest Cl. perfringens (57.2%) infection rate. In the zoo animal population, the elephant, baboons, wild beast, jackals, and foxes were shown to be heavily infected with various CI. perfringens types compared to other wild life animals species. Of the 298 isolates obtained through this investigation Cl. perfringens type D was obtained from 118 (39.7%) morbid samples of the domestic and zoo animals; CI. perfringens type A from 63 (21 .21%) samples, Cl. perfringens type B from 95 (31.98%) samples; and the CI. perfringens type E was isolated from 21(7.07%) samples. None of the samples indicated the presence of CI. perfringens type C. Of the total 100 samples from the humans, CI. perfringens type A was isolated from 14 (14%) and Cl. perfringens type D was isolated from 04 (4%). None of the human samples showed the presence of Cl. perfringens types B, C, or E. Of the 17 human gangrene tissue samples, Cl. perfringens type A was isolated from 09 (52.94%) samples and the Cl. perfringens type D was recovered from 02 (11 .76%) samples. However, all attempts to isolate Cl. perfringens types B, C or E from the human gangrene tissue/material samples were unsuccessful.
The overall findings indicated that of the total 297 samples positive for various Cl. perfringens types 63 indicated the presence of Cl. perfringens type A. Of those 63 Cl. perfringens type A isolates, 49 were recovered from the animals; and 14 were isolated from the wound swabs and gangrene tissue material samples from humans. Of the 63 Cl. perfringens type A isolates from the animals, 5 were isolated from cattle; 3 from sheep, 20 from goats; 5 from the horses; 10 from camels, 01 from the deer; 01 from the zebra, 01 from baboon, 01 from fox, 01 from the monkey, and 01 isolate was recovered from yak. Of the 14 isolates of Cl. perfringens type A from humans, 05 were recovered from the open wound swabs, and 09 strains of the organism were isolated from the gangrenous tissue material.
Of the 297 samples positive for various Cl. Perfringens types, 95 animal samples indicated the presence of Cl. perfringens type B. These 95 isolates were obtained from cattle (n=22), sheep (n=10), goats (n=30), horses (n=03), camel (n=14), deer (n03), wild beast (n=02), monkey (n=02), zebra (n=02), yak (n=01), fox (n01), jackals (n02), baboon (n02) and bear (n=02). None of the human samples was positive for Cl. perfringens type B. Isolation of C/. perfringens type B from the zoo animals is a matter of concern for the human health, as the zoo visitors have the possibility to get infected with this organism.
Of the total 297 positive samples of faecal and morbid tissues from various types of animals and human being Cl. perfringens type D isolates were recovered from 118 (39.7%) samples. Of these 118 isolates of Cl. perfringens typeD, 114 were obtained from various types of animals, and 04 isolates were from the humans. Of the 114 animal isolates, 10 from the cattle, 5 from the sheep, 44 from the goats, 9 from the horses, 27 from the camel, 4 from the deer, 02 from the wild beast, 02 from the monkey, 02 from the zebra, 01 from the elephant, 01 from the yak, 02 from the fox, 02 from the jackals, 02 from the baboon, and 01 isolate the bear. A total of 04 CI. perfringens type D isolates were recovered from gangrenous tissue and open wound samples from human beings.
During this investigation 21 isolates of CI. perfringens Type E were obtained from domestic and zoo animals. Of the 21 isolates, 03 were from cattle, 04 from sheep, 09 from goats and 03 from horses, 01 from monkey, and 01 from the baboon. All the 21 isolations were from the fecal material of above mentioned animals. None of the human samples was positive for CI. perfringens type E.
Alpha toxin was produced by all of the 63 Cl. perfringens type A isolates. Within the toxin producing isolates, there was no difference in the quality of toxin in respect to its lethality for mice, dermonecrosis effects for guinea pigs and cytotoxicity in the HeLa cells. The 07 fecal isolates were hemolytic, lecithinase (+), and positive for all biochemical characteristics of Cl. perfringens. Those isolates were not lethal for mice, indicated no dermonecrotic activity in guinea pig, and produced mild degree of cytotoxicity in the cell cultures.
The activity of beta toxin obtained from 95 isolates of CI. perfringens type B isolates was determined using standard toxin-antitoxin test carried in mice and the standard serum neutralization test with antitoxin raised in rabbits. Within the toxin producing isolates, no difference was seen in the potential of toxin based on its lethality for mice.
Epsilon () toxin activity of the 114 isolates of CI. perfringens type D from animals and 4 of the human isolates was also determined. Of the 114 animal isolate, 110(96.49%), and all the 4 human isolates produced E-toxin. There was no difference in the lethal potential of toxin for mice, dermonecrotis action in guinea pig and production of CPE in VERO cells.
Iota (i) toxin activity of the 21 isolates of Cl. perfringens type E was also determined serum neutralization test in mice. Many isolates produced more than one major toxin. Ci. perfringens (CP) type
A produced Alpha (a) toxin; CP type B produced Alpha (a), Beta (3) and Epsilon (E) toxins; OP type D isolates produced Alpha (a) and Epsilon (E) toxins, and OP type E isolates produced Alpha (a) toxin + Iota (i) toxin.
The immunobiologic studies of isolates showed that many of the isolates were quite antigenic. Isolates of CI. perfringèns type D and B were found highly immunogenic as those isolates producing SN titer of 1:320.
Availability: Items available for loan: UVAS Library [Call number: 0998,T] (1).
Add to cart (remove)
Isolation And Characterization Of Phytase Producing Fungi For Poultry Feed
by Ali Ahmad (2002-VA-121) | Prof. Dr. Aftab Ahmad Anjum | Prof. Dr. Masood Rabbani | Prof. Dr. Kamran Ashraf.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Isolation And Characterization Of Phytase Producing Fungi For Poultry Feed Availability: Items available for loan: UVAS Library [Call number: 2770-T] (1).
Add to cart (remove)
Isolation And Molecular Characterization Of Antimicrobial Resistant E-Coli Isolation From Retail Meats
by Ali Ahmed | Prof.Dr.Khushi Muhammad | Dr.Mueen Aslam | Prof.Dr.Masood.
Material type: ; Format:
print
; Nature of contents: ; Literary form: Publisher: 2010Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1252,T] (1).
Add to cart (remove)
Isolation And Molecular Characterization Of Rotavirus From Calf Diarrhea And Preparation Of Vaccine
by Nadia Mukhtar (2008-VA-718) | Prof. Dr. Tahir Yaqub | Dr. Jawad Nazir | Prof. Dr. Asim Aslam.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The main contribution of the thesis “Title” is threefold. First, rotavirus was isolated and identified from calf diarrhea samples from 10 districts in Punjab. Second, optimization of molecular diagnostics and genome sequencing was done of the positive bovine rotavirus isolates from Pakistan. And thirdly, the preparation as well as evaluation of killed vaccine against bovine rotavirus isolates was performed.
The above three objectives of this study were created due to the distribution of rotavirus all over the world as an enteric pathogen in both human as well as animal species. In developing countries where cases of malnutrition are very common in young children and animals, this virus has a special importance as an etiologic agent. It causes severe diarrhea, when accompanied with severe dehydration, leads to high rate of mortality. Among the rest of the infectious diseases present in calves, neonatal diarrhea is a dire threat as it has a major impact on economic viability. Calf diarrhea is the most important problem in dairy calves that causes more financial losses to the calf producers than any other. Although numerous etiological agents may be implicated, Rotaviral diarrhea is one of the main infections causing calves to scour between five to fourteen days of age.
The cattle and buffalo calves’ population in Pakistan is devastatingly affected by the neonatal calf diarrhea due to rotavirus outbreaks. Neonatal calf mortality varies from 8.7 to 64 per cent throughout the world accounting for 84 per cent of the total mortality in the first month of age and is particularly high in the third week. While vaccination is available for the disease, it is being imported in Pakistan from other countries. The importation of the said vaccine thus, leads
SUMMARY
117
to extra expenses for the farm managers. As mentioned above one of the aims of this study is to develop an effective vaccine against bovine rotavirus and cut down expenses for farm managers.
To fulfill the objectives proposed in this thesis, rectal swabs and fecal samples were collected from public/private sector buffalo and cattle farms from 10 districts of the Punjab: Lahore, Faisalabad, Okara, Sahiwal, Sargodha, Chakwal, Bhakkar, Bahawalnagar, Multan and Bahawalpur. The samples were selected on the basis of agro-ecological zones of the province. As sampling based on agro-ecological zones allow for better data collection for recording incidence rate of the disease. Samples (n=10) from each diarrheic and apparently healthy cattle and buffalo calves from all of the districts were collected. In this way a total of 200 samples from buffalo calves and 200 samples from cattle calves were collected for this study.
Antigen of bovine rotavirus was screened from calf feces through Direct Sandwich ELISA. Bovine rotavirus samples were further confirmed through the amplification of the VP4 and VP6 genes through Rt-PCR. Homology and phylogenetic analysis of the sequenced samples was also performed. The data gathered through this analysis was helpful in collecting important data regarding the similarities as well as differences of the bovine rotavirus strain present in Pakistani isolates when compared to local regions as well as international ones. The data is also valuable when it comes to production of effective vaccines again rotavirus. RNA viruses are known to mutate unpredictably and it is safe to assume that a particular vaccine might not work effectively against all strains of a particular virus. That’s why analysis of data pertaining to all possible BRV strains is important for creation of an effective vaccine of import quality in order to help the economy of Pakistan.
Rotavirus isolate, after adaptation on MDBK cell line, was further propagated to determine TCID50 for vaccine preparation purposes. Final dose of the vaccine was adjusted to
SUMMARY
118
approximately 3ml, containing 40% culture and 60% adjuvant. Final vaccine contained 1ml of inactivated bovine rotavirus harvested culture, 1.8ml of Montanide ISA 70, 0.2ml of PBS and 0.05% of Thiomersal sodium. Efficacy of the vaccine was checked in rabbits.
For vaccine efficacy testing twenty one month old rabbits were procured. Rabbits were reared in individual isolator units in the shed facility of Quality Operations Laboratory, UVAS, Lahore. The collected rabbits were divided into two groups, vaccinated and unvaccinated rabbit groups. Each group had 10 rabbits. One ml of rotavirus vaccine was administered intramuscularly in vaccinated rabbits group. In unvaccinated rabbits group 1ml of normal saline was injected intramuscularly. The second dose of vaccine was administered at 24 days post-vaccination of first dose. The rabbits from both groups were bled at 0, 14, 28 and 42 days post-vaccination. The antibody response of rabbits to rotavirus vaccine was determined through using Antibody detection kit. The rabbits were challenged on day 42 post-vaccination using live field strain of rotavirus having TCID50 1 × 108.5. The rabbits were observed daily up to 14 days post-vaccination for appearance of diarrheic signs. The stool samples of ELISA positive were further confirmed by reverse-transcriptase polymerase chain reaction (RT-PCR) at least 14 days post-vaccination.
The field trials were conducted at Livestock Production Research Institute, (LPRI) Bahadurnagar, Okara. The field study was done to evaluate the prepared rotavirus vaccine for prevention of neonatal calf diarrhea. For this trial, 100 dams were selected. The dams were divided into two groups and each group consisted of 25 pregnant cows and 25 pregnant buffalos. A total of 50 dams (25 cattle and 25 buffalo) were vaccinated intramuscularly with 3ml of prepared inactivated rotavirus vaccine. The 50 remaining dams (25 cattle and 25 buffalo) were kept unvaccinated.
SUMMARY
119
The blood samples were collected for serum separation after 0, 14, 28 and 42 days post vaccination in dams. The antibody titers were measured using antibody detection ELSIA kit.
After calving, newborn calves were fed with the colostrum obtained from the vaccinated dams daily for 5 consecutive days. Similarly, the calves from unvaccinated dams were fed on colostrum from their unvaccinated dams.
The 5 calves from vaccinated and 5 from the unvaccinated dams were isolated in individual isolators. These calves were challenged orally with 1ml of live field strain of rotavirus having 1 × 108.5 TCID50 and the animals were observed for diarrheic signs for 7 days.
All of the collected data was subjected to statistical analysis of (one way) ANOVA and t-test using SPSS. The <0.05 p-value determined the significance of the results through this study.
The data collected through this study allowed for the creation of valuable inferences. According to the current results of this study, the prevalence of bovine rotavirus was shown to be 6% in Punjab. This 6% included 40% and 20% from the districts of Lahore and Faisalabad respectively. Keeping these results in mind, it is to be noted that the recorded prevalence percentage from this study is higher than the prevalence of 2% in Lahore according to a previous study done in the country. It is to be noted that while the 6% prevalence of rotavirus in Punjab detected through ELISA is lower than the prevalence of 16.83% which was detected by ELISA in diarrheic calves from pervious researches, the 12% prevalence detected by ELISA in this research is higher than the prevalence of 7.25% detected by ELISA in diarrheic calves from past data.
In the present study of this thesis it was observed that the use of killed vaccine for bovines produced more efficient immune response in calves. It also enhanced the clostral rotavirus antibody titers as compared to previous studies where the use of the same strain of modified-live virus in a commercial vaccine administered IM with or without adjuvant did not significantly
SUMMARY
120
elevate colostrum antibody titers. The results collected from the present research showed that the average antibody titers in the 25 cattle dams at 0, 14, 28 and 42 days post vaccination were 0%, 57%, 68% and 78% respectively. In a similar manner the average antibody titers in the 25 buffalo dams at 0, 14, 28 and 42 days post vaccination were 0%, 55%, 70% and 82% respectively. These results indicated
the protective maternal antibody level against the rotavirus which will be transferred passively to calves. The results indicate that vaccinated dams were able to provide passive immunity to both buffalo and cattle calves in order to provide protection against the deadly virus. Availability: Items available for loan: UVAS Library [Call number: 2570-T] (1).
Add to cart (remove)
Isolation And Molecular Identification Of H9N2 Avian Influena Virus From Human In Punjab Province Pakistan
by Abdul ahad | Prof .Dr, Masood rabbani | Prof. Dr. Rana | Prof. Dr. Tahir yaqub.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2012Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1926,T] (1).
Add to cart (remove)
Isolation, Characterization And Pathogenesis Of Capripox Virus
by Abdul Sajid | Prof. Dr. Zafar Iqbal Chaudhry | Dr. Aftab | Prof. Dr. Azhar Maqbool.
Material type: ; Format:
print
; Nature of contents: ; Literary form: Publisher: 2010Dissertation note: Goat pox is the most important pox diseases of livestock and it usually
causes huge economic losses. The economic losses occur in terms of mortality,
reduced productivity and lower quality of wool and leather. The clinical
manifestations of the disease include high temperature, lesions skin in the form of
macules, papules, vesicles, pustule and scabs on hairless areas of the body. The
disease is highly contagious having high morbidity and mortality in the infected
herds. The present study was conducted to document the prevalence of goat pox
disease in the different regions of Punjab. The study was based on clinical
manifestation of the disease in various collecting spots including slaughter houses,
cattle and hide markets and tanneries. The prevalence of goat pox at slaughter
houses in different regions was 9.93% in arid region followed by 8.69% and 7% in
southern and northern irrigated regions respectively. The prevalence of pox disease
in sheep was highest (8.54%) in the northern irrigated region, 7.69% and 6.62% in
arid and southern irrigated regions respectively.
The prevalence of pox recorded in the hide markets shows a trend of high
presence 7.29% in arid region followed by 6.22% and 3.84% in southern and
northern irrigated regions. Whereas in sheep the overall prevalence was 0.51 %,
4.44% and 1.66% in northern irrigated, arid and southern irrigated regions.
In tanneries the pox lesions were identified on the basis of method as
adopted in hide markets. The overall prevalence of pox in goat was 3.96%, 4.06%
and 4.09% while in sheep 9.58%, 2.41 % and 10% in northern irrigated, arid and
southern irrigated regions.
The overall prevalence of pox disease in goat was 5%, 5.79% and 5.34% in
Northern irrigated, arid and southern irrigated regions respectively. Where as in
sheep, pox was 3.133%, 4.11 % and 2.67% in Northern irrigated, arid and southern
irrigated regions respectively. The highest trend of incidence of disease was present
in the arid regions followed by southern and northern regions. The slaughter houses
shows high incidence of disease as compared to cattle and hide market and
tanneries. The result was significant (P<0.05) among the regions and samples
collecting spots.
A total of 100 samples consisting of 55 scabs and 45 skin tissues were
randomly selected from the different collecting spots of the three regions. The scabs
and skin tissue samples were processed on dehydrated minimum essential media
tor virus isolation. The virus was isolated on Vero cell line culture and its
characteristics were observed on the basis of specific cytopathic effects. All 55 scab
samples consisting 20 from cattle markets, 20 from slaughter house and 15 from
hide market and tannery were tested through cell culture. The cell culture positive
result for scabs was 60% cattle markets, 20% hide market and tannery and 40%
slaughter house.
All 45 skin tissue samples including 5 from cattle markets and tannery, 20
from hide market and 20 from slaughter house were subjected to virus isolation on
Vero cell line. The cell culture positive result for skin tissue samples was 100% cattle
markets, 30% hide market and tannery and 60% slaughter house. In this way the
total cell culture result for scabs and skin tissue samples from all areas become
41.82% and 51.11 % respectively.
The isolated virus was confirmed through peR. All the collected samples
were also analyzed through peR in order to compare the two techniques for disease
diagnosis. Out of 40 samples from slaughter houses 18 scabs and 15 tissues
sample were positive through peR with 82.5%. Out of 25 samples collected from
cattle markets consisting of 20 scabs and 5 skin tissues, 17 of scabs and 5 skin
tissues were positive with 92%.
Similarly a total of 35 samples out of which 15 were scabs and 20 were skin
tissues collected from hide markets and tanneries. The peR of 7 scabs and 14 skin
tissues was positive with 60%. In this way the total peR result for scabs and skin
tissue from all areas was 42% and 34% respectively.
In the 3rd study of the present project the isolated virus was inoculated in to
experimental animal to study the detail pathogenesis. The disease followed the
same pattern as in the natural outbreak. But however the routes of inoculation affect
the severity of the disease. During the study the diseased animals were periodically
slaughter at weekly interval after the appearance of 1 st clinical signs. The detailed
lesions were observed in different visceral organs and the tissues were collected
and preserved in 10% formalin. The tissues were processed for histopathology and
immunohistochemical examination. The IHC was successfully optimized for the
detection of viral antigen in the tissues of skin, lung and lymph nodes.
Availability: Items available for loan: UVAS Library [Call number: 1372,T] (1).
Add to cart (remove)
Loading