1151.
Prevalence Of Mastitis And In-Vitro Antibiogram Study Of The Mastitogens In Bhag-Nari Cattle
by Shakirullah (2009-VA-089) | Dr. Muhammad Avais | Dr. Muhammad Shafee | Dr. Syed Saleem Ahmad | Dr. Hassan Mushtaq.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Mastitis creates detectable changes in mammary gland and causes inflammation of the mammary gland. In terms of economic losses it is most expensive disease. Mastitis is a worldwide issue which affects the milking animals in any stage of life. Mainly it is caused by bacterial organisms. A study was designed to detect the mastitis and its mastitogens in Bhag-nari cows at district Naseerabad, Pakistan. Milk samples were collected from Bhag-nari cows. All information of milk samples (n=323) were collected randomly on the basis of designed performa (Annexure.1). Two to three strips of milk from each quarter were drawn on the floor surface to examine the presence of pus, blood clots, flakes and change in colour. Strip cup test was applied to detect the clinical mastitis. Surf Field Mastitis Test (SFMT) was used for the detection of subclinical mastitis in Bhag-nari cows. Aseptic techniques were applied by using cotton swabs dipped into 70% ethanol to clean and disinfect teat end. Sterile tubes of 10ml capacity were used to collect the milk samples. The positive milk samples were kept immediately in an icebox cooler and transported to lab (CASVAB) in Quetta. Primarily each milk sample was cultured on Nutrient agar by spread out technique. Mannitol salt agar was used to culture the Staphylococcus aureus. Multiple streaking was applied to isolate the selected bacteria. On the basis of culture characters, microscopic morphology, staining method and biochemical tests bacterial isolates were identified. Prevalence of mastitis in Bhag-nari cattle in Naseerabad, Balochistan was 15.79%. Areas wise the prevalence of mastitis was 18.5%, 16.2%, 14.1% and 12.9% in DM Jamali, Chattar, Baba kot and Tamboo, respectively. Age wise prevalence in the study was 14.29%, 19.63%, 17.58% and 4.88% in age group of 3-5 years old, 6-8 years, 9-11 years and above 11 years, respectively. On the basis of calving number there was significant difference (P<0.05) among the various parity numbers. The animals milked once daily showed 17.06%
SUMMARY
49
mastitis as compared to 3.33% mastitis in animals daily milked more than once. There was significant difference (P<0.05). The prevalence of mastitis in well fed and under fed animals was 5.63% and 18.65%, respectively. Highly significance relation (P<0.05) was observed between the animals of satisfactory and none satisfactory udder hygiene with 6.94% and 33.64% prevalence. The most common bacterial isolates (staphylococcus aureus, streptococcus agalactiae and streptococcus dysgalactiae) were identified in the study. The most effective drugs against isolated bacteria were Ceftiofur, Oxytetracyclinc, chlortetracycline, Norfloxacin and Cephradine. Other antibiotics (Ciprofloxacin and Amoxicillin) were intermediate to resistive (Penicillin). Bhag-Nari is the only dual purpose cattle breed of Balochistan. The cattle have developed resistance to harsh environmental conditions of its home tract through centuries. The production potential (beef, milk) of the breed may be assessed and practical scientific approaches should be developed to improve the animal and facilitate the farmer. Availability: Items available for loan: UVAS Library [Call number: 2671-T] (1).
1152.
Study Of Hematological Alterations And Chemotherapeutic Trials Of Camels Naturally Infected With Trypanosomiasis In Cholistan, Bahawalpur
by Zubair Bashir (2014-VA-782) | Prof. Dr. Aneela Zameer Durrani | Dr. Khalid Mehmood | Dr. Muhammad Avais | Dr. Haroon Akbar.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Trypanosoma evansi (T. evansi) is a flagellated protozoan that is mechanically spread through biting flies like Stomoxys, Tabanus and Lyperosia.T. evansi was first isolated in 1880 from diseased equines and camels of Indian sub-continent. It is the parasite of likewise intravascular as well as extra vascular fluids causing “surra” in the subtropical and tropical regions all over the world, including Africa, Asia, and America. It affects a wide range of mammals. It is mostly observed in camelids and equines but camel is the principal host. Trypanosomiasis in Pakistan is prevalent as a major threat to the camels causing heavy financial losses like causing anemia, weight loss, high fever, anorexia, dullness, depression, pale mucous membranes, facial paralysis, and thin hump dropped to one side, abortion in females and even death of camels.Considering the significance and utilization of camels in our country and the substantial losses rendered by trypanosomiasis, the present study was designed to study incidence, hematological alterations and chemotherapy of trypanosomiasis in camels of Bahawalpur district.
For this purpose, 100 camels were examined for Trypanosoma infection. The blood was collected by ear-tip puncture and from Jugular venipuncture. Then thin blood smear slide was prepared and dried up in air and stained with Geimsa's staining method and examined under microscope. Trypanosomes were identified by their morphological characteristics (Chandler and Read, 1961), as described by standard texts like Taylor et al. (2007). Overall incidence of T. evansi in camels was estimated as 20%.
The effect of trypanosomiasis on various blood parameters (Hb, ESR, TEC, TLC, DLC, and PCV) was determined in 30 camels including 15 apparently healthy and 15 trypanosome infected camels to compare normal blood parameters. The remarkable decrease in Hb, TEC, PCV, platelets and lymphocytes were observed while remarkable increase inESR and TLC was observed.Severe leukocytosis, neutrophilia, monocytosis, eosinophilia and basophilia were also observed in diseased camels.
For chemotherapy, 12 camel’s positive for trypanosomiasis, were divided into three groups (A, B and C). The animals of group A were treated with Imidocarb dipropionate @ 1.2 mg Kg-1 BW I/M, and efficacy of drug was found 50% in camels against trypanosomiasis. The group B was treated with Buparvaquone @ 3 mg/kg BW 1/M and was observed 25% effective. While the group C was treated with Isometamedium chloride(Trypamidium Samorin®, Merial, Pakistan) @ 0.75mg/kg BW I/M, which was found 100% effective. The efficacy of drugs was measured on the basis of disappearance of clinical signs and recovery rate of the animals, and blood smear examination at day 2, 4 and 07 of post-medication.
Finally, the data on hematology were analyzed by Student's T-test using statistical software package SPSS v22 (statistical package for social science), P < 0.05 was considered significant. Considering the significance and utilization of camel in our country and the substantial losses rendered by trypanosomiasis, the present project was designed to record clinical cases and chemotherapy of trypanosomiasis in camels of Bahawalpur districts. The results of this study will help farmers and veterinary practitioners in field.
Availability: Items available for loan: UVAS Library [Call number: 2668-T] (1).
1153.
Prevalence And Chemotherapy Of Dry Cow Mastitis
by Abdul Sattar Saqib (2014-VA-766) | Dr. Muhammad Avais | Prof. Dr. Aneela Zameer Durrani | Prof. Dr. Masood Rabbani.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: The study was undertaken to determine the prevalence and chemotherapy of dry cow mastitis. Mastitis is responsible for a wide range of health problems and economic losses in cows and is characterized by decrease in milk production, Swelling of the udder, hotness of the udder and anorexia. All lactating animals generally have a period of 6-10 weeks preceding to calving (usually annually) as a dry or resting period, a non-lactating phase. About to calving the cow remains at risk to new intra-mammary infections, especially shortly after the ‘drying off’ or termination of milking. During the dry period the prophylactic benefit of 82% reduction in the rate of intra-mammary infection is the result of the dry cow treatment with antibiotics and higher rate of eliminating infections than treating in lactation.
For this purpose, 250 Pregnant dry cows were examined for subclinical mastitis. The milk samples were collected from Pattoki and adjacent areas and California mastitis test (CMT) was performed and positive samples were furtherly processed for somatic cell count at medicine Laboratory of University of Veterinary and Animal Sciences, Lahore.
For Chemotherapy, 24 animals positive for dry cow mastitis were equally divided into 4 groups viz A, B, C and D. Each group comprising of 6 animals. The animals of group A were treated with intramammary antibiotic Cloxacilline+ Ampicillin (Masticlox ,ICI). Animals in group B were treated by injecting 2 shorts (72 hours interval) of long acting Amoxicilline (amoxy 150 L.A Floris veterinaire produkten B.V Vught the Netherland) intra muscularly. Animals in group C were treated with Cephradine (Velosef, GSK) 1g/quarter through intramammary route once. Cows in group D were served as positive control. Animals in all groups were kept under close observation for clinical mastitis until parturition. After calving, cows in each group were tested for mastitis at days 7, 14 and 21 (post calving) using CMT and
Summary
53
SCC. Effectiveness of a particular treatment was determined on the basis of CMT score and SCC.
The collected samples from Pattoki and adjacent areas were processed at the Medicine laboratory at UVAS, Lahore aseptically for CMT and CMT positive samples were processed by Somatic cell count (SCC).
Overall prevalence determined which was 39.60% (99/250samples) by CMT and SCC.The efficacy of different antibiotics used in chemotherapy of dry cow mastitis was checked. The efficacy of Amoxicilline (Amoxy 150 L.A), Ampicillin+ Cloxacilline (Masticlox) and Cephradine (Velocef 1g) was recorded at day 7,14 and 21days post calving.
Group A was treated with Ampicillin +Cloxacilline (Masticlox) its efficacy was 83.33% and group B was treated with Amoxicilline (Amoxy 150 L.A) and its efficacy was 66.66% effective while the efficacy of Cephradine (Velocef 1g) was 33.33% in group C.
From this study it was concluded that CMT is more reliable test than other tests for the diagnosis of Mastitis in cows. Secondly subclinical mastitis which is an important problem of cows is significantly prevalent in dry cows in Pattoki and adjacent areas. Cloxacilline+ Ampicillin and Amoxicillin is the most effective drug while Cephradine is relatively less effective against mastitis in dry cows. Availability: Items available for loan: UVAS Library [Call number: 2669-T] (1).
1154.
Prevalence And Chemotherapy Of Bovine Anaplasmosis In District Mirpur Azad Jammu And Kashmir
by Ayyaz Shakar (2014-VA-1119) | Dr. Muhammad Hassan Saleem | Dr. Imtiaz Ahmad | Dr. Muhammad Ijaz | Dr. Muhammad Imran Rashid.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Anaplasmosis of livestock is mostly confined to tropical and subtropical countries like Pakistan, where climatic conditions are suitable for growth and development of many vectors as ticks. Piroplasms belongs to this complex and affects both large and small ruminants with high morbidity and mortality rates resulting in heavy economic losses and thus poses a serious risk to livestock production. A total of 200 blood samples of bovine, cattle (n=100) and buffalo (n=100) showing the signs of fever, progressive anemia, a marked decline in body weight, depression and debility from district Mirpur AJK were included in the study. The diagnosis was made through thin blood smear examination. The overall prevalence was found 15.00% in both species of animals. The prevalence in cattle and buffaloes revealed 22% and 08% respectively. The results showed significant difference (P<0.05) in prevalence between cattle and buffaloes. The gender wise prevalence of the disease revealed 12.12% in male and 26.87% in female cattle whereas; these values were 6.45% in male and 8.70% in female buffaloes. Chi-square analysis showed significant difference (P<0.05) between male and female animals in the area. The data on breed wise prevalence of anaplasmosis showed highest prevalence in exotic breeds (28.00%) followed by cross breed cattle (24.44%) and native breed (16.67%) of AJK. The prevalence was 5.71% in Kunddi breed of buffalo and 9.23% in Nili Ravi buffaloes. Chi-square analysis showed significant difference (P<0.05) between breeds of animals. Three different age groups of cattle and buffaloes were analyzed for the prevalence percentage of anaplasmosis in the area. The data showed highest prevalence (35.48%) in 1-3 year age group of animals followed by 18.92% in 3-5 year and 12.50% in age group 5-7 year in case of cattle and 14.29%, 6.67% and 5.88% in buffaloes respectively. the analysis of the data revealed a significant difference (P<0.05) among different age groups. The values of hemoglobin percent, packed cell volume and total
Summery
40
erythrocyte count were found increased significantly (P<0.05) in cattle and buffaloes infected with anaplasmosis whereas; total leukocyte count was decreased significantly. The parameters were tested through student’s T-test. The analysis showed significant difference of values of all parameters in normal and infected animals. The chemotherapeutic trials were conducted with two drugs against bovine anaplasmosis in clinically diagnosed cases. Twelve positive cases of each cattle and buffaloes were divided into two main groups A and B comprising of 06 animals in each group. Each group was further divided into two sub groups comprising of 03 animals in each sub groups. The group A was treated with Oxytetracycline @ 20 mg/kg B.W. I/M the efficacy of the drug was evaluated on the basis of disappearance of Anaplasma in the blood smear. The efficacy percentage of Oxytetracycline was 33.3, 33.3, 66.7, and 100 at 2nd, 4th, 6th and 8th day respectively post treatment in cattle whereas; 0.00, 33.3, 33.3 and 66.7 respectively in buffaloes. The group B was treated with Calotropis procera (Aak) at the dose rate of 0.3 mg/kg body weight orally. The efficacy percentage of Calotropis procera (Aak) was 0.00, 33.3, 66.7, and 66.7 at 2nd, 4th, 6th and 8th day respectively post treatment in cattle whereas; 0.00, 0.00, 0.00 and 33.3 respectively in buffaloes. The efficacy of Oxytetracycline against bovine anaplasmosis on day 08 was found 83.33% whereas; of Calotropis procera was 66.66%. It was concluded that Oxytetracycline is the most effective drug against bovine anaplasmosis. Availability: Items available for loan: UVAS Library [Call number: 2665-T] (1).
1155.
Case Control Study Of Brucellosis And Its Associated Risk Factors At Commercial Dairy Farms
by Amna Riaz (2008-VA-257) | Prof. Dr. Mansur Ud Din Ahmad | Dr. Mamoona Chaudhry | Dr. Muhammad Imran Rashid.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Brucellosis, is a febrile, zoonotic disease caused by bacteria of genus Brucella. It is a second most important zoonotic disease after rabies. (WHO, OIE, FAO). Brucella is gram negative, aerobic, non-spore forming and non-motile coccobacilli. (Gull and Khan, 2007).The main signs are abortion after fifth month of pregnancy, still births, birth of weak calves, infertility, placentitis in females and in male’s epididymitis and orchitis. Due to its zoonotic nature farm labors, butchers, veterinarians and slaughter house workers are at high risk. Signs in human brucellosis are highly variable i.e., flu, rising and falling of temperature and causes many other complications in the body. (Baba et al.2001; Grillo et al. 2006; Shimol et al. 2012). Standard tests for brucellosis are Rose Bengal Precipitation Test (RBPT), Serum Agglutination Test (SAT) and Complement Fixation Test (CFT) (Memish et al, 2002). Its control is very difficult due to its variable incubation period, long survival time in both extracellular and intracellular environments, asymptomatic stages and resistant to the treatment, co-mingling, increasing population size and nomadism (Rahman et al. 2006).
The case study was conducted on the commercial dairy farms situated in the catchment area of University Diagnostic Laboratory, UVAS Lahore which were located Lahore, Kasur and Sheikhupura districts in Punjab. The data about positive and negative farms was obtained from university diagnostic lab, UVAS, Lahore. A predesigned questionnaire was filled from that farm workers in face to face interview. The sample size was calculated by the formula given by Schlesselman, 1982. The parameters for calculation of the sample size were power of study kept at 80% with 95% confidence interval. Total 90 samples were included (cases= 45, controls=45). Data was analyzed using chi-square. All statistical tests were performed at the significance level of 0.05.
In this study, absence of the calving pens at the farm, feeding and water practices, presence of streams and lakes near the farm and breeding practices show the strong association with this disease,by controlling the above factors and improving management at the farm can low the occurrence and spread of the disease in animals.
Availability: Items available for loan: UVAS Library [Call number: 2664-T] (1).
1156.
Pathogenesis Of Aflatoxin B1 In Quails Under Experimental Conditions And Detoxification By Biological And Chemical Means
by Sakhra Mahmood (2005-VA-251) | Prof. Dr. Muhammad Younus Rana | Prof. Dr. Asim Aslam | Prof. Dr. Aftab Ahmed Anjum.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Secondary metabolites of certain fungi produce toxins under favorable conditions especially while growing on different food grains. Mycotoxins are among major threats to growing poultry industry and human beings. Aflatoxins are closely related, biologically active fungal metabolites and commonly produced by Aspergillus species.
A research was carried out to evaluate the ability of Aspergillus flavus for Aflatoxin B1 production using rice, wheat and maize as substrates. Lethal effects on growth performance parameters, hematological and histopathological of graded doses of aflatoxin B1 in quails under experimental conditions were observed. Effect of Aflatoxin B1 on humoral immune response to Newcastle Disease virus vaccine in quails were determined. Biological detoxification of Aflatoxin B1 by Saccharomyces servisiae was evaluated in quails. Comparative evaluations of different commercially available toxin binders were checked. All these experiments were carried out till the six weeks (42 days).
Aspergillus flavus was identified on the basis of macroscopic and microscopic characteristics. Rice, wheat and maize grains was used as substrate to check the level of Aflatoxin B1 produced by inoculating an aqueous suspension of 106 spores/ml. Aflatoxin B1 checked by Thin Layer Chromatography (TLC) and quantified by High Performance Liquid Chromatography (HPLC).
Quails were reared under standard management conditions in five groups (A, B, C, D and E) having sixty each. Each group was further divided in two independent units. Diets offered to groups were control (without toxins), 0.25, 0.50, 1 and 2 mg Aflatoxin B1/kg feed. One unit of
SUMMARY
187
each group was vaccinated with Newcastle Disease Virus (NDV) vaccine while other was not and studied the lethal effects on growth performance, blood parameters, immune response and histopathology of vital organs. At the end of the experiment, it was found that the deleterious effects of Aflatoxin B1 were dose and duration dependent. As the level of the toxin was increased, the lethal effects were prominent. The growth performance parameters including gain in body weight, feed intake and feed conversion ratio was adversely affected at high doses. The body weight gain was significantly reduced in Aflatoxin B1 treated groups as compared to control group. Similarly feed intake and feed conversion ratio were significantly different from the control group. The hematological studies exhibited that aflatoxin B1 significantly reduced the hemoglobin, packed cell volume and total leukocyte count whereas the erythrocyte sedimentation rate was significantly increased as compared to control group. The immune response against NDV vaccine was adversely effected in Aflatoxin B1 treated groups and values of Antibody titer in AFB1 were significantly low as compared to group A( control) In the second experiment, Saccharomyces cervisae (SC) dried powder was mixed in basal quail diet having 0.5mg Aflatoxin B1 for all experimental groups and control was without toxins. SC was added at levels of 0.5 gm, 1.0 gm and 2.0 gm /kg of feed. It was recorded that Saccharomyces cervisae (yeast) have the potential to remove the deleterious effects of Aflatoxin B1. Yeast effectively detoxified the Aflatoxin B1. The results recorded of growth performance and other parameters were non-significantly different from the control group. Chemical detoxification of Aflatoxin B1 was evaluated in quails using commercially available toxin binders. Toxin binders used were activated charcoal, kaoline, Myco AD and selenium plus vitamin E and mixed in basal quail diet having 0.5mg Aflatoxin B1 for all experimental groups and control was without toxins. The Myco AD and selenium plus vitamin E showed the highest detoxification potential as compared
SUMMARY
188
to other chemical toxin binders. Groups E and F showed the results of growth performance, hematological, immune response and histopathological were non-significantly different from the control group (A). Kaolin was moderately detoxifying the toxin.
Presence of aflatoxin B1 in soft tissues was checked by TLC and quantified using HPLC. The liver exhibited the residues of Aflatoxin B1 at high doses of toxin. Group D and E rearing on feeds having 1mg AFB1 /Kg feed and 2mg AFB1 /Kg feed of toxin showed the residues of AFB1 in liver and kidney.
Statistical means for growth performance parameters, hematological, immune response and histopathological scores in each subunit of quails were analyzed by applying one way ANOVA and Duncans‟s Multiple Range (DMR) test at 95% probability. Aflatoxin B1 is lethal and lowers the performance of birds. The lethal effects can be detoxified by biological and chemical means to lower the economic losses to poultry industry. It can be concluded that biological detoxification is preferably better as compared to chemical detoxification. Availability: Items available for loan: UVAS Library [Call number: 2670-T] (1).
1157.
Comparative Efficacy Of Albendazole, Pyrantel Pamoate, Ajwain And Kamala Against Toxocara Vitulorum Infestation In Bovine Calves
by Muhammad Zahid IQbal (2007-VA-72) | Prof. Dr. Aneela Zameer Durrani | Dr. Muhammad Hassan Saleem | Dr. Arshad Javid.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxocara vitulorum is a round worm of cattle and buffalo that is common in tropical and subtropical area.Toxocara vitulorum from infected cattle and buffalo transmitted to calves via colostrum and placenta while its transmission was very less though feed and water. Toxocara vitulorum infestation was very high in calves and it caused mortalities in calve ages between 1 to 3 months, while infestation was less in high age groups.Mortality in cattle and buffalo calves reached up to 50% andcause poor growth, colic, constipation, diarrhea, anorexia and ketosis in calves. These worms could cause intestinal strangulation, holes and blockage in intestines of calves.
Resent study was designed to check the prevalence and therapeutic trial of Toxocara vitulorum in cow and buffalo calves. These results were very helpful for the treatment of the Toxocara vitulorum that was a major endo-parasite in the cows and buffalo calves. Fecal samples from 300 cows and buffalo were examined under the compound microscope for ova. Positive cow and buffalo calves were divided in five groups and different treatments were given to each group. Egg per Gram (EPG) counted at day 7and 14th post-treatment.
Overall prevalence Toxocara vitulorum was 49% in cow calves and 59% in buffalo calves. Prevalence was higher in 1-3 month age group calves (78% in cow calves & 91% in buffalo calves) while prevalence was higher in female calves (52% in cow and 61% in buffalo calves) as compare to male calves (44% in cow and 55% in buffalo calves). Prevalence was higher in the summer stress months.
The efficacy of the Albendazole was lowest in both cows and buffalo calves. The efficacy of Albendazole in cow was 25% and 31% at day 7th and 14th, respectively while in buffalo calves the efficacy of Albendazole was 24% and 31% at 7th and 14th days of post treatment, respectively. The efficacy of Pyrantel pamoate was 98% and 100 % in cow calves at day 7th and 14th, respectively while in buffalo calves the efficacy of Pyrantel pamoate was 81% and 100% at day 7th and 14th, respectively. The efficacy of Ajwain in cow calves was 59% and 69% at day 7th and 14th, respectively while in buffalo calves it was 58% and 69% at day 7th and 14th, respectively. The efficacy of Kamala in cow calves was 33% and 39% at day 7th and 14th day of post-treatment, respectively and buffalo calves the efficacy was 34% and 42% at day 7th and 14th of post-treatment.
It is concluded from the present study that both in cow and buffalo calves, Toxocara vitulorum is most prevalent parasitic infestation. This parasite is more prevalent in female calves, 1-6 months of age and during hot and humid season in both cows and buffaloes. Pyrantel pamoate is proved to be better than Ajwain but Albendazole and Kamala was not justified good dewormer against Toxocariasis in bovine calves.
.
Availability: Items available for loan: UVAS Library [Call number: 2656-T] (1).
1158.
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice
by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr.
SUMMARY
132
Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited
SUMMARY
133
elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).
1159.
Molecular Identification And Treatment Of Theileriosis In Small Ruminants Of Northern Balochistan
by Mir Ahmad Khan (2005-VA-214) | Prof. Dr. Muhammad Arif Khan | Prof. Dr. Muhammad Azam Kakar | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr. Aftab Ahmad Anjum.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: The present study was conducted to investigate the prevalence of Ovine and Caprine Theileriosis in Northern Highlands and Suleiman Mountain Region of Balochistan, Six thickly populated /union councils were included in the study area. Samples were collected from 2870 animals Sheep (n= 2200) and Goats (n= 670) for screening of the disease. The samples were collected and processed in Regional Disease Investigation Laboratories, Department of Livestock and Dairy Development Balochistan, T.B. Sanatorium Hospital Quetta and Center for Vaccinology, Bacteriology, The University of Balochistan, Quetta and Medicine Laboratory, Department of Clinical Medicine and Surgery, The University of Veterinary and Animal Sciences, Lahore. Data revealed 20.82% disease in sheep and 9.70%. in goats. The regional prevalence of theileriosis revealed 19.19% in Northern Highlands and 17.48% in Suleiman Mountain Region Chi-square analysis showed significant difference in the prevalence of disease in sheep and goats. The regional difference was not significantly different between two regions of Northern Balochistan. The comparison among union councils showed significant difference being highest prevalence (22.71%) in union council Kuchlak district Quetta followed by Aghberg (18.42%) and Hanna Urak (15.53%) in Northern highlands and Union Council Zangiwal Jogezai (19.83%) followed by Kach Amaqzai (16.30%) and Sinjavi (15.92%) in SMR. The disease prevalence when compared among 4 different breeds of sheep showed significant difference being highest in Karakul breed (34.62%) followed by Shinwari (24.54%), Bibrik (19.36%) and Harnai (16.40%). The highest prevalence of theileriosis in sheep and goats were observed in Summer season (30.30%) followed by Autumn 19.07%, Spring 14.52% and Winter
SUMMERY
105
7.61%. Chi-square analysis of the data showed significant difference in the prevalence of the disease in different seasons of the year. The disease was also compared in three age groups of sheep and goats. The data showed 22.17% disease in adult animal group above 2 years of age followed by 15.85% in animals between 1-2 year and 7.99% in age group below one year. Statistically significant difference in all age groups was found in chi-square analysis. The sex wise prevalence of theileriosis revealed non-significant difference between male and female sheep and goats. Two different species of Theileria were reported by many researchers causing disease in sheep and goats. The PCR was carried out for the identification of Theileria species affecting sheep and goats in Balochistan. Two species specific sets of primers were designed using 18SRNA gene sequence to identify these two species of Theileria and the distribution among the two species of animals. The genomic DNA of two species of parasite was successfully amplified in positive samples. The assay was proved successful and we recommend for the prevalence surveys for theileriosis in sheep and goats. The data showed that the prevalence of T. lestoquardi was 73.80% in sheep and 69.23% was in goats in the target regions. It was found the T. lestoquardi was highly prevalent and causing theileriosis in small ruminants. The prevalence of T. ovis was 26.19% in sheep and 30.76% in goats respectively in the investigated animals; it was less than T. lestoquardi. It was concluded that both Theileria species were identified and found circulating in small ruminants in the target region of Balochistan. In the study we determined that PCR method based on 18S RNA gene could detect and differentiate T. ovis and T. lestoquardi.
Effect of theileriosis in sheep and goats on hemeto-biochemical parameters were studied included RBCs, Hb%, PCV, Platelets, WBCs, MCV, MCHC, AST, ALT, BUN, Bilirubin and Creatinine. Blood samples were collected from Theileria confirmed, diseased animals (sheep and
SUMMERY
106
goats) along with equal number of healthy animals for comparison. In sheep RBCs, Hb%, PCV, WBCs, MCHC, AST, ALT and Creatinine values showed significant difference when compared with values of healthy animals. Significant (p<0.05) reduction was noted in measurement of RBCs, Hb%, PCV and MCHC whereas, AST, ALT and Creatinine showed significant increase in diseased animals. In goats affected with theileriosis showed significant decrease in RBCs count and Hb%. The values for AST, ALT and Creatinine were found significantly increased in diseased animals when compared with healthy control group of equal number of animals. In present study it was noted that Butalex intra muscularly at the rate of 2.5 mg/kg body weight is quite effective in eliminating the Theileria parasite from the blood of sheep and goats and treatment at the day 10 post treatment. Imizol was also found an effective treatment of theileriosis but less effective than Butalex. Availability: Items available for loan: UVAS Library [Call number: 2690-T] (1).
1160.
Affect Of Temperature, Cell Density And Multiplicity Of Infection On Biological Titer Of FMDV Type “O”
by Qazi Ithram Ul Haq (2009-VA-104) | Dr. Imran Altaf | Prof. Dr. Aftab Ahmad Anjum | Dr. Muhammad Imran.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: FMD is a transmissible viral disease of animals. It is causing very highly economical loses in Pakistan and all over the world. Through vaccination FMD is being controlled in Pakistan. Inactivated virus is used in vaccines. FMD virus grows on BHK-21 cell lines. FMDV show good adoptability on these cell lines. For good and high titer FMDV needs few physical factors to grow on BHK-21 cell lines. These factors include Temperature, Cell density and Multiplicity of infection (MOI)was considered in this research. The FMDV strain “O” was grown on BHK-21 cell line. The cells monolayer was propagated for conduction of effect of these factors on the virus. The mentioned factors were studied to get optimum level of virus titer in in vitro cell lines. The effect of 35°C, 37°C and 39°C was evaluated on the virus growth. Maximum virus propagation was noted at optimum temperature 37°C. The viral concentration at 37°C was significantly (P<0.05) higher than at 35°C and 39°C. The effect of cell density was studied on the virus concentration. Flask of three different densities 25cm2, 175cm2 and 275cm2were utilized in the current study. The virus concentration in all three different densities was not significantly different (P>0.05) from each other. Another factor Multiplicity of infection (MOI)was investigated in the study. Five different volumes 10ul, 20ul, 30ul, 40ul and 50ul of the FMDV strain “O” were used to investigate the effect of factor on the virus concentration. The results revealed highest viral harvest concretion at 50ul volume with MOI of 7.1, %age of cells infected with single virus and 6.3 × 1079. The MOI at 50ul was significantly higher (P<0.05) than the other four concentration of the virus. It was concluded from the study that the optimum temperature for the maximum FMDV concentration harvest is 37°C. The density of cell has no significant effect on the growth of virus that is flask of any density may be used to grow the FMDV. Multiplicity of infection (MOI) of 14.2 give maximum
SUMMARY
34
TCID50 Optimizing the conditions for the cell culture and virus cultivation helps in maximum virus harvest achievement. From the present study it may be suggested that the physical factors may be optimized for the remaining strains of FMD and other vaccine viruses to attain maximum virus grow. Availability: Items available for loan: UVAS Library [Call number: 2681-T] (1).
1161.
A Comparative Epidemiological Study Of Coccidiosis In Broilers Raised Under Open And Control Sheds
by Shehar Yar Alvi (2007-VA-173) | Prof. Dr. Khalid Saeed | Dr. MUhammad Lateef | Dr. Jawad Nazir.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: The domesticated fowl (Gallus gallus) is susceptible to seven species of genus Eimeria which are are Eimeria acervulina, Eimeria brunetti, Eimeria maxima, Eimeria mitis, Eimeria necatrix, Eimeria praecox and Eimeria tenella. All of these are capable of causing disease but the clinical picture and pathogenesis may be different according to species, while the pathogenicity ranges from mild to severe. All the species are ubiquitous and cause disease in combination up-to 6 species at the same time on an individual farm so in this sense coccidiosis may be regarded as a disease complex. Now a days subclinical coccidiosis is more frequently affecting the birds as compared to clinical coccidiosis and greatest financial losses are being caused by subclinical coccidiosis in terms of decreased or less weight gain and reduced feed conversion efficiency.
. The present study was designed to compile data on the prevalence of coccidiosis in broilers reared under open and controlled sheds situated in and around the Lahore city. Study provided better understanding of the risk factors associated with coccidiosis and their relationship.
A questionnaire was designed to record information regarding the management practices, health status of the flock, weight gain. Pooled faecal samples were collected from 50 control sheds and 50 open sheds and were transported to the parasitology laboratory of UVAS. Faecal sample were examined by direct smear to see the coccidial oocysts. Post mortem was conducted to check the presence or absence of the gross lesions associated with coccidiosis. Association between coccidiosis and the risk factors was determined, and the results of open and control sheds were compared. It was assumed that coccidial infections will be higher in the open sheds as compared to environmentally controlled sheds. Open sheds had more prevalence 78% as compared to closed sheds which was reported as 72%. Five major risk factors were studied. Temperature and humidity fluctuation were strong risk factors associated with prevalence of coccidiosis. While litter condition also appeared as an associated risk factor for the prevalence and occurrence coccidiosis in both type of farming systems. Whereas use of medicated feed in open houses appeared as an associated risk factor but in controlled houses use of medicated feed was not associated with the prevalence of coccidiosis. History of previous infections of coccidiosis was also associated risk factor in both type of farming systems. The high prevalence of coccidiosis in open sheds may be due to lack of biosecurity and uncontrollable conditions of temperature and humidity while closed farms have proper biosecurity measures and good husbandry practices. Use of medicated feed and good husbandry practices may be help full to minimize the risk of occurrence of coccidiosis. Further studies are required for better understanding of the disease and associated risk factors.
Therefore, the following recommendations are forwarded.
• Educating farmers about the importance coccidiosis and its control.
• Adaptation of good management practices on farms.
• Avoid over-crowding in the house.
• Alternative remedies need to be developed and evaluated to prevent and control coccidiosis.
Availability: Items available for loan: UVAS Library [Call number: 2691-T] (1).
1162.
Anthelmintic Activity Of Withania Coagulans Against Gastrointestinal Nematode Of Sheep In District Killa Saifullah, Baluchistan
by Yousaf Gul (2009-VA-145) | Dr. Muhammad Lateef | Dr. Saadullah Jan | Dr. Muhammad Imran Rashid | Dr. Wasim Shehzad.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Evaluation of anthelmintic activity of Withania coagulans was studied against GIT nematodes of sheep in district Killa Saifullah Baluchistan. Sheep of the district were screen out for the presence of GIT nematodes. Animal positive for GIT nematodes and having 150+ Egg per Gram (EPG) of feces was included in the drug trial. Animals were treated with extract(s) of locally available herbal plant (withania coagulans) and levamisole. Two types of plant formulations that is crude powder and crude methanole extract were prepared each with various dosages. The effect of both medicinal plant and levamisole was observed on different groups of animals and the results were analyzed with appropriate statistical tool. Eighty animals were randomly divided in to eight groups (10 animals in each group) i.e. A, B1, B2, B3, C1, C2, C3 and D. Animals in group A served as control untreated group. Animals in groups B1, B2 and B3 were treated with crude powder of Withania coagulans at the dose rate of 1, 2 and 3 g/kg body weight respectively. And Animals in groups C1, C2 and C3 were treated with crude methanol extract of Withania coagulans at 33.3, 66.6 and 100mg/kg equivalent dose rate of 1, 2 and 3 g/kg body weight respectively. Animals in group D were given Levamisole at the standard dose rate of 7.5 mg/ kg body weight. Data was analyzed by using SPSS version 20.0; comparative analysis was done by applying ANOVA. P value <0.05 was taken as significant. The analyzed data and the results revealed that Levamisole is still a better anthelmintic against ovine nematodes in district Killa Saifullah Balochistan. Efficacy of levamisole tested for 15 days in-vivo sheep was up to 92%. This efficacy was much higher than the various forms and dosages of medicinal plant. The efficacy of Levamisole was significantly higher (P<0.05) than all forms and dosages of medicinal plant. Group C3 treated with crude methanol extract of Withania coagulans at the dose rate of 10mg/kg equivalent to 3mg/kg showed highest efficacy of the plant that is up to 48%. The efficacy showed by the form of the medicinal plant used in group C3 against ovine GIT nematodes was significantly higher (P<0.05) than all other forms of the plant. Animals in group B1, B2, B3, C1 and C2 showed anthelmintic efficacy of 19.47%, 23.58%, 31.66%, 31.76% and 33.33% from day 0 to day 15th post-treatment. Gastrointenstinal nematodes of sheep have produced anthelmintic resistance against Levamisole at the dose rate of 7.5mg/kg. In previous studies Levamisole had showed efficacy of 99.99%, 99% and 98%. It is therefore recommended that further investigation on huge scale should be passed out concerning a great number of animals, quantities higher than those used in the present study, documentation of active principles, and calibration of dose and toxicity studies for drug development from the herbal plant.
Availability: Items available for loan: UVAS Library [Call number: 2688-T] (1).
1163.
Comparative Studies On Egg Quality, Hematology And Reproductive Traits In Ring Necked And Green Pheasants In Captivity
by Qurat Ul Ain (2014-VA-963) | Dr. Arshad Javid | Dr. Ali Hussain | Prof. Dr. Muhammad Ashraf.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Present study was planned to compare egg quality, hematology and reproductive traits in ring necked and green pheasants in captivity. Day-old chicks of both the pheasant species Phasianuscolchicusand P.versicolorwere tagged individually and maintained initially in a room for a period of 4 weeks. The chicks were then transferred to cages provided with separate feeding and drinking facilities to the individual bird. The birds were kept until the 16 weeks of life. The sex of the chicks was predicted at early stages by observing feathers and plumage and was confirmed later at adult ages.
Eggs (n = 100) of both the pheasant species i.e. Phasianuscolchicusand P.versicolorwere collected. Each egg was weighed and its length and breadth was taken. These eggs were divided into three weight groups and were classified as light, medium and heavy category. The length and breadth of each collected egg was taken and surface area, egg volume and shape index were calculated.The egg quality test was performed on freshly collected eggs in the egg quality testing laboratory periodically. The eggs were weighed carefully on electronic digital balance. The albumen and yolk height and width, yolk index, albumen and yolk pH and Haugh unit score were recorded.
During present study, chick weight in ring necked pheasants Phasianuscolchicusand green pheasant P. versicolorfrom day old chick to 6-month stage varied significantly. The average body weight in day old chick weight ranged from20.6±1.35g to 24.50±1.29g.Increase in chick weight in male ring necked pheasants was 24.50±1.29g to 1235.25±101.81g. Similarly increase in female ring necked pheasant was 22.47±1.79gto 1004.75±52.94g.The chick average weight was almost double during 2nd week. Body length was maximum in male green pheasant 5.00±0.81cm during 1st week. However significant (p<0.05) increase in body weight was observed during 1st to 4thweek.Higher increase in average body weight was observed during 6thweek. Significantly (p<0.05) increase in wing length and wing span was also recorded during 6th week. During 7thweek, non-significant differences in body weight were observed between male and female P. colchicus.Overall, minimum increase in chick weight was observed during 21st,22nd and 23rd week and maximum during 6th,7th and 8th week of chick age. The chick weight at hatching in light, medium and heavy egg groups were determined as 19.5g, 21.8g and 22.6g, respectively.
Lowest increase in chick body weight in green pheasants ranged from 20.6±1.35g during 1st week to 837.00±49.45g during 24thweek of its growth. During present study it was determined that hatched chick weight increases with increase in egg weight. After completion of the incubation, the infertile egg percentage was 48% in ring necked pheasant and 42% in green pheasant. Increase in wing length varied significantly in male and female and between both species from day old chick to 6-month stage. The lowest increase in chick’s wing length ranged from 5.37±1.10cm to 33.75±1.70cm in female P. versicolor. Overall minimum increase in wing length was observed during 12thweek and maximum during 2nd,3rd and 6th week of chick age.
During present study, significant differences in various hematological parameters were recorded during different ages of pheasants. RBCs values in P.cholchicusincreased with age, reached a maximum point then decreased. While in P. versicolorthe values decreasedat juvenile stage and then increased to young ages and decreased. However, maximum 4.04±0.6 values for RBCs were recorded in P. versicolorduring 3rd month. In young age,significant (p<0.05) differences in blood biochemical profile of both the pheasant species were observed.
Availability: Items available for loan: UVAS Library [Call number: 2674-T] (1).
1164.
Construction Of Cellulolytic And Sulfate-Reducing Bacterial Consortium For Enhancing Efficiency Of Cellulose-Linked Bioremedial Processes
by Ali Hasan (2014-VA-939) | Dr. Waseem Ahmad Khan | Dr. Arshad Javid | Prof. Dr. Muhammad Ashraf.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note:
Metallic and non-metallic pollutants originating from different industries are not treated before their final discharge into the environment. Consequently, environment is being degraded very rapidly and posing serious threats to all forms of life. For remediation of the said pollutants, a number of physico-chemical treatment methods have been practiced but couldn’t found suitable due to environmentally non-compatible natures and generation of secondary pollutants.
The present study was, therefore, designed to treat artificially prepared sulfate-rich wastewater jointly with the help of cellulolytic and sulfate-reducing bacterial species while using a variety of agro-industrial wastes as cost-effective growth substrates. In order to achieve the goal, the two bacterial species were mixed in different proportions to achieve significant results of sulfate reduction.
Statistical analysis revealed that rice straw appeared as the most efficient carbon source among all the agricultural wastes because it reduced about 96% of the total added sulfate in a 60-day trial of anaerobic incubation. And among all the industrial wastes, animal manure appearedasthe most efficient carbon source, it could reduce 93% of sulfate. Mixture of industrial and agricultural waste reduced about 90% of the sulfate. Findings of this project will be helpful in developing an economical and environmental friendly bio-remedial technique for the treatment of metallic and non-metallic wastes simultaneously which ultimately convert the industrial wastewaters into harmless and suitable discharge to aquatic environment.
Availability: Items available for loan: UVAS Library [Call number: 2675-T] (1).
1165.
Comparative Efficacy Of Xylocaine Hcl And Bupivacaine Hcl For Ophthalmic Anesthesia In Horses
by Muhammad Asad Islam (2012-VA-576) | Dr. Sadaf Aslam | Prof. Dr. Muhammad Arif Khan | Prof. Dr. Muhammad Sarwar Khan.
Material type: Book; Literary form:
not fiction
Publisher: 2015Dissertation note: Ophthalmic procedures can be performed by many clinicians in horses using local nerve blocks by using local anaesthetics for short duration of action for completion of these procedures. These surgical procedures may involve exclusion of third eyelid, suturing of laceration around eye orbit and tumor which can be caused due to any reason with in time period of thirty minutes. Inner chamber centesis can be done easily by using the above mentioned technique in standing horse.
There are numerous benefits of doing standing surgical methods and avoiding general anaesthesia in horses. As hospitalizing horse may get other infectious diseases from surroundings like colitis and laminitis and also injured it when recovering from general anaesthesia. On the other hand standing surgical procedure reduced such complication by using local anaesthetic for short duration.
Bupivacaine Hcl gave an ideal local eye anaesthesia compare to xylocaine Hcl for standing surgical procedures in horses.
The present study was accomplished to assess the effectiveness of two local eye anaesthetics; xylocaine Hcl and bupivacaine Hcl by two different techniques i.e. retrobulbar technique and auriculopalpebral technique in horses. A total of 12 horses from indoor clinic and S.P.C.A were used in this study. These horses were subjected to two groups’ i.e. Group A and B. Each of these groups was further subdivided into two subgroups i.e. Group AI, AII and BI, BII respectively.
SUMMARY
42
Horses in group A were administered xylocaine Hcl through auriculopalpebral technique and retrobulbar technique. While horses of subgroup AI were given xylocaine Hcl by auriculopalpebral technique and horses in subgroup AII were injected xylocaine Hcl by retrobulbar technique.
Likewise horses in subgroup BI were given bupivacaine Hcl by auriculopalpebral technique, while those of subgroup BII were given bupivacaine Hcl through retrobulbar technique. The efficacy of above mentioned local anaesthetics was compared on the basis of Pattern of induction, Duration of anaesthesia and Recovery Pattern. Presence or absence of reflexes was also noted i.e. Pupillary Light Reflex and Blink reflex.
The data were analyzed through one way analysis of variance (ANOVA). The difference in group’s means was determined by Least Significant Difference (LSD) post-hoc test. A probability level of (P<0.05) was considered as statistically significantly difference. The statistical analysis was performed using statistical package for social science (SPSS) version16. Availability: Items available for loan: UVAS Library [Call number: 2679-T] (1).
1166.
Infection Rate And Chemotherapy Of Haemonchus Contortus In Mouflon Sheep
by Majeed Ul Zafar Jaidi (2013-VA-890) | Dr. Waseem Yaqub | Dr. Muhammad Sarwar Khan | Dr. Zia Ullah.
Material type: Book; Literary form:
not fiction
Publisher: 2015Dissertation note: Mouflon sheep have lovely brown colored short haired coat. Typically it is not the wild animal found in Pakistan but a little population of Mouflon sheep is present in Pakistan in the captive vicinities like private zoo and wild life parks .Their population is countable, 150-200 Mouflon sheep are present. They can be parasitized by many nematodes, one of the most important is Haemonchuscontortus. Adult Haemonchuscontortus found in the abomasum of the animal.Female parasite can lay up to 1500 eggs in a day in mid-Summer July- August and those eggs produce the infective stage L3, which after infestation causes heavy blood loss resulting anemia, weight loss, emaciation and sudden death in acute cases compromising the production and propagation losses in Mouflon sheep.
The Mouflon sheep of various private and public Zoo and Wild Life Parks located in area of District Lahore were included in this study. A total of 100 Mouflon sheep were examined coprologically for the presence of Haemonchuscontortus for the present study. It is difficult to restrain the wild animal, a Dort was used for this purpose keeping in view of this problem about 3 gram of sample were collected early in the morning from the freshly passed feces, for this purpose disposable gloves was used on hands,the samples were collected carefully to avoid soil contamination the sample was placed in self-sealing polythene bags and were transferred to the laboratory in ice pack cooler. The samples were stored in refrigerator at 4°C till analysis.
The fecal samples were analyzed for Haemonchuscontortus eggs using direct smear method and floatation technique, while the egg count were performed by McMaster technique at medicine Laboratory University of Veterinary Animal Sciences Lahore the identification of Haemonchuscontortus was made by using standard procedures. Infection rate was calculated by using formula
Infection rate (%) = No. of infected animals (n)/ total No. of sampled animals (N) × 100
The infection rates were calculated in this study and total Thirty (33) animals were found positive after qualitative and quantitative analysis of fecal samples. The infection rate of Haemonchuscontortus in Mouflon sheep were calculated out of sampled animals which resulted the significant (P < 0.05) infection rate in females as well as in male Mouflon sheep. The infection rate in female Mouflon sheep was 33.82 % and in males it was 31.25 % in males out of positive animals. Similarly The infection rate of H. contortus in Lahore Zoo, Safari Park Lahore and Jallo Park was 29.72, 32.50, 39.13 respectively, and the infection rate of H. contortus in age group of 1-3, 4-6, 7-9 was 39.58, 27.27, 26.31 respectively.
For therapeutic trails, a total of 30 animals positive for nematodes having egg per gram between 1000---2000 were divided into 3 groups A, B, and C each group were comprised of 10 animals. The animal of group A was treated with Albendazole at the dose rate of 10 mg per kg of body weight PO; group B was treated with Levamisole at the rate of 7.5 mg per kg of body weight PO whereas the group C was treated with Pyrentelpamoate at the dose rate of 25 gram PO.The fecal sample of all groups were collected at day 0 (pre-treatment) and then at 3rd day 5th, 7th and 12th (post-treatment). The efficacies of these drugs were assessed on the bases of reduction in egg per gram and calculated as per formula of (Iqbal at al. 2013).
Drug efficacy = {(pre-treatment EPG - post-treatment EPG / pre - treatment EPG)} × 100
The chemotherapy of Haemonchuscontortusin Mouflon Sheep were studied in different 3 treatment groups. Microscopically screened out Haemonchuscontortus positive Mouflon sheep were divided in Three (3) treatment groups T 1, T 2 and T 3 and each group contained Ten (10) positive animals. Faecal samples of animals were examined at day 0 pre-treatment and at days 3, 5, 7 and 12 post treatment. All the treatment groups showed a significant reduction (P < 0.05) in eggs per gram (EPG) at 3rd, 5th, 7th and 12th days after treatment. The maximum reduction in EPG %age was 96.1 % showed by T 1 group treated with single dose of Albendazole at 10 mg/kg body weight at day 7 post treatment while the groups T 2 and T 3 showed maximum reduction of 95.52 % and 93.26 % at day 12th post treatment. Hence Albendazole was the best group found against Haemonchuscontortus at day 7 post treatment among the other two groups of drug used.
Data on Infection rate of Haemonchuscontortus was estimated by Pearson’s chi-square test. For significance whereas data on chemotherapy was analyzed by one way analysis of variance (ANOVA) using SPSS, P< 0.05 were considered significant.
Availability: Items available for loan: UVAS Library [Call number: 2677-T] (1).
1167.
Prevalence And Chemotherapy Of Mites Infestation In Sheep In Tehsil Bhag Of District Bolan
by Shujat Ali (2008-VA-208) | Prof. Dr. Kamran Ashraf | Dr. Nisar Ahmed | Dr. Muhammad Avais.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Estimated population of sheep in Pakistan is 27.8 million. Balochistan is the largest province which comprises 44 percent of the total area of Pakistan and only 4.9% of entire population of the country. Share of Livestock in Agriculture is 55%, 11.4% of National GDP of Pakistan and more than 47% in the economy of Balochistan. In between the Chelicerates, (mites and ticks) characterize the biggest and most wide taxon, with a valued 0.5–1 million species. More then 48,000 species defined (Halliday et al., 2000). Mange is a contagious disease showing signs like crusty, dermatitis and loss of hairs. Almost 50 mites species having 16 families and 26 genera responsible for mange where all the main mite species having the orders of Astigmata and Prostigmata. Bolan district is situated in the center of Balochistan province of Pakistan Population estimate 640,000 (2005). Bolan district is administratively subdivided into six tehsils viz Bhag, Dhadar, Machh, Sani, Khattan. The present study was carried out in tehsil Bhag. Latitude 29.0415, longitude 67.8239, Altitude 88 meters above the sea level. 1442 square kilometer of Tehsil Bhag. Mean rainfall is 209.9 mm, range of temperature (Avg) is between 40.6°C and 14.58°C. Four distinct breeds of sheep found in Balochistan are Balochi, Bibrik, Harnai, Rakhshani.
A total of 200 sheep were randomly selected to study the prevalence of mites’ infestation. Skin scraping technique was used. For chemotherapy 30 sheep positive for mange mites through skin scraping test were randomly selected and divided into 3 groups of viz A, B, C. Each group contain 10 number of sheep. Sheep’s in group A were injected Ivermectin at 0.2mg/kg bwt subcut while the animals in group B, were treated with Trichloroforn in the form of 0.15% solution as topical application. The members in group C were treated topicaly with aqueous
Summary
37
extract of Nicotiana Tobacum (tobacco). Treatment were done on day zero and repeated on day 15. The sheep in each group were examined in routinely and samples of skin scraping were collected at day 0, 7, 14 and 28 days (Habib et al., 2009). The effectiveness of particular treatment was estimated on the basis of reduction of clinical sign and negative skin scraping.
200 sheep of different breed, age, sex and areas were examined. 30/200 (15%) sheep were found positive for mange mites infestation. Mites infestation was noticed high in male sheep (16%) as compare to female sheep (14%). According to Breed Balochi sheep breed was noticed highly positive (22%) for mange mites infestation. Area wise prevalence was witnessed high in union council Bhag (25%). Mostly effective drug observed for mites infestation was Ivermectin with 90% efficacy at day 28 in conclusion mange mites infestation in sheep at Bhag tehsil of Dist Bolan and Ivermectin is the best effective drug for mange mites into the following in order by Seguvan and Nicotiana Tobaccum. Availability: Items available for loan: UVAS Library [Call number: 2676-T] (1).
1168.
Prevalence And In Vitro Acaricidal Activity Of Nicotiana Tobacum Extract(S) Against Ticks(S) Of Cattle In District Loralai (Balochistan)
by Najeeb Ullah (2008-VA-203) | Dr. Muhammad Lateef | Dr. Saad Ullah Jan | Prof. Dr. Khalid Saeed | Prof. Dr. Aneela Zameeer Durrani.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: In this study prevalence and acaricidal activity of Nicotiana tobacum plant leaves extracts of chloroform and methanol based was evaluated.
6.1 Prevalence study
In this study total 670 cattles were examined for tick infestation in cattle of different breed, age and sex in district Loralai (Balochistan). Overall prevalence of tick infestation of cattle recorded was 21.49%. Breed wise prevalence was 26.15, 12.80 and 22% in Friesian, Sahiwal and non-descriptive breed of cattle respectively. Age wise prevalence was 27.90, 26.88 and 19.34% in <1 year, 2 year and >2 years of cattle respectively. Higher sex related prevalence was noticed in female cattle (21.98%) as low found with male cattle (16.92%).
6.2 Acarididal effects of tobacco (Nicotiana tobacum) plant
The plant leaves of Nicotiana tobacum were dried for 8 to 10 days. The leaves were grinded mechanically into powder form and extract was prepared in Soxhlets apparatus. Extract was further dried in rotatory evaporator and hot air oven to remove left over moisture to obtain solid extract. The dry powder was stored in refrigerator at 4 °C to protect it from any fungal contamination. The powder extracts was used to make different concentrations of 12.5mg/ml, 25mg/ml and 50mg/ml in distilled water. The ticks collected from study area was weighed and dipped in to the formulated solution for interval of 5 mints. After immersion ticks were incubated at 30 °C temperature and 80% relative humidity. After the oviposition period (18 days), the eggs were collected and weighed for each group. The comparison of all the groups was observed in terms of egg laying index and percentage inhibition of egg laying. 200 eggs (Approximately 10mg) were studied for egg hatchability of different groups at different concentration of chloroform and methanol extracts,
This study has successfully achieved main objectives to determine the acaricidal effects of Nicotina tobacum extracts on ticks of cattle.
Egg laying index: values of egg laying index at concentration of 12.5mg/ml, 25mg/ml and 50mg/ml for chloroform and methanol extracts were as follows, for chloroform extracts these were 0.4782800±0.02789077, 0.4388300±.05119868 and 0.3963600±0.03380405 and for methanol extracts these were 0.4991200±0.00948646, 0.4614300±0.03917896 and 0.4205800±0.04183098 respectively. While for control group it was calculated 0.5331200±0.02757486 for all concentrations of Nicotiana tobacum extracts. This decline in egg laying index showed by ticks of chloroform and methanol extracts was significantly different (P<0.05) from control group.
Percentage inhibition of egg laying: For chloroform extract calculated value was 10.048, 17.378 and 25.143% at concentration of 12.5mg/ml, 25mg/ml and 50mg/ml respectively, and for methanol extracts the value was 6.367, 13.152 and 20.827% at concentration of 12.5mg/ml, 25mg/ml and 50mg/ml respectively.
Egg hatchability: Hatchability of ticks eggs of chloroform extract of Nicotiana tobacum plant were recorded 67.5, 43.5 and 17% at concentration of 12.5mg/ml, 25mg/ml, and 50mg/ml respectively. Moreover, hatchability of ticks eggs of methanol extract of Nicotiana tobacum plant were recorded 77.5, 47.5 and 23% at concentration of 12.5mg/ml, 25mg/ml, and 50mg/ml respectively and for control group it was recorded 100% as treated with distilled water.
Availability: Items available for loan: UVAS Library [Call number: 2687-T] (1).
1169.
Epidemiology Of Influenza Virus H5n1 In Islamabad Capital Territory
by Zahida Fatima (2005-VA-246) | Prof. Dr. Muhammad Athar Khan | Dr. Khalid Naeem | Prof. Dr. Mansur Ud Din Ahmad | Prof. Dr. Khushi Muhammad.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: The poultry sector in Pakistan is the second largest industry that contributes to the national gross domestic products (GDP) and remains a major source of nutrition (protein and energy) for human population in Pakistan. Highly Pathogenic Avian Influenza (HPAI) outbreaks due to H5N1 virus in poultry have been recorded in over 62 countries, indicating the contagious nature of the disease and its potential to infect various avian species. These HPAI outbreaks in poultry have lead to killing/culling of around 120 million birds in various countries. During 2009, the Avian Influenza continues to occur in poultry in China, Hong Kong, India, Egypt, Nepal, Bangladesh and Canada . In Pakistan, an HPAI outbreak due to H7N3 virus was first observed in 1994-95 and those due to H9N2 virus in broiler and layer chickens were recorded between late 1990’s and early 2000. During the period between 2006 and 2008, poultry heavily suffered due to multiple outbreaks caused by H5N1 virus.
The country experienced several and severe HPAI subtype H5N1 outbreaks during 2006-2008 in commercial poultry farms mostly, causing mass economic losses. In Pakistan all the four poultry production system exists being identified by FAO. The present study was conducted in peri-urban areas of ICT Islamabad, capital of Pakistan. The objectives of the present study were to investigate the outbreaks due to HPAIV H5N1 in 2006-2007 in ICT and identify the pattern and trends of these outbreaks. For this purpose descriptive epidemiological study was conducted and data was collected on a predesigned questionnaire regarding farm demography, culling, morbidity and mortality. The result statistical analysis showed a significantly (P< 0.05) higher morbidity, mortality, case fatality and culling rate in layers farms than breeders and broilers respectively. Layers and breeders of old ages were mostly affected with having higher mortality and culling in comparison to younger age layer and breeder commercial farms. The mean morbidity and mortality rates ranged 57–95% and 5-43% correspondingly.
After the HPAIV H5N1 first reported outbreak in Pakistan in 2006 culling strategy was adopted after devastating outbreaks regularly reported from throughout the country. The reasons behind these emerging epidemics were unknown and several hypotheses were given birth after these outbreaks. Knowledge regarding potential risk factors responsible for HPAIV H5N1 epidemics in commercial poultry farms in Pakistan was lacking. Therefore we conducted a longitudinal cross sectional survey (1:1 matched case control study) to identify potential risk factors at farm level responsible for 2006-2007 HPAIV H5N1 infection in poultry in ICT. Information on farm characteristics, biosecurity practices and farm management were collected. Logistic regression model on data was used to unveil the potentially associated risk factors with cases (farms confirmed HPAI H5N1 Positive). Several candidate variables were studied and investigated for association. The results multivariable logistic regression showed that farm location such as in urban area (P<0.05: OR=18.50), wild birds entry (P<0.05: OR= 12.66) and farms situated in highly dense poultry populated area (P<0.05:OR=4.50) were found significantly associated with outbreaks of HPAIV H5N1 infection in commercial poultry farms during 2006-2007 epidemics in the study area.
Live bird markets (LBMs) are essential for poultry marketing in developing countries like Pakistan. One year active disease surveillance for influenza viruses in avian species in LBMs in ICT area was conducted in 2011. LBMs in Pakistan are typically urban that brings together many avian species produced by different suppliers. Which make LBMs in Pakistan a potential source of HPAIV viruses as well as other emerging poultry pathogens i.e. new castle disease virus,infectious bronchitis etc. The results of the present surveillance data showed that seroconversion against H5N1 and H9N2 is present in LBMs bird species which were isolated from different samples like serum, cloacal, nasal samples and organ samples.This indicates the continuous threat of AIV viruses circulating in the live bird markets set up of Pakistan.
Findings of these studies will help to tailor control and prevention measure against devastating outbreaks in future regarding the local circumstances of commercial poultry farms as well as in LBMs. These studies also succeeded to unveil the true reasons behind these devastating outbreaks and their higher impact on poultry industry. Such type of surveillance programs will be useful in future to investigate several emerging diseases and outbreaks in Pakistan and other developing countries. Availability: Items available for loan: UVAS Library [Call number: 2700-T] (1).
1170.
Molecular Identification And Treatment Of Theileriosis In Small Ruminants Of Northern Balochistan
by Mir Ahmad Khan (2005-VA-214) | Prof. Dr. Muhammad Arif Khan | Prof. Dr. Muhammad Azam Kakar | Prof. Dr. Muhammad Sarwar Khan | Prof. Dr. Aftab Ahmad Anjum.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: The present study was conducted to investigate the prevalence of Ovine and Caprine Theileriosis in Northern Highlands and Suleiman Mountain Region of Balochistan, Six thickly populated /union councils were included in the study area. Samples were collected from 2870 animals Sheep (n= 2200) and Goats (n= 670) for screening of the disease. The samples were collected and processed in Regional Disease Investigation Laboratories, Department of Livestock and Dairy Development Balochistan, T.B. Sanatorium Hospital Quetta and Center for Vaccinology, Bacteriology, The University of Balochistan, Quetta and Medicine Laboratory, Department of Clinical Medicine and Surgery, The University of Veterinary and Animal Sciences, Lahore. Data revealed 20.82% disease in sheep and 9.70%. in goats. The regional prevalence of theileriosis revealed 19.19% in Northern Highlands and 17.48% in Suleiman Mountain Region Chi-square analysis showed significant difference in the prevalence of disease in sheep and goats. The regional difference was not significantly different between two regions of Northern Balochistan. The comparison among union councils showed significant difference being highest prevalence (22.71%) in union council Kuchlak district Quetta followed by Aghberg (18.42%) and Hanna Urak (15.53%) in Northern highlands and Union Council Zangiwal Jogezai (19.83%) followed by Kach Amaqzai (16.30%) and Sinjavi (15.92%) in SMR. The disease prevalence when compared among 4 different breeds of sheep showed significant difference being highest in Karakul breed (34.62%) followed by Shinwari (24.54%), Bibrik (19.36%) and Harnai (16.40%). The highest prevalence of theileriosis in sheep and goats were observed in Summer season (30.30%) followed by Autumn 19.07%, Spring 14.52% and Winter
SUMMERY
105
7.61%. Chi-square analysis of the data showed significant difference in the prevalence of the disease in different seasons of the year. The disease was also compared in three age groups of sheep and goats. The data showed 22.17% disease in adult animal group above 2 years of age followed by 15.85% in animals between 1-2 year and 7.99% in age group below one year. Statistically significant difference in all age groups was found in chi-square analysis. The sex wise prevalence of theileriosis revealed non-significant difference between male and female sheep and goats. Two different species of Theileria were reported by many researchers causing disease in sheep and goats. The PCR was carried out for the identification of Theileria species affecting sheep and goats in Balochistan. Two species specific sets of primers were designed using 18SRNA gene sequence to identify these two species of Theileria and the distribution among the two species of animals. The genomic DNA of two species of parasite was successfully amplified in positive samples. The assay was proved successful and we recommend for the prevalence surveys for theileriosis in sheep and goats. The data showed that the prevalence of T. lestoquardi was 73.80% in sheep and 69.23% was in goats in the target regions. It was found the T. lestoquardi was highly prevalent and causing theileriosis in small ruminants. The prevalence of T. ovis was 26.19% in sheep and 30.76% in goats respectively in the investigated animals; it was less than T. lestoquardi. It was concluded that both Theileria species were identified and found circulating in small ruminants in the target region of Balochistan. In the study we determined that PCR method based on 18S RNA gene could detect and differentiate T. ovis and T. lestoquardi.
Effect of theileriosis in sheep and goats on hemeto-biochemical parameters were studied included RBCs, Hb%, PCV, Platelets, WBCs, MCV, MCHC, AST, ALT, BUN, Bilirubin and Creatinine. Blood samples were collected from Theileria confirmed, diseased animals (sheep and
SUMMERY
106
goats) along with equal number of healthy animals for comparison. In sheep RBCs, Hb%, PCV, WBCs, MCHC, AST, ALT and Creatinine values showed significant difference when compared with values of healthy animals. Significant (p<0.05) reduction was noted in measurement of RBCs, Hb%, PCV and MCHC whereas, AST, ALT and Creatinine showed significant increase in diseased animals. In goats affected with theileriosis showed significant decrease in RBCs count and Hb%. The values for AST, ALT and Creatinine were found significantly increased in diseased animals when compared with healthy control group of equal number of animals. In present study it was noted that Butalex intra muscularly at the rate of 2.5 mg/kg body weight is quite effective in eliminating the Theileria parasite from the blood of sheep and goats and treatment at the day 10 post treatment. Imizol was also found an effective treatment of theileriosis but less effective than Butalex. Availability: No items available
1171.
Biochar Application As A Strategy In Water Treatment Of River Ravi: A Comparative Study
by Safa Abid Chughtai | Dr. Saif Ur Rehman Kashif | Dr. Fareeha Arooj | Dr. Muhammad Nasir.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Pakistan is a resourceful but a water starved country. With a population of almost 20 crore there is an extreme pressure on the resources specially the meager water resources of the country. The inaccessibility to clean water and the unavailability of cheap methods of water treatment has created an utmost need to develop a new cost effective method for waste water treatment.
The actual aim of this research was to treat water of River Ravi using a relatively new Biochar method and compare it with a conventional precipitation method in removal of heavy metals. For this purpose, a total of 48 samples were collected from 4 different points for three consecutive weeks. 8 samples were treated with Biochar method and 8 with precipitation method per week. Heavy metals which were analyzed were Zn, Mg, Cu, Cr, Ni, Fe, Mn and Pb. Samples were pre and post analyzed and the results were compared.
There was a clear difference as Heavy metals were completely removed by the Biochar method and its efficiency was 100% while precipitation method managed to remove only 50- 80% 0f the heavy metals. There were some drawbacks associated with both the techniques as well. The Biochar method caused a slight change in water’s pH and its colour. On the other hand precipitation technique was a failure in removing metals completely specially those which can form complexes in water like Pb, Ni, Fe etc. Biochar method was also found to be a cheap technique as compared to the precipitation technique as there were no costly chemicals and apparatus required and was prepared from mere waste which was intended to be disposed off.
Availability: Items available for loan: UVAS Library [Call number: 2702-T] (1).
1172.
Effect Of Zinc Oxide Nano-Particles On Histological Features Of Pancreas, Liver And Kidney In Alloxan-Induced Diabetic Rats
by Nihar Ali (2014-VA-538) | Dr.Hafsa Zaneb | Dr.Saima Masood | Dr. Muhammad Shahbaz Yousaf.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Diabetes mellitus (DM), a metabolic disorder, is considered one of the top five causes of death globally, affecting as many as 150 million people worldwide. In diabetic subjects, use of zinc oxide nano-particles (ZnONPs) leads to reduction in blood glucose level and higher expression of insulin receptors. However, the structural changes introduced by them in pancreas, liver and kidney of diabetic rats are largely undocumented. The current study, therefore, was designed to report the modifications effectuated in the histomorphometry of the above- mentioned organs of diabetic rats through oral use of ZnONPs.
The study included 25 Wistar rats, housed in stainless steel cages in the animal shed. The rats were kept in environmentally controlled room with temperature of 24 ± 5 ºC, under a 12 h light: 12 h dark cycle and provided free access to water and food. The rats were divided into five groups. Diabetes was induced by injection of alloxan in four groups, leaving one group as negative control. The treatment of ZnONPs was mixed in the feed of three diabetic groups at 15mg/kg, 25mg/kg and 50mg/kg respectively doses for 15 days. At the termination of the trial, pancreas, liver and kidney were dissected out, fixed and processed for histomorphometry. Diameter and density of pancreatic islets of Langerhans, number and diameter of alpha, beta cells, renal cortex width, glomerular diameter, proximal and distal convoluted tubules diameter, wall to lumen thickness ratio of proximal and distal convoluted tubules, Bowman’s capsule basement membrane thickness, central vein diameter of liver, width of hepatocyte cords and Kupffer cells count was studied.
The morphometric results showed that size of pancreatic islets of Langerhans, diameter and number of beta cells per islet was lower (p<0.05) in positive control group and ZnONPs treated groups G1, G2, and G3 than in negative control group. There was no significant difference of islet size, diameter and number of beta cells between G1, G2, G3 groups and positive control group. Histomorphometric evaluation of alpha cells showed that alpha cells count and diameter remained the same in all groups. Pancreatic islet density was similar among all groups.
Glomerular diameter in control positive group was similar (p>0.05) to control negative group. Glomerular diameter increased (p>0.05) in ZnONPs treated groups (G1, G2, G3) as compared to both control groups. The cortex width decreased (p<0.05) in positive control group as compared to negative control, increased (p>0.05) in ZnONPs treated groups (G1, G2, G3) as compared to both control groups. The cortex width decreased (p<0.05) in positive control group as compared to negative control group Following treatment with ZnONPs, thickness increased (p<0.05) in G2 and G3 groups compared to positive control group but was similar to that of negative control group. Proximal convoluted tubule diameter increased (p<0.05) in ZnONPs treated groups as compared to both control groups. The distal convoluted tubules diameter increased in G1, G2 and G3 groups as compared to control groups. Wall to lumen ratio of distal tubules showed no significant difference among groups. Bowman’s capsule basement membrane thickness significantly increased in the positive control group and G1, G2 and G3 groups as compared to negative control group.
Central vein diameter of liver increased (p<0.05) in positive control group as compared to negative control group, while it was found similar between G1, G2 and G3 groups and positive control group. The hepatocyte cords width increased in positive control group as compared to negative control group. In G1, G2, and G3 groups, the hepatocyte cords width was smaller (p<0.05) than in control positive group. The number of Kupffer cells significantly increased in positive control group as compared to negative control group. The Kupffer cell count was lower (p<0.05) in G1, G2 and G3 groups than the positive control group. Microscopy of liver sections, stained with PAS staining, showed minimum glycogen deposition in hepatocytes of positive control group and treated groups as compared to negative control group.
In conclusion, histomorphometric evaluation showed that ZnONPs did not improve tissue micro-architecture of pancreas and kidney, rather deterioration of the parenchyma was observed. However, use of ZnONPs ameliorated the liver histology to some extent.
Availability: Items available for loan: UVAS Library [Call number: 2706-T] (1).
1173.
In Vitro Activity Of Selected Biocides Against Fungal Isolates From Production Area Of Pharmaceutical Industry
by Sana Ilyas (2009-VA-238) | Dr. Muhammad Nawaz | Prof. Dr. Aftab Ahmad Anjum | Dr. Muhammad Ovais Omer.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Pakistan pharmaceutical industries have grown to grab their position amongst top ten pharmaceutical industries of Asia Pacific region. These are serving with 80% of pharmaceutical needs. The industry on the other hand faces some challenges in terms of sterile pharmaceutical product manufacturing. The fungal contamination causes spoilage to pharmaceutical products, cosmetics, and food products. The fungal contamination to pharmaceutical products has resulted in direct losses to human health and to economy.
A total of 50 air samples were collected from clean area of a pharmaceutical production unit by exposing sabouraud dextrose agar (SDA) plates by settle plate method (4 hours exposure). Fungal colonies were purified by sub-culturing and later identified macroscopically and microscopically. Selected biocides included isopropyl alcohol (70%), chloroxylenol (20%), chlorhexidine gluconate (20%), and benzalkonium chloride (20%) were used in this study. A 100 μl of spore suspension of each fungal contaminant (1.0 × 106 to 5.0 × 106 spores/mL) was exposed to 9.9 mL of biocide preparation for 15 and 30 minutes while exposure was stopped by adding 1 mL of mixture (spores exposed to biocide) into 9 mL of respective neutralizing agents The enumeration of colonies was started immediately after the growth was visible and expressed as Mean±S.D. and converted to log10. Antifungal activity of biocides was expressed as log10 reduction and different biocides‟ activity was compared using ANOVA technique by graphed prism 5.0 statistical software.
Total 204 colony forming units (CFU) were identified from filling area (36), solution room (47), and buffers (121). The antifungal activity in terms of log reduction was lowest by isopropyl alcohol at 15 minutes and highest was shown by chlorohexidine gluconate at 30 minutes against
Summary
64
Aspergillus flavus. In case of Aspergillus fumigatus all the biocides presented significant difference of antifungal activity at 15 minutes. The response of Aspergillus niger against different biocides at 15 minutes and 30 minutes was same as was in case of Aspergillus flavus while each biocide‟s antifungal activity was found significantly increased with increase in time of exposure. The similar response of antifungal activity of different biocides at both exposure times was noted against Saccharomyces cerevisiae. The antifungal activity of all biocides against penicillium was found significant different at 15 minutes and 30 minutes exposure time. Similarly, each biocide‟s antifungal activity increased with increase in time of exposure. On overall basis, isopropyl alcohol was found less effective while benzalkonium chloride and chlorohexidine gluconate presented comparatively higher efficacy against fungal isolates. Availability: Items available for loan: UVAS Library [Call number: 2705-T] (1).
1174.
Molecular Epidemiology Of Mycobacterium At The Animal Human Interface And Its Co-Morbidity With Diabetes Mellitus
by Zarfishan Tahir (2011-VA-624) | Prof. Dr. Mansur-ud-Din Ahmad | Dr. Abdul Majeed Akhtar | Dr. Muhammad Hassan Mushtaq | Prof. Dr. Tahir Yaqub.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Tuberculosis (TB) is a common and fatal infectious disease which has afflicted mankind for several millennia. At the moment, TB is positioned at number five when it comes to the most common causes of fatality worldwide. TB is curable if it is properly diagnosed and treated. In 2015, it was estimated that 1.5 million deaths (an equivalent of 4,000 deaths per day) and 9 million new TB cases have been reported. Diabetes Mellitus is also widely distributed and estimated to affect 366 million people by 2030. The co-morbidity of DM and TB is re-emerging because of the progressive epidemiology of both diseases especially in the developing countries. Endemicity of TB and DM is growing in developing countries because of low socio-economic status and poor living conditions.
In this study, a total of 500 tuberculosis positive patients were selected under TB DOTS program from five tertiary care hospitals of Lahore. Sputum samples were collected from all the enrolled patients and smear microscopy was performed for TB confirmation. Blood samples were collected from the same patients for screening of diabetes mellitus. Sputum samples were also processed for culture and drug sensitivity on LJ medium. Molecular identification by PCR technique was carried out on all positive cultured strains and results were compared with reference strain H37RV. For DNA sequencing, PCR products were sent to Singapore where sequencing was performed by Sanger method.
Data was compiled and variables including gender, age, drug resistance and treatment history and correlation among different variables was analyzed using chi-square test and Fischer’s exact test method at P-value of ≤0.05. SPSS (Statistical Package for Social Sciences, Version 20.0) was used for statistical analysis. The count data was statistically analyzed using
SUMMARY
124
descriptive statistical tools. On screening for fasting blood sugar level, 74 (14.8%) patients were recorded as diabetics as well i.e. blood sugar level ≥ 126 mg/dl. Out of these 74 patients, 22 patients had previous history of diabetes whereas remaining 52 patients were newly diagnosed at the time of screening. The maximum distribution of TB-DM patients was found in age group > 57 years. Mean age of the group without DM was 39 years and with DM was 48 years. Coexistence of DM in TB patients was higher in males (62.2%) as compared to female study subjects. However, the gender difference is statistically non-significant (p value 0.243).
The distribution of education level revealed that out of the total participants, maximum number of patients (n=220) were illiterate and similar trend was observed in diabetic patients with 54 (73%) individuals belonging to the illiterate group of the subjects. There is statistically significant difference between existence of DM and literacy level in tuberculosis patients. Among social and behavioral risk factors in tuberculosis patients, majority of the patients were unemployed (24%) in TB-DM group. Significant correlation p value ≤ 0.05 was found between coexistence of TB-DM and tobacco use. TB cases with diabetes were known to have history of smoking with 73% (n=54) while non-smokers were 27% (n=20).
On sputum smear microscopy frequency of 3+ results showing high bacterial load, was profoundly higher i.e. 67.6% in diabetic tuberculosis patients as compared to non-diabetics which was 4.9% only. Total culture yield was 363 out of 500 sputum samples. There were 193 samples that were sensitive to all drugs, 9.4% were MDR strains (resistant to Isoniazid and Rifampicin). MDR-TB is significantly higher in TB-DM patients i.e. 13.5% as compared to 8.7% in TB only patients.
In our study, DNA sequence data for drug resistance was studied by the sequence of rpoB gene of the wild type MTB strain. Sequencing results showed mutations at various spots of rpoB gene.
SUMMARY
125
Most common mutational sites identified were at codon 531, 526 and 516 with frequency of 70%, 15% and 7.5%, respectively. Moreover, mutation sites at 512 and 574 codon had also been reported. In this study, predominantly two phylogenetic variants were identified. Majority of the isolated strains were Central Asia Strain (CAS) with a prevalence of 88.2% and rest were Beijing strain. However, attempts to find zoonosis could not be established. A total of 900 raw milk samples were also screened for M. bovis and no positive sample could be detected.
The present study emphasizes the importance of screening for DM in TB patients, which had not been done in routine. This practice may prove to be helpful in reducing the disease burden of TB patients as well as DM patients. Thus it is recommended that the screening for DM should be implemented in TB/DOTS clinics.
Emergence of Multi drug resistant Mycobacterium tuberculosis is also a serious challenge for clinicians. A very large financial implication in terms of treatment, duration of chemotherapy and spread of MDR TB strains is being faced. Treating MDR TB is more complicated than treating drug sensitive TB. Patients with MDR TB require longer, much more costly treatment and experience higher mortality rates. Such a long time to initiate the treatment is not affordable, thus there is a dire need for some rapid technique like molecular based diagnostics for MDR detection, which can provide quick results and making it possible to start treatment at earlier to minimize transmission, morbidity and mortality. Availability: Items available for loan: UVAS Library [Call number: 2710-T] (1).
1175.
Epidemiology And Control Of Gastro-Intestinal Nematodes Of Large Ruminants In Balochistan
by Muhammad Ramzan (2009-VA-653) | Dr. Nisar Ahmad | Prof. Dr. Muhammad Azam Kakar | Prof. Dr. Kamran Ashraf | Prof. Dr. Aneela Khurram.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: The main area of research in this study was to assess the prevalence, hematological aspects
of Bovine nematodiasis. Three main experiments were conducted to highlight the objectives of
the present research study.
The first experiment was conducted to find out the prevalence of large ruminants major
nematodes for one year. For this purpose buffalo and cattle of either sexes and between < 1 year
to > 2 years of age were selected from two sites i.e., Quetta and Qilla Abdullah. Fecal analysis of
these cattle and buffalo showed overall higher (33.99%) nematodes prevalence recorded in buffalo
in Quetta, (27.99%) in cattle at Qilla Abdullah followed by in cattle at Quetta (26.66%). Five
nematode infection was recorded in all two experimental sites with higher prevalence of
Haemonchus contortus in buffalo at Quetta and Ostertgia ostertagi in cattle at Quetta and Qilla
Abdullah. The buffalo and cattle of < 1 year presented higher nematodes prevalence than 1-2 years
and > 2 years. The female buffalo and cattle were infected with nematodes prevalence higher
than male animals. These five nematodes were prevalent almost throughout the year, however a
peak infection was recorded during August and September in cattle and October in buffalo. The
high temperature, rainfall and humidity during these months may be predisposing factor of higher
prevalence. Mostly the level of nematodes infection was low(< 800 EPG) and did not seriously
impaired the buffalo and cattle productivity.
Second experiment on assessing the comparative efficacy of anthelmintics (Levamisole,
Oxafendazole and Ivermectin) against cattle and buffalo nematodes were conducted at Govt and
private farms. The results showed that Ivermectin than Oxfendazole were found effective against
cattle and buffalo nematodes. The higher (89-100%) reduction of EPG were recorded in cattle and
87
buffalo calves treated with Ivermectin followed by Oxfendazole (86-100%), Levmisole (88-
100%).
Third experiment was conducted to determine the hematological values in healthy and
nematodes infected animals. Different hematological parameters i.e., TEC, TLC, Hb estimation,
were determined. The results showed that overall low Hemoglobin estimation and RBC were
recorded in nematodes infected animals than healthy, while higher WBC were recorded in
nematodes infected animals than healthy. The Lymphocytes and Neutrophil and Monocytes were
higher in some nematodes and lower in other, while higher mean Eosinophil counts was recorded
in all nematodes infected animals than healthy animals. Availability: Items available for loan: UVAS Library [Call number: 2730-T] (1).
1176.
Effect Of Pre-Weaning Diets And Varying Levels Of Concentrate During Post-Weaning Period On The Performacne Of Female Nili-Ravi Buffalo Calves Up To One Year Of Age
by Zeeshan Muhammad Iqbal (2002-VA-55) | Prof. Dr. Muhammad Abdullah | Prof. Dr. Khalid Javed | Prof. Dr. Makhdoom Abdul Jabbar.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Nili-Ravi buffalo is a well-known buffalo breed in subcontinent Indo-Pakistan region and famous for its high milk production ability. Currently, buffalo calves and growing heifers are fed on deprived quality and quantity roughages with poor nutritive values resulting in reduced growth rate, reproduction with delayed attainment of puberty and high mortality. These constraints can be overcome through nutritional management of buffaloes. There is a need for the development of standards for adequate, cost effective provision of colostrum, whole milk/milk replacer and calf starter ration to neonatal calves up to weaning, establishment of nutrient requirements for growing buffalo heifer with aim of more average daily gain to reduce age at puberty and nutrients requirements for lactating buffalo according to their status and stage of milk production.
The current study comprises of two experiments and was conducted at Livestock Experiment Station, Bhunikey, Pattoki, District Kasur, Punjab, Pakistan. The first experiment was performed with an aim to check the growth performance of female buffalo calves on whole milk & milk replacer and find out the cost effective and growth rate friendly alternate source of liquid diet. The duration of this experiment was 120 days. Thirty six female calves were selected and randomly divided into three (n=12) different treatments A (whole milk), B (50% whole milk & 50% milk replacer) and C (milk replacer). All the calves were given colostrum for first three days, then whole milk up to 15 days of age and transferred into three treatments. In addition to this all the calves were provided calf starter and fresh water ad-libitum. The calves were given
SUMMARY
133
liquid diet @ 10% of their body weight for first two months and then gradually decline of 1% on weekly basis for the subsequent two months. Green fodder was started on three month of age. The average daily total dry matter intake was remained same for all the three treatments but the average daily gain was higher in treatment A (457.38±110.13a) compare to treatment C (362.22±107.83b) but it was same for treatment A&B and B&C, respectively. The mean FCR value was also better for treatment A (3.49±0.56b) compare to treatment C (4.30±1.24a) and it was same for treatment A&B and treatment B&C, respectively. The mean cost/kg gain was higher in treatment A (422.72±70.66a) compare to treatment C (352.97±97.49b) and it was same for treatment A&B and B&C, respectively. Animals had performed well on mix liquid (50 % whole milk: 50% milk replacer) diet and it was more cost effective than other two treatments.
The aim in second experiment was to set the standard and cost effective level of concentrate ration for growing female buffalo heifer calves. For second experiment thirty (30) calves were selected from first experiment and were randomly dived into three treatments A, B and C. Treatment A was fed on concentrate ration according to 0.5 % of their body weight, treatment B 1.0 % and treatment C 1.5 % of their body weight. In addition to this all the calves were given ad-libitum green fodder and fresh clean water. All the calves were fed on similar concentrate ration having CP: 17 % and ME: 2.6 Mcal/kg. The duration of this experiment was 8 months. There was significant difference (P<0.05) in mean dry matter intake, protein intake, energy intake and protein per kg gain across all the three treatments and were higher (P<0.05) for treatment C then treatment B and lower (P<0.05) in treatment A, respectively. The average daily gain was remained same (P>0.05) for all the three treatments (497.32±17.92, 503.63±19.09 and 532.77±20.67). The higher feed efficiency was observed in treatment A (0.135±.004a) while it was same for treatment B & C (0.113±.003b & 0.108±.004b), respectively. The average body
SUMMARY
134
condition & score, body mass index and blood constituents (RBCs, WBCs, heamoglobin, packed cell volume, mean corpuscular volume, platelets count, lymphocytes, monocytes and granulocytes) were unaffected (P>0.05) by different concentrate levels. Concentrate levels had significantly affected some of serum components (total protein and urea) but some components (glucose & cholesterol) were unaffected by dietary treatments. The values of mean serum total protein and serum urea were found lower in treatment A (6.12±0.17b & 42.34±1.59b) compare to treatment B (6.65±0.23a & 50.08±2.05a) and C (6.79±0.23a & 51.41±2.29a), respectively. The higher values of serum total protein and cholesterol in treatment B & C may be attributed to higher concentrate level in these two treatments. Concentrate levels had significantly (P<0.05) affected some of the digestibility parameters (DM %, CP% and NDF%) while other parameters (organic matter, fat, ash, ADF and urine pH) were remained same (P>0.05) on varying concentrate level diet. The mean body measurements (height at wither, body length and heart girth) were also not affected (P>0.05) by dietary treatments. There was significant difference across all the three treatments in total average daily dry matter intake cost and cost per kg gain. These were lower in treatment A compared to other two treatments B & C. It was observed that mean dry matter, protein and energy intake was lower in treatment A (0.5% of body weight) and weight gain was remained same on all the three dietary treatments. The mean feed efficiency was greater and mean cost per/kg gain was lower in treatment A. So, treatment A was remained more cost effective than other two treatments.
Both experiments were planned by keeping in mind the problems of buffalo farmer. Rearing of calves with improved growth rate on least cost feeding regime is important in dairy farming. Milk replacer is an alternate source of whole milk. Most of the buffalo farmers don’t use milk replacer for rearing of calves because of slower growth rate. Mixing of milk replacer
SUMMARY
135
with whole milk in 50:50 ratio make the consistency of liquid diet near to whole milk. Feeding of whole milk with milk replacer along with calf starter reduces the cost without affecting growth rate. At this stage farmers should keep in mid the cleaning of feeding pans to avoid the risk of diarrhea.
In post weaning period calves’ rumen is fully develop and is completely shifted to solid diet. During this transition phase farmers don’t follow the nutritional requirements of calves, which slow down the growth rate and ultimately increase the age at puberty. As buffalo are efficient converter of low quality diet. If farmers offer concentrate ratio (16-18% CP) to buffalo heifers at the rate of 0.5% of body weight along with ad-libitum green fodder, growth rate can be improved cost effectively.
5.1. Conclusion:
The findings of first experiment shows that 50% whole milk & 50% milk replacer @ of 10 of body weight along with adlibitum calf starter ration help in early rumen development, improved growth rate and better FCR on economical basis. So, it is recommended that whole milk and milk replacer in 50:50 ratio is growth rate friendly and cost effective for rearing of female buffalo calves up to weaning. The results of second experiment shows that growth rate, body measurements and body condition & score remained the same on all the three dietary concentrate levels but the feed efficiency was improved on lower concentrate level. So, it is recommended that it is cost effective to raise buffalo growing heifers on small amount of concentrate ration (0.5% of body weight) along with ad-libitum green fodder. Availability: Items available for loan: UVAS Library [Call number: 2720-T] (1).
1177.
Effect Of Age On Lipid Peroxidation Of Fresh And Frozen-Thawed Semen Of Nili-Ravi Buffalo Bulls
by Sohail Ahmed (2014-VA-917) | Dr. Muhammad Irfan-ur-Rehman Khan | Dr. Sajid Iqbal | Dr. Muhammad Usman Mehmood | Dr. Muhammad Ijaz.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Buffalo spermatozoa are rich in polyunsaturated fatty acids and prone to lipid peroxidation. Malondialdehyde (MDA) is a byproduct of lipid peroxidation and causes irreversible damage to sperm structure and function. In buffalo, blood plasma MDA level increases with age. Therefore, we hypothesized that MDA level in buffalo bull semen will increase with age and will affect the semen quality. The objective of the study was to compare MDA level and quality of fresh and frozen-thawed semen in aged vs. young Nili-Ravi buffalo bulls. Single ejaculate was collected on weekly basis for four weeks from aged (13.6±1.0 years; n=3) and young (3.4±0.3 years; n=3) Nili-Ravi buffalo bulls. MDA level was estimated through thiobarbituric acid assay (TBA) in fresh and frozen-thawed semen. The quality of fresh and frozen-thawed semen was estimated through sperm motility, viability, DNA and acrosome integrity. MDA level (nmol/ml) did not differ (P>0.05) between aged vs. young bulls in fresh (2.3±0.2 vs. 2.9±0.7) and frozen-thawed (53.1±2.8 vs. 48.4±2.6) semen, respectively. In fresh semen, sperm motility and concentration did not differ (P>0.05) in aged vs. young bulls; however, the volume of fresh semen increased (P<0.05), while sperm viability and DNA integrity decreased (P<0.05) in aged vs. young bulls. In frozen-thawed semen, sperm motility, viability, and DNA integrity decreased (P<0.05) in aged vs. young bulls. In frozen-thawed vs. fresh semen, MDA level (nmol/ml) increased within young (48.4±2.6 vs. 2.3±0.2) and aged bulls (53.1±2.8 vs. 2.9±0.7), while motility and viability decreased (P<0.05) within the age groups. In conclusion, 1) lipid peroxidation (MDA) does not increase due to age in buffalo bull semen, and 2) freezing causes increase in lipid peroxidation irrespective of age and deteriorates semen quality of Nili-Ravi bulls.
Availability: Items available for loan: UVAS Library [Call number: 2707-T] (1).
1178.
Evaluation Of Cardioprotective Effect Of Citric Acid On Serum Biochemical Profile Against Isoproterenol Induced Myocardial Infarction In Rabbits
by Aasma Shabbir (2014-VA-525) | Prof. Dr. Habib ur Rehman | Dr. Muhammad Shahbaz Yousaf | Dr. Nisar Ahmad .
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Isoproterenol is a drug which is used to treat heart attack, congestive heart failure, shock and certain types of irregular heartbeat. In addition to this, it is also employed during the process of anesthesia to avoid the constriction of airways. Isoproterenol is a synthetic catecholamine which produced myocardial infarction because of production of cytotoxic free radicals. Citric acid is water soluble and is most important antioxidant and enzyme cofactor. Recent evidence suggests that citric acid possess antioxidant activity.
The aim of this study was to optimize a supplement at which citric acid can act as cardio protector against isoproterenol and also to evaluate its effect on level of CK-MB, serum glucose, serum creatinine, urea, uric acid, triglycerides, total cholesterol, HDL-C, AST, ALT, ALP.
Forty rabbits were selected and housed in the experimental shed of the Department of physiology, University of Veterinary and Animal Sciences, Lahore. Before the arrival of rabbits, the shed was cleaned and fumigated. The rabbits were divided randomly in to five groups, each with eight replicates (n=8 in each group). Animals were treated by following treatment plan; Group 1: (Negative Control) Animals received normal saline 1ml orally for 14 days. Group 2: (Positive Control) Animals received normal saline 1ml orally for 14 days and then myocardial infarction induced on 15th day. Group 3: Animals received citric acid 250 mg/kg body weight orally (dissolved in 1 ml distill water) for 14 days and then myocardial infarction induced on 15th day. Group 4: Animals received citric acid 500 mg/kg bodyweight orally (dissolved in 1 ml distill water) for 14 days and then myocardial infarction induced on 15th day. Group 5: Animals received citric acid 750 mg/kg body weight orally (dissolved in 1 ml distill water) for 14 days and then myocardial infarction induced on 15th day.
At the end of the experiment, rabbits were slaughtered to collect blood samples for serum biochemical analysis (CK-MB, lipid profile, LFT’s, RFT’s, serum glucose). Data was analyzed by one way analysis of variance using SPSS software (SPSS Inc. version 20, Chicago, Illinois). The group differences were studied by using Duncan’s multiple range tests. The P value <0.05 was considered as significant. Data was presented as mean ± SD.
Results showed that the level of CK-MB, creatinine, urea, HDL-C, ALT were found significant (P<0.05) in rabbits compared with the control. While there was no significant effect found on serum glucose, uric acid, total cholesterol, triglycerides, AST, ALP in all the experimental groups compared with control.
From our study we have concluded that supplementation of citric acid has cardioprotective effect against isoproterenol induced myocardial infarction in rabbits. It shows significant effect on CK-MB, HDL-C, ALT, urea and creatinine. While there was no significant effect found on serum glucose, uric acid, total cholesterol, triglyceride, AST, ALP.
Availability: Items available for loan: UVAS Library [Call number: 2703-T] (1).
1179.
Extraction Of Functional Polysaccharides From Chickpea (Cicer Arietinum) And Application As Edible Coating On Cheddar Cheese
by Muhammad Ali Sabir (2008-VA-433) | Dr. Muhammad Nadeem | Dr. Saima Inayat | Prof. Dr. Muhammad Abdullah.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Cheddar cheese was collected from the market and coated with three different coatings. All the reagents used in this study were High Performance Liquid Chromatography grade and obtained from Sigma Aldrich, USA. Experiment were performed in completely randomized design. Cheddar cheese was ripened for 60-days for lipolysis and was analyzed at the interval of 30-days interval. Composition of cheese milk and cheese, peroxide value, Iodine value, free fatty acids and changes in fatty acids (short chain and unsaturated fatty acids) composition were determined.
Fat content of all the treatments and control went on decreasing throughout the storage period of 60-days. There was not-significant difference in the protein content of cheddar cheese coated with different coatings.Moisture contents of cheddar cheese coated with different coatings decreased with the decreased ripening period of the cheddar cheese (P>0.05). Free fatty acids increased in all the treatments during the entire ripening period from 0 day to 60 days, the concentration of free fatty acids in all the treatments at all the determination time points were not different from each other and control. There was also increase the peroxide value of control sample from 0 day to 60-day time period of cheese ripening. All the determination frequencies showed that peroxide value of control and experimental samples were not different.Iodine value decreased in control sample day 0 to day 60 continuously, the decline in iodine value of control and experimental samples was not different.Concentration of short-chain, medium-chain and long-chain fatty acid decreased during the ripening period of 60 days but the decline in all the treatments was non-significant.Anisidine value increased in control sample day 0 to day 60 continuously. There also increased the Anisidine value higher in all treatments and control (P>0.05).
These results suggest that galactomannas based coating can be used for the coating of cheddar cheese.
Availability: Items available for loan: UVAS Library [Call number: 2701-T] (1).
1180.
Prepration Of Cost-Effective Aquafeeds For Labeo Rohita Using Plant Based Feed Ingredients
by Afifa Bari (2009-VA-422) | Dr. Sumaira Abbas | Prof. Dr. Muhammad Ashraf | Dr. Abdul Razaaq.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: In Asia Carp culture is dominated which is mostly extensive and semi-intensive. Now a days aquatic plants used in animal feed became very popular. Aquatic plants have been used to enhance the growth, reduce stress, induce appetite and play a major role as Immunostimulants that have antimicrobial effects in fin fish and shrimp. However, exact percentage contribution needs to be determined to obtain its benefits as over dose can have harmful effects. These plants are mechanically removed at a high costs and dumped. So, the use of unusual feed resources is a way of significant reduction in the cost of feed.
Addition of Aquatic plants upgrade growth, enzyme level, body composition and immunity of Labeorohita (rohu) fingerlings.This study will produce useful information for aqua feed and fish industry concerning possible utilization source of aquatic plants for carp. It will also be helpful to save the increasing cost of aqua feed industry because of cheaper source of energy inproving health of fish thus enhance production.
To compare the growth performance and meat quality of Labeorohitaunder different treatments
Experiment was designed in glass aquariums and with two replicates in each treatment. The effect of inclusion of aquatic plants in the feed of Labeorohitawas also observed on histology under different treatments in aquariums. Before stocking all aquariums was disinfected with KMnO4. Each aquarium was stocked with 15 Labeorohitafingerlings and their morphometric parameters i.e,body weight and total length was recorded at the time of stocking. The physico-chemical parameters (DO, pH and Temperature) was monitored on daily basis from each treatments. For proximate and histological studies organs of fish was collected at the end of experimental. The feed was formulated for treatment T1, T2, and T3 having 35%, 30% and 25% of plant (Vallisneriaspiralis). The fish samples were captured randomly from each of the treated aquarium and their morpho-metric characteristics viz. total body weight and total length were recorded on weekly basis. And after obtaining the data the fish were released back into their respective aquarium. At the final harvest, the proximate composition of fish meat sample was studied.
The findings of the present experiment are summarized as follow.
1-The average body weight of Labeorohitaremained as 91.2, 71.3, 62.2 and 58.2g under the treatments T1, T2, T3 and T4 respectively.Fish attained the maximum average body weight in T1 which was treated with 35% plant.Among the different treatment, maximum body increment in body weight was recorded in T1 as 91.2(g) whereas minimum body weight was recorded in T4 as 58.2 (g)..
2-Labeorohitashowed the minimum value of specific growth rate as 0.422 and 0.463 in T3 and T4. Maximum value of 0.789% of specific growth rate was noted in T1.
3-Among different treatments the maximum condition factor was observed as 2.717% in T1 while minimum was gained as 1.918% in T4.
4-Among different treatmentsLabeorohita showed the highest growth rate with the highest crude protein contents 18.70% under the treatment T1. while17.85%, 17,60% and 17.35% in T2, T3 and T4.
5-The maximum moisture content was observed as 75.22% in T1 and minimum moisture content was observed as 73.20% in T4
6-The maximum value of total fats was observes as 1.29% in T4 and minimum value was observed as 1.13% in T1 treatment
7- Among the abiotic factor water temperature played major role towards fish growth as higher increase in body weight was observed for all the treatments during July and august while minimum increase in body weight was observed in September and October which perhaps due to low water temperature.Maximum water temperature was observed as 24.6 °C in T1 and T3 treatments. While minimum was recorded as 21.3 °C.
8-The physico-chemical characteristics of water remained within the favourable limits for fish culture.and shows non-significant under all treatments.
Availability: Items available for loan: UVAS Library [Call number: 2699-T] (1).
1181.
A Case Control Study Of Risk Factors Of Periodonitis In Pregnant Women In District Faisalabad
by Sehar Yousaf (2014-VA-539) | Prof. Dr. Mansur-ud-Din Ahmad | DR. MamoonaChaudhry | Dr. Muhammad Nasir.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Good oral health is the indicator of good general health of an individual. Poor oral hygiene is the most important factor to cause dental diseases. Severe form of gingivitis called periodontitis. Periodontal disease affects the gum and jaw bone.
If periodontitis is not treated in the early stages it become worse due to increased production of clavicular fluid, which contains inflammatory mediators and bacterial flora that can damages the periodontium. Gingival health is compromised during pregnancy due to hormonal changes. This is called pregnancy gingivitis which is initial stage of periodontitis.
A matched case control study was conducted to identify the risk factors of periodontitis during pregnancy. Study duration was three months and it was conducted in tertiary care hospitals of Faisalabad (Madina teaching hospital, D.H.Q, Allied hospital).Cases were matched on the bases of month of pregnancy and number of pregnancy with control.
Study sample was 282 (141 cases and 141 controls). Data were collected through questionnaire which comprises of two sections one is demographic data and one is questions related risk factors.
Data was entered on SPSS software value was less than 0.05 and confidence interval was 95%. Multi logistic regression test was applied to identify the potential risk factors of periodontitis. Results have been shown the different risk factors which are capable of cause periodontitis.
The most significant risk factors e.g. family history, systemic illness in which diabetes and hypertension were most common, poor eating habits due to lack of knowledge about oral health were common. Results have been shared with health authorities of concerned hospitals. Results cannot be generalized on the whole population due to its less sample size.
Availability: Items available for loan: UVAS Library [Call number: 2695-T] (1).
1182.
Evaluation Of Antioxidant And Antmicrobial Potential Of Rutin In Combination With Butylated Hydroxytoluene In Cheddar Cheese
by Bakhtawar Naseer (2014-VA-815) | Dr. Sanaullah Iqbal | Mr. Haroon Jamshaid Qazi | Dr. Muhammad Nadeem.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Commercially synthetic antioxidants like ButylatedHydroxytoluene (BHT),Butylatedhydroxyanisole(BHA), and ascorbic acid were added in cheese as antioxidants. Researches reveal that synthetic antioxidants havehuman health side effects. With increasing food safety demand, the synthetic antioxidant needs to be replaced with natural antioxidants. Rutin is a natural flavonoid, which has antioxidant and antimicrobial activity and can be used as natural antioxidant to reduce lipolysis and decrease microbial load.
Rutinin combination with BHT in various concentrations was added as an antioxidant and antimicrobial agent in Cheddar Cheese to reduce lipolysis and microbial load in Cheddar Cheese.
Total no. of treatments (n=7) of cheddar cheese were prepared and analyzed to evaluate the antioxidant and antimicrobial potential of Rutin in combination with BHT. Each treatment was done in replicates. Cheddar cheese was ripened for three months at 8ᵒC. During ripening different types of tests i.e., antioxidant (includes Total phenolic contents, Antioxidant activity in linoleic acid, Anisidine value, Peroxide value, Thiobarbituric acid value, Free Fatty Acid value), antimicrobial (includes Total plate count, Yeast and mould count, Antimicrobial test for S. aureus and E. coli.) were performedat 0, 30, 60 and 90 days of ripening. Sensory evaluation was performed by a penal of five semi trained panel of judges, samples were evaluated for color, taste, flavor and overall acceptability at 0, 30, 60 and 90 days of ripening.
Total phenolic contents and antioxidant activity in linoleic acid tend to increase with increasing antioxidants concentrations from T1 to T5. In current study T5 showed slightly more antioxidant capacity than positive control. On the other hand, TPC and AA tend to decrease during storage time from 0 to 90 days which shows that the phenols contents are being utilized during the time to stop free radicles to produce.
Anisidine test is used as a chemical indicator of lipid oxidation and to measure the secondary lipid oxidation. In current findings anisidine value increased significantly (p < 0.05) in all treatments from 0 to 90 days storage.
In current findings antioxidant activity of the rutin in combination with BHT has no effect on free fatty acid value. But free fatty acid value increase during the time 0 to 90 days due to moisture present in the samples. In current study Peroxide value increased during storage. PV was highest for negative control. T5 had low peroxide value and positive control showed lowest PV.
In sensory evaluation color of all the experimental cheddar cheese treated with rutinin combination with BHT and controls were not different from each other (P>0.05).The result showed that increasing rutinin combination with BHT concentration had no effect on the color at storage from 0 to 90 days.In current study taste scores of all the treatments having different concentration of rutinin combination with BHT showed the decreasing trend with storage from 0 to 90 days. Lower sensory score of T5 is maybe because of the high phenolic content in it. T4 has good sensory score and good antioxidant and antimicrobial capacity. Thus, it is concluded that T4 is the best combination of Rutin in combination with BHT in it. Addition of Rutin in combination with BHT increased the total phenolic content and Antioxidant Activity of Cheddar Cheese.It also has significant results for Total plate count and Yeast and mold count. This indicates that Rutin in combination with BHT has the antioxidant and antimicrobial potential in Cheddar Cheese.
Availability: Items available for loan: UVAS Library [Call number: 2736-T] (1).
1183.
Evaluation Of Multiple Heated Oil Consumption On Liver And Kidney Health In Male And Female Rats
by Sehar Ashraf (2014-VA-528) | Dr. Muhammad Shahbaz Yousaf | Dr. Imtiaz Rabbani | Dr. Saima Masood.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Reuse of oil during food making is practiced worldwide. This practice is established not only by roadside food stalls but also customary to food outlets, restaurants and hotels in big cities. The process of heating and reheating of dietary oil results in oxidation of oil and generation of free radicals and toxic compounds. These toxic compounds cause red patches and necrosis in liver and kidney, antioxidants decreases also.
The consumption of multiple heated oil may affect liver and kidney health in male and female rats. Eighteen male and eighteen female Wistar rats were taken and divided into groups. Group-I (negative control) fed chow diet and sub-divided into two groups, based upon gender, IA (negative control males) and IB (negative control females). Group-II was given chow diet mixed with 15% v/w single time heated oil and sub-divided into two groups based on gender i.e., IIA and IIB. Animals in sub-groups IIIA and IIIB were fed on chow diet mixed with 15% v/w multiple heated oil. Blood samples were collected at the end of four weeks of study. Hepatic (AST, ALT, ALP, bilirubin) and renal (creatinine, blood urea nitrogen, uric acid) functions, oxidants and antioxidants (in blood and (liver, kidney) tissues) parameters were studied. Data were analyzed using two-way ANOVA on SPSS. Differences between the groups were compared by the Tukey’s test. Differences were considered significant at P < 0.05.
Upon feeding of fried oil liver and kidney damage occurred due to oxidation of oil. But in our present study single time and multiple time heated oil consumption did not damage liver and kidney. Alanine aminotransferase, aspartate aminotransferase and liver catalase significantly higher values in oil feeding groups confirm that chow diet was energy deficient whereas oil supplementation enhance diet energy.
Availability: Items available for loan: UVAS Library [Call number: 2723-T] (1).
1184.
Evaluation Of Repeatedly Heated Oil Consumption On Anthropometric Characteristics And Lipid Profile In Male And Female Rats
by Aasma Bashir Ahmed | Dr. Muhammad Shahbaz Yousaf | Dr. Khalid Abdul Majeed | Dr. Saima Masood.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Deep-fat frying of foods is the most common and quickest method in food preparation. Numerous chemical changes occur during heating process of oils, which promotes the production of different volatile and non-volatile compounds. These noxious compounds are absorbed in the food, and ultimately enter the systemic circulation after digestion and absorption. Effects of peroxidation of biological systems come with a number of pathological manifestations including incidence of oxidative stress, glucose intolerance and atherosclerosis.
Repeatedly heated cooking oil consumption has harmful effects on anthropometric characteristics, lipid profile in male and female rats.
Thirty six adult male and female Wistar rats were selected and divided into six groups having three groups of male rats and three groups of female rats. Group-I including IA (negative control males) and IB (negative control females) were fed chow diet. Group-II including IIA and IIB were given chow diet mixed with 15% v/w fresh oil. Animals in sub-groups IIIA and IIIB were fed on chow diet mixed with 15% v/w fried oil. Body weights were recorded weekly. Organs and blood samples were collected at the end of 28 days to assess organ weights, measure plasma glucose level and lipid profile.
Data was analyzed using SPSS software. Data was analyzed using two-way ANOVA. The group differences were compared by Tukey’s range test. Differences were considered significant at P < 0.05.
Body length of rats was not significantly affected by the feeding of single and multiple fried oil. Effects of treatment, gender and week are significant on body weights of rats. Effect of single and multiple fried oil feeding was significant on absolute weights of abdominal fat and
Summary
63
liver and non- significant on absolute weights of heart, kidney and testes. Treatment effect was non-significant on relative weights of abdominal fat, heart, kidneys and testes, whereas effect was significant only on relative weights of liver. Availability: Items available for loan: UVAS Library [Call number: 2724-T] (1).
1185.
Quality Assessment Of Pasteurized Milk In Relation To Time Of Different Brands Available In Lahore Market
by Noman Ali Khan (2008-VA-367) | Dr. Muhammad Nasir | Mr. Zubair Farooq | Prof. Dr. Aftab Anjum.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: There is consistent threat from adulteration, microorganism and aflatoxin M1 occurrence in the milk. Coliform, Salmonellaare among the majorfood borne pathogens which causes multiple outbreaks. This study is designed to assess the quality of different brands of Pasteurized milk sold in Lahore Market.
The quality of different brands of Pasteurized milk changes in relation to time.
The present study was conducted in Lahore market. A total of 90 samples (30 samples each day) for each of the six pasteurized milk brands were collected on 1st day and analysed on 3rd, 5th and 7th day of pasteurization. These analyses were repeated two times on monthly basis. Analytical parameters for evaluation were: physical (pH, colour, taste and odor), chemical parameters (total solid, fat, SNF and protein), adulterants (salt (NaCl), QAC, sorbitol, boric acid, hypochlorites, formalin, sugar, urea, starch, carbonates, hydrogen peroxide and detergent), microbiological (total viable count, Coliform count and detection of Salmonella) and aflatoxin M1
All the data of experimental results were analysed through repeated measure ANOVA The means will be separated with Duncan multiple range test and the level of significance will be at α=0.005 .
Availability: Items available for loan: UVAS Library [Call number: 2732-T] (1).
1186.
Association Of Dietary Habits With Anthropometric Measurement And Academic Performance Of Children Enrolled In Grade Iv And V In Selected Schools Of Lahore
by Asifa Saleem (2013-VA-445) | Dr. Muhammad Nasir | Prof. Dr. Saeed Ahmed Nagra | Prof. Dr. Mansur-ud-Din Ahmed.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: More than 30% of Pakistan’s population lives below the poverty line. The poorest 20% of the population earn 6.2% of the country’s total income and most households in Pakistan spend almost half of their income on food. School age period is nutritionally important because this is the prime time to build up body stores of nutrients in preparation for rapid growth. Healthy children learn better. Dietary habits are associated with the anthropometric measurement and academic performance. Different schools in three categories (i.e., high, moderate and low fee structured) were surveyed and 50 children of grade IV and V (total 900 samples) from each school of each category in the district Lahore.
Questionnaire was filled to get the information regarding the 24 hour dietary recall of the children and its effect on the anthropometric measurements and academic performance will be noted. Parameters included were age, gender, weight, height, body mass index (BMI), mid upper arm circumference (MUAC), dietary habits and academic performance was assessed and the association of dietary recall with anthropometric measurements and academic performance were assessed. The collected data was analyzed by association SPSS. Analyzed data were represented in percentage, frequencies and charts to assess the association of dietary habits with anthropometric measurements and academic performance of children. The proposed study is expected to determine the role of dietary habits with anthropometric measurements and the academic performance of children.
Summary
49
Mother’s education depends on the admission of students in better school. In High Fee structured schools, mainly the children of Private employees get admitted. Whereas, in Middle Fee structured schools, the children of government employees get admitted. Whereas, in Low Fee structured schools, the children of Government and Private Employees get admission. In class IV, 9 years old children get admitted. Whereas, in Low Fee structured Category, the students of 9 and 10 years age get admitted. It can be stated that in High Fee structured early aged children are admitted. In Class V, the children of 10 and 11 years has almost equal proportion of admission in different category of schools. In Class IV, female’s ratio was more as compared to male in each category of schools. Whereas, in Class V, equal proportion of male and female children got enrolled.
The ratio of Obese children was more in High Fee Structured Category Schools, whereas, less in Moderate and Low Fee Structured Schools. The ratio of Under Weight was also more in students of each category of schools. The ratio of Obese, Overweight and Normal children of Class IV, was more in male children as compared to female, in High and Moderate Fee Structured Category Schools. Whereas in Low Fee Structured Schools, female children were Normal regarding BMI. In class V children, Normal BMI ratio was more in Girls, as compared to Boys, and Vice versa in other two categories of schools.
In class IV students, Main number of students scored 70-79% and 80-89% in high fee structured schools marks and in Moderate Fee structured schools, mainly students scored 60-69%
Summary
50
marks. In Low fee structured schools, score was 70-79% marks in last school examination. On the other hand, in class V students, Main number of students scored 80-89% in high fee structured schools marks and in Moderate Fee structured schools, mainly students scored 60-69% marks. In Low fee structured schools, average score of children was 60-69% marks in last school examination. Overall consumption was less than recommended by US Department of Health and Human Services and the American Heart Association (AHA).
Association of Dietary Habits with anthropometric measurements was significant. There was a direct relationship between Dietary Habits with anthropometric measurements. Main proportion of children were under weight. Less children were normal and only a few 8% children were Overweight. The data has a direct relationship between dietary habits and Anthropometric measurements. There was also an indirect relationship between dietary habits and Academic performance. If we improve the Dietary habits of children then the score of children will not be high. On the average 67.85% children got above 90% marks in last school examination. The 52.81% children scored 81-90% marks in last school examination. Similarly, 62.35% children scored 71-80% marks. Hence it can be computed from the data that Dietary habits has a reverse relationship with academic performance of children.
In view of the data discussed, it is concluded that dietary habits and life style plays and important role in the maintenance and promotion of the good health. The children who were taking adequate diet from all food groups have normal BMI and adequate muscle protein indicated by MUAC values. Underweight children eat less frequently than normal. Data analysis revealed that
Summary
51
over all consumption of food was inadequate and nutritional status was also affected by meal frequency, meal timings, eating pattern and physical activity.
There was no significant difference among normal and obese regarding meal frequency but unstructured eating pattern was observed. Through the children taking adequate calories the type of food taken was not proper. The food prohibition was more common in children. The prohibition of these food items.in children existed due to the absence of knowledge regarding nutritional value of the food items, personal likings and disliking. Availability: Items available for loan: UVAS Library [Call number: 2731-T] (1).
1187.
Role Ofprebiotic Galacto - Oligosaccharides In Rehablitation Of Gut Microbiota Distrubed By Antibiotic Therapy
by Toheed Ahmad (2014-VA-545) | Dr. Sanaullah Iqbal | Dr. Azmat Ullah Khan | Dr. Muhammad Nawaz.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: In this research work, GOS was availed by Friesland campina Domo, Vivinal® GOS powder. Galacto-oligosaccride rich in whey product and is white homogeneous powder, neutral to slightly sweet,and were fed to the patients of sore throat who were on antibiotic trial to check the growth of Lactobacillus, Bifidobacteriu, E. coli and total plate count after disturbing micro flora.Then, by using the same concentrations of antibiotic for two group and prebiotics were fed orally to group one which was treatment group and other was control only depend upon antibiotic. After 0, 5, 10 and 15 days the fecal samples were collected aseptically to check the growth of Lactobacillus, Bifidobacterium, E. coli and total plate count. Colony counting was done very to count the colonies.The plates were incubated at 37 ºC and numbers of colonies were counted on digital colony counter. The results showed that treatment groupof Lactobacilli showed significantly high growth of colonies as compared to control group.The two-other bacteria Bifidobacterium and E. coli species were also tested. Bifidobacteriumrecovered back as earliest it was possible due to the consumption of GOS while it was opposite in case of control. In case of control group Bifidobacteria did not recover back to its original condition even on 15th day of sampling.In case of E. coli and Total Plate Count results of colonies counting showed that day 0 and 10 show the maximum growth of bacteria, the day 10 and 15 were also similar in statistically results due to the rapid increment in rehabilitation of gut micro-biota but the situation in E. coli case were little different because microflora’s strains did not much disturbed and E. coli growth were high in both groups as compare to all other bacteria. This was due to the naturally developed immunity of E. coli against antibiotic.Results of control group of total plat count was checked and
it was noticed that the growth of colonies was slow and the results of 0,5,10 and 15 days did match statistically as per requirement.
Availability: Items available for loan: UVAS Library [Call number: 2725-T] (1).
1188.
Prevalence Of Campylobacteriosis Among Diarrheic Children And Its Associated Risk Factors
by Zahra Aziz Butt (2014-VA-985) | Dr. Muhammad Hassan Mushtaq | Prof. Dr. Mansur-ud-Din Ahmad | Miss Noor-ul-Hudda.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Campylobacteriosis is an acute gastroenteritis characterized by diarrhea (which could be
bloody), fever and abdominal cramps. Campylobacter is becoming a leading cause of bacterial
diarrheal disease worldwide. Campylobacter is a food born pathogen that can transmit to
children through unhygienic practices by mother during feeding, through contact with pets, or
consumption of raw milk, milk products, vegetables, undercooked poultry meat and
contaminated water. It can leads to fetal outcome in children. Post infection complications can
lead to reactive arthritis, irritable bowel syndrome and Guillain Barre Syndrome (GBS). So the
study was design to measure the prevalence and associated risk factors of Campylobacteriosis
among children suffering from acute diarrhea in a tertiary care hospital in Lahore.
A total of 41 stool samples were collected through systematic random sampling from
children having complaint of acute diarrhea visiting a tertiary care hospital (MAYO Hospital) in
Lahore. The samples were transported within 6 hours of collection and cultured on modified
charcoal cefparazone deoxycholate agar and incubated at 42ᴼC for 42 hours for isolation of
Campylobacter. Then the samples were purified and various biochemical tests as catalase,3.5%
NaCl stress, and 1% glycine stress were performed. Out of 41 samples 7 showed no growth on
charcoal agar. Out of 34 samples that showed growth on charcoal agar 14 were positive
biochemically. So the prevalence was found to be 34%.
Data was analyzed by using SPSS 16.0 version. Descriptive statistics was applied to
check the frequencies of different risk factors. Risk factors like sociodemographics and other risk
factors related to hygiene as house member suffering from diarrhea, playing of child in muddy
areas, use of raw milk, bottle feeding, use of common latrines, washing of latrines, presence of
Summary
49
pets in house, access of pets to kitchen, restaurant eating and travelling to any other area were
studied. Chi square test was applied to check the association of different risk factors with
Campylobacteriosis. Three factors as washing of hands by mother before preparing food,
frequency of washing of latrines and consumption of food from restaurant before onset of illness
were found to be associated with the Campylobacteriosis.
Campylobacteriosis is an important disease of children which is underestimated in
Pakistan due to deficient knowledge in subject and financial constraints. Adequate awareness of
hand washing, good hygiene, proper cooking of food and boiling of drinking water can be
important in preventing infection. Careful attention should be given on the disease and further
studies should be conducted about the disease to study upcoming status of the disease . Availability: Items available for loan: UVAS Library [Call number: 2734-T] (1).
1189.
Estimation And Correlation Of Serum Electrolytes And Minerals Levels During Gastroentritis In Dogs
by Asif Hameed Awan (2008-VA-242) | Dr. Syed Saleem Ahmad | Dr. Muhammad Ijaz.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: In gastroenteritis, there is severe diarrhoea and vomiting occurs, particularly in young dogs, it is a life-threatening condition due to loss of body fluid and vital electrolytes and minerals. Which contributes to high mortality. Fluid therapy in these patients is essential to correct hypovolemia, dehydration, acid-base imbalances and serum electrolyte abnormalities. Diarrhoea means increase in frequency, fluid quantity and volume of faecal excretion. As diarrhoea has different levels of dehydration recognized by their specific signs can lead to abnormal level of serum electrolytes and trace elements (minerals).
Serum concentration of electrolytes and minerals varies during gastroenteritis in dogs and its values change dramatically at different dehydration levels. Which could cause death in dogs.
The present study was designed to check the effect of diarrhea on different electrolyte and mineral. Total 40 dogs was included in this study from different private pet clinics and Pet Centre, UVAS, Lahore suffering from clinical diarrhea and vomiting irrespective of cause, These dogs were divided into four groups A, B, C and Control, comprising of 10 dogs in each group. Group A, B and C will be categorized according to dehydration state i.e. 0 - 5%, 5 -8% and 8 - 10% respectively. These groups were made on basis of clinical signs and Packed Cell Volume, (PCV), whereas Group D was be kept as a control, comprising of normal and healthy dogs. These were further subdivided on the basis of age. 5 dogs were included having less than 1 year age and 5 dogs were included having more than 1 year age with the same dehydration level.
PCV was checked to diagnose the level of dehydration. The PCV value, which comes in desire category, were further proceeded for serum collection to check the concentrations of serum electrolytes and minerals like Na, K, Cl, Cu, Zn and Fe through different methods like Na
CHAPTER 6
SUMMARY
Summary
46
and K were checked by flame photometer, Fe, Zn and Cu were checked by atomic absorption and Cl were determined by titration at WTO Laboratory and the Laboratory of Environmental Science, Department at University of Veterinary and Animal Sciences Lahore.
Analysis of variance ANOVA (1 way factorial) technique were used with Random Complete Block Design (RCBD) to compare serum electrolytes and trace elements concentration in gastroenteritis with the concentration of healthy one. Considering the importance and utilization of dogs in our country and substantial losses occur due to deficiency of vital electrolytes and minerals at different dehydration levels due to diarrhea and vomiting irrespective of the cause, the present project were planned to give proper guidance to dog’s owners for their treatment and quick recovery by knowing about the decreasing serum concentration of essential electrolytes and vital minerals during different dehydration levels have different age groups.
From the present study the value of sodium was observed significantly reduced (P<0.05) in all test groups (A, B, C) as compared to control unhydrated group of dogs when serum chemistry was done/ According to result of present study, the concentration of Na in healthy dog was 146.47 ± 3.06 (mmol/l) in infected dogs the concentration was Na= 144.40 ± 3.61 (mmol/l) while normal range of Na= 142-150mmol/l.
Chloride value was observed significantly reduced (P<0.05) in all test groups (A, B, C) as compared to control unhydrated group of dogs when serum chemistry was done. This Chloride value was also significantly reduced (P<0.05) in group A as compared to the groups B and C, while chloride value in group B was significantly reduced (P<0.05) as compared to group C. Potassium is another vital electrolyte that can be affected by dehydration. Potassium is important for muscle contraction and the heart’s rhythm. Small changes in the concentration of K in the bloodstream can have serious health hazards. Potassium value was observed significantly
Summary
47
reduced (P<0.05) in all test groups (A, B, C) as compared to control unhydrated group of dogs when serum chemistry was done. Copper value was observed significantly increased (P<0.05) in all test groups (A, B, C) as compared to control unhydrated group of dogs when serum chemistry was done. This copper value has been increased as the dehydration increases from group A to group C such that Control>A>B>C. Iron value was observed significantly reduced (P<0.05) in all test groups (A, B, C) as compared to control unhydrated group of dogs when serum chemistry was done. This value was also significantly reduced (P<0.05) in group C as compared to the groups A, but the iron value has no significant effect between group A and group B. Zinc value was observed significantly reduced (P<0.05) in all test groups (A, B, C) as compared to control unhydrated group of dogs when serum chemistry was done. Zinc value was also significantly reduced (P<0.05) in group C as compared to the groups A, but the iron value has no significant effect between group A and group B. Electrolytes such as sodium (Na), chloride (Cl), magnesium (Mg), potassium (K), Cupper (Cu), and iron (Fe) are involved in several physiological processes like conduction of electrical impulse through nervous system and muscle contraction and their imbalance could lead a lowering of animal performance.
Dogs having gastroenteritis experienced diarrhea and vomiting due to which fluid loss along with vital electroytes like Na, K, Cl, Fe and Zn in dehydration inspite of Cu which increases as dehydration increases. Availability: Items available for loan: UVAS Library [Call number: 2733-T] (1).
1190.
Prevalence And Chemotherapy Of Coccidiosis In Camel
by Mosin Ali (2014-VA-1134) | Dr.Muhammad Hassan Saleem | Dr. Muhammad Ijaz | Dr.Nisar Ahmed.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Camel belongs to Family Camelidae.The camel is species of desert which is adapted to harsh environment of desert. The versatility and suitability of camel to survive in the hot desert of the regions of the world have given the name “Ship of the Desert”.Coccidiosis is responsible for health problem, economic losses in camels and are characterized by impaired milk production, meat process, decrease feed intake, dehydration, decrease working efficiency and even death of the camel. Coccidiosis cause losses through morbidity and hidden effects on feed intake, efficiency of nutrients utilization and also reduce growth rate in young animal, as a result, it leads to reduction in productivity and performance of the infected animal. The present study was designed to study the prevalence and chemotherapy of coccidiosis in camel. For this, fecal samples of 100 camels of both sex and of various aged were examined. For this purpose, 10-15gm fresh fecal sample was collected into a polythene zipper from the rectum of each camel in a container with ice packs and transported to Medicine lab, UVAS Lahore. The fecal sample was examined by using direct smear method and floatation technique and OPG were determined by McMaster technique. By using these techniques the prevalence of coccidiosis in the camel was found to be 13% i.e. 13 animals of variousage of both male and female had coccidiosis. For chemotherapy, 12 animals were used by dividing into 3 groups containing 4 animals in each group randomly.4 positive animals were given amprolium 50 mg/kg BW for 5 days daily PO. 4 positive animals were given toltrazuril20mg/kg BW PO once and neem seed at the dose rate of 100mg/kg BW to 4 positive animals once PO. The fecal sample were again collected from camels to which drug had used at 14 and 21 days and comparison of drug were done to determine the efficacy among these drugs by OPG counts , Toltrazuril was found to had more efficacy measured by OPG count reduction using ANOVA in SPSS.There is coccidiosis in the camel which caused weakness, off-feed and diarrhea in camels. There are both allopathic and herbals drugs used for the treatment but allopathic drugs were found to be had more efficacy. Availability: Items available for loan: UVAS Library [Call number: 2708-T] (1).
1191.
Evaluation Of Antioxidant And Antmicrobial Potential Of Rutin In Cheddar Cheese
by Namrah Wahid (2009-VA-574) | Mr. Haroon Jamshaid Qazi | Mr. Haroon Jamshaid Qazi | Dr.Azmat Ullah Khan | Dr. Muhammad Nadeem.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Commercially synthetic antioxidants like Butylated hydroxyl toluene (BHT),Butylatedhydroxyanisole (BHA) and ascorbic acid were added in cheese as antioxidants. Researches reveal that synthetic antioxidant has human various side effects on human health. With increasing food safety demand, the synthetic antioxidant needs to be replaced with natural antioxidants. Rutin is a natural flavonoid, which has antioxidant and antimicrobial activity and can be used as natural antioxidant to reduce lipolysis and decrease microbial load.
Rutinin various concentrations was added as natural antioxidant and antimicrobial agent in Cheddar Cheese to reduce lipolysis and microbial load in Cheddar Cheese.
Total no. of treatments (n=6) of cheddar cheese were prepared and analyzed to evaluate the antioxidant and antimicrobial potential of Rutin. Each treatment was done in replicates. Cheddar cheese was ripened for three months at 8ᵒC. During ripening different types of tests i.e., antioxidant (includes Total phenolic contents, Total antioxidant capacity, Antioxidant activity in linoleic acid, Anisidine value, Per oxide value, Thiobarbituric acid value, Free Fatty Acid value), antimicrobial (includes Total plate count, Yeast and mould count, Antimicrobial test for S. aureus and E. coli.) were performedat 0, 30, 60 and 90 days of ripening. Sensory evaluation was performed by a five semi trained panel of judges; samples were evaluated for color, taste, flavor and overall acceptability at 0, 30, 60 and 90 days of ripening.
Total phenolic contents, total antioxidant capacity, total antioxidant capacity and antioxidant activity in linoleic acid tend to increase with increasing antioxidants concentrations from T1 to T4.In current study T4 showed slightly more antioxidant capacity than positive control. On the other hand, TPC and AA tend to decrease during storage time from 0 to 90 days
Summary
67
which shows that the phenols contents are being utilized during storage time to stop free radicals to produce.
Anisidine test is used as a chemical indicator of lipid oxidation and to measure the secondary lipid oxidation. Anisidine value increased significantly (p < 0.05) in all treatments from 0 to 90 days storage.
Antioxidant activity of the rutin has no effect on free fatty acid value. But free fatty acid value increase during the time 0 to 90 days due to moisture present in the samples.
In current study per oxide value increased during storage. PV was highest for negative control. Per oxide value and positive control showed lowest PV. PV value decreases with increasing rutin concentration.
In microbial test antimicrobial potential of rutin was evaluated. Total plate count, yeast and mold count showed the significant (p <0.05) during storage of 90 days. While increasing rutin concentration showed the significant reduction the total plate count and yeast and mold count.
In sensory evaluation color of all the experimental cheddar cheese treated with rutin and controls were not different from each other (P>0.05).The result showed that increasing rutin concentration had no effect on the color at storage from 0 to 90 days. Antimicrobial potential of rutin against E.coli and S.aureus showed the non significant (p > 0.05).
In current study sensory scores of all the treatments having different concentration of rutin showed the decreasing trend with storage from 0 to 90 days. The change in the taste of all the treated cheddar cheese showed the significant (p < 0.05) declining trend, this could be due to the change in the chemical composition of the cheese during storage.
68
Conclusion
The study showed successful incorporation of various concentration of rutin in cheddar cheese as natural antioxidant and antimicrobial agent. All the treatments showed decreased rate of lipid oxidation. Study showed that rutin increased the total antioxidant activity and total phenol in cheddar during 90 days of storage. Oxidative storage stability of rutin in cheddar cheese was evaluated by TBAR, Anisidine value, FFA, Peroxide value. Antimicrobial potential of rutin was also evaluated by total plate count and yeast and mold count. The results showed that increasing rutin concentration significantly reduced the TBA, FFA, PV,Anisidine Value and microbial load. This could be due to the phenoilic and phytochemical properties of rutin. Incorporation of rutin in cheddar cheese improved the antioxidant activity and storage stability of cheese and can be served commercially as a natural preservative in other cheese as well.
Recommendations
Increasing rutin concentration increased the antioxidant activity, total phenol and linoleic activity in cheddar cheese.
Oxidative/storage stability of cheddar cheese can be increased by increasing rutin concentration.
T4 with 80ppm of rutin is the best among all the treatments.
Rutin can be used as a natural antioxidant and antimicrobial agent industrially in other variety of cheeses. Availability: Items available for loan: UVAS Library [Call number: 2735-T] (1).
1192.
Effect Of Royal Jelly On Post Thaw Semen Quality Parameters Of Beetal Buck
by Muhammad Kaleem (2009-VA-190) | Dr. Abdul Rehman | Prof. Dr. Mian Abdul Sattar | Dr. Muhammad Avais.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Pakistan is an agricultural country. Livestock plays a major role in the agriculture. Among livestock goat population is highest. In Pakistan Beetle is the most important breed of goat and is known as poor man’s cow. This goat is kept for dual purpose for milk and meat production. Artificial insemination is most valuable technique to improve the production and genetic potential of the goat. Cryopreserved semen has many biochemical, structural and functional problems. These detrimental effects produced by cryopreservation compromise the fertility of goat by decreasing post thaw motility, concentration, viability, plasma membrane and DNA integrity. These detrimental effects are due to many reasons among them production of reactive oxygen species is the most important ones. For last many years’ various solutions have been made to overcome the detrimental effect of reactive oxygen species. Various antioxidants are added in all domestic animals and their positive results have been demonstrated by many researchers. RJ is among these antioxidants which improve the sperm parameters.
RJ administration in the semen extenders has been shown to improve the post thaw motility, viability, DNA and plasma membrane integrity (PMI) of Beetal buck semen.
The study was conducted at Al-Haiwan Sires district Sahiwal, Punjab, Pakistan. For this study 3 regular semen donors Beetal bucks were used for semen collection. Semen was collected twice a week and total 7 collections was taken from each buck. After each collection semen of bucks was pooled to avoid individual buck variations and was divided into 5 equal parts in test tube containing extender with different concentration of royal jelly. These concentrations were . 0%, 0.5%, 1%, 1.5% and 2% RJ. Semen was cryopreserved in LN2.. On post thaw motility, livability, plasma membrane, DNA and acrosome integrity was evaluated.
Summary
27
Different royal jelly concentrations were analyzed by repeated measures analysis of variance (ANOVA).Duncan Multiple Range (DMR) test was used to compared the significant differences. Results of different group were expressed as mean ±SEM.
The results show that motility%, Plasma Membrane Integrity %, viability %, Normal Apical Ridge % and DNA integrity% of sperms was significantly high at 1% royal jelly concentration as compare to control and other treatment group. Availability: Items available for loan: UVAS Library [Call number: 2722-T] (1).
1193.
Estimation Of Serum Homocysteine Level In Patients With Ischemic Or Hemorrhagic Stroke
by Iqra Ikhlaq (2014-VA-810) | Prof. Dr. HabiburRehman | Dr. Ahsan Numan | Dr. Muhammad ShahbazYousaf | Dr. Hafsa Zainab.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Stroke is the second major cause of deaths and common cause of disabilities worldwide. Increased level of homocysteine is considered as a critical but treatable risk factor for stroke. Homocysteine has many harmful effects on vascular system including thrombosis induction, increased in oxidative stress, stimulating mitogenesis and impaired endothelial function. Stroke patients with elevated homocysteine level have more frequently developed multiple infarctions and cerebral microangiopathy. In the present study, the serum homocysteine level was measured in Pakistani acute stroke patients.
Subjects selected for the study was divided in to two groups. Group 1 (Control) having 30 healthy individuals and in Group 2 (Patients) having 68 stroke patients. Both of the groups, controls and patients were sex and gender matched. The stroke subtypes (ischemic and hemorrhagic) was diagnosed by neurologists based on the neuroimaging (CT or MRI). Neurologic functions assessment was based on (NIHSS) Stroke Score. Biochemical parameters i.e. total cholesterol,triglycerides, high density lipoprotein, low density lipoprotienand serum homocysteine was measured by using commercially available kits at the end of the experiment.
The data was analyzed by using SPSS software. Student's t-test was applied on data to compare serum homocysteine concentrations and other continuous variable of patients and control groups. A chi-square test was used to analyze the qualitative findings. Differences will be considered significant at p < 0.05.Comparison among stroke cases and controls for homocysteine and other stroke risk factors were performed by using binary logistic regression analysis. The odds ratios (OR) and 95 confidence intervals (95% CI) were also estimated.
The results revealed that serum homocysteine level was significantly higher (p=0.001) in stroke patients. Other risk factor of stroke were also significantly high in stroke patients as hypertension (p=0.000), diabetes mellitus (p=0.009) and smoking (p=0.008). Clinical data revaeled that Systolic blood pressure (mmHg) (p=0.000), diastolic blood pressure (mmHg) (p=0.006), cholesterol (p=0.003), triglyceride (p=0.008), LDL cholesterol level (p=0.006) and serum creatinine level (p=0.010) was also significantly raised in stroke patients.
Concluded that in stroke patients, the measurement of serum homocysteine level may be effective and useful to get a clearer image about patients, condition and this is beneficial for disease prevention and management. Treating hyperhomocystenemia may be helpfull in formulating strategies in reducing stroke incidence and its complications in Pakistan.
Availability: Items available for loan: UVAS Library [Call number: 2721-T] (1).
1194.
Electrophysiological Evalution Of Patients Suffering From Juvenile Epilepsy
by Masuma Amin (2014-VA-526) | Prof. Dr. Habib ur Rehman | Dr. Ahsan Numan | Dr. Muhammad Shahbaz Yousaf | Ms. Amina Chughtai.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Epilepticogenic seizures are episodes of excessive, abnormal and repeatsynchronous neuronal activity in the brain. Seizures can be accompanied by clinical neurological symptoms as alterations in consciousness and abnormal body movements.These epileptic activities are causing impermanent disturbance in brain an message signals became mixed up and it results in epileptic seizure. The electrophysiological changes occur in epileptic seizure in the brain and it can be diagnosed by the EEG which is an electrical presentation of impulses on a paper. The electrophysiological evaluation of children with epilepsy was made by the EEG machine. There are many risk factors contributing to the occurrence of epilepsy including cousin marriages, positive family history and affected sibling. Different types of seizures are studied which included Generalized tonic clonic, Myoclonic and tonic clonic.
This study was a cross sectional study in which 50 epileptic children and 25 control subjects with no epilepsy were studied. The age of the patients was between 4-18 years divided into 4 groups regardless of gender in this study conducted in Services Hospital Lohore.EEG was performed and history has been taken, a questionnaire was filled by parents and clinical examination was done.
This study showed that there are electrophysiological changes in epileptic seizure and the wave changes exhibit in epilepsy (p=0.03) which shows significant results .Similarly the history of family with epilepsy has significant relation with occurrence of epilepsy(p= 0.037). The cousin marriage are also contributing factors in occurrence of epilepsy as it has link with genes and it run into families showing the significant association (p= 0.040).The sibling are also affected if there is presence of epilepsy in any one of the child in the family(p=0.020). Hague severity scale was applied that reveals that the severity of epilepsy occurred as the number of scale increases and it affects the daily activity of the individuals.Chi Square test was applied to analyze the Electrophysiological changes in epilepsy while Binary Logistic Regression was applied to analyze the different contributing factors in prevalence and occurrence of epilepsy.
Availability: Items available for loan: UVAS Library [Call number: 2719-T] (1).
1195.
Solid Phase Dispersion Technique For Enhancing Water Solubility Of Diclofenac Sodium
by Sana Javed (2013-VA-901) | Muhammad Nabeel Shahid | Dr. Farzana Chowdhary | Prof. Dr. Muhammad Ashraf.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Improving oral drug absorption and bioavailability is a major issue with the pharmaceutical industries and a number of approaches to enhance the intestinal absorption of drugs have been taken up. Particle size reduction has been proved an important aid in improving bioavailability and drug delivery by increasing the solubility and dissolution rates of poorly soluble drugs.
In this study, Diclofenac Sodium was formulated with polyethylene glycol in different ratios to examine the effect of concentration of carriers on properties of diclofenac sodium and how it enhances the aqueous solubility of drug. Diclofenac sodium and other powder mixtures were characterized by compressibility, bulk and tapped density, angle of repose, solubility and dissolution. The data on flow properties, solubility and dissolution was calculated for comparative analysis of diclofenac sodium in bulk with formulated solid dispersion. Results showed improved flow of powders and improved water solubility of drug. The solubility and dissolution data showed the better results for the formulation with code SDF2. The physicochemical characteristics of the prepared formulations were assessed by differential scanning calorimetry, Fourier transform infrared spectroscopy and scanning electron microscopy. The DSC and FTIR studies revealed that there was no interaction between drug and carriers. It was concluded that the SD prepared by solvent evaporation technique using hydrophilic polymer enhanced solubility and dissolution and hence better patient compliance and effective therapy. Availability: Items available for loan: UVAS Library [Call number: 2718-T] (1).
1196.
Evaluation Of Lipid Lowering Effect Of Terminalia Chebula In Hyperlipidemic Patients
by Abdur Rehman (2013-VA-780) | Dr. Muhammad Nasir | Dr. Zubair Farooq | Dr. Aqeel Javeed.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Hyperlipidemia is regarded as leading cause of cardiovascular diseases and atherosclerosis and found to be best recognized modifiable factor for heart diseases and atherosclerosis. The present study constitutes on T. chebulahaving hypolipidemic activity. Sixty patients were studied in four groups and treated with T.chebula (150 mg hydroalcholicextract) for group 1 (15 patients), T.chebula(150mg hydroalcholic extract) + Atorvastatin (10 mg) for group 2 (15 patients), T. chebula (75 mg hydroalcholic extract) + Atorvastatin (5 mg) for group 3 and Atorvastatin (10 mg) for group 4 respectively for 12 weeks. The primary endpoints were mean changes in LDL-C, VLDL-C, HDL-C, Triglycerides and Total Cholesterol levels at 0, 30, 60 and 90 days. Data are expressed as means ± standard error of mean (SEM) and minimum – maximum and was analyzed using Descriptive Statistics and Repetitive Measures. Values of p<0.05 were considered statistically significant.The hydroalcoholic extract of T. chebula exhibits significant hypolipidemic activity when applied in different doses as compared to statin group. Lipid parameters like Cholesterol, Triglycerides, LDL and VLDL were decreased in all the 4 designed groups. However the statin groups have relatively high potential of decreasing Cholesterol, Triglycerides, LDL and VLDL when compared with the results of T. chebula extract. Group 3 have least hypolipidemic activity. Group 2 receiving exhibits highest results when compared with all the other 3 groups. Group 1 has the ability to significantly decrease Cholesterol, Triglycerides, LDL and VLDL when compared with group 4. Group 4 was taken as standard and found to significantly reduce the all lipid parameters used during the study.These results suggests a pharmacological indication on the traditional uses of T. chebula pericarp for hyperlipidemia and it can be determined that T. chebulahave a strong ability to reduce high lipid profile. The findings of proposed research are helpful in reducing modifiable risk factor for cardiovascular diseases. Availability: Items available for loan: UVAS Library [Call number: 2716-T] (1).
1197.
Genetic Identification And Characterization Of Pakistani Birds Of Perdicinae Subfamily (Partridge) Through Dna Barcoding Method
by Asim Iqbal Jutt (2013-VA-557) | Dr. Ali Raza Awan | Dr. Muhammad Wasim | Prof. Dr. Kamran Ashraf.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Pakistani birds of Perdicinae sub family are cage and game birds. Birds includes Altectoris chukar, Ammoperdix heyi, Ammoperdix griseogularis, Francolinus francolinus and Francolins pondicerianus. Traditional methods of identification were based on the phenotypical characterization of birds, which may lead to incorrect identification, so there was need to explore their characters at DNA level for accurate identification and to establish a DNA reference.
Birds of sub-family Perdicinae have not been genetically characterized in Pakistan. A new precise method “DNA barcoding” was applied using COI gene of mDNA for authentic identification and classification of these birds. Blood and tissue samples of five species (fifteen samples) were obtained. DNA of each sample was extracted by organic method. Amplification of CO1 gene was done by using a universal set of primers BIRDF1, BIRDR1. Sequence of 450bp were analyzed using bioinformatics softwares. Each sample was aligned with its reference sequence of COI gene available on NCBI. Every nucleotide position which did not align with the reference sequence was studied to identify SNPs. A common phylogenetic tree of all partridges showed that they have common ancestor about 0.7 million year ago, F.francolinus, F.pondicerianus and A.heyi shared a common clade whereas A.chukar made a separate clade from the ancestor. A.heyi and F.pondicerianus showed closed resemblance. It has been proved that DNA barcoding is an efficient and accurate molecular tool for species identification and phylogenetic implication. This study established a DNA Data Bank that helped scientists to investigate the biodiversity, taxonomic classification, species identification and also established foundations for molecular biologists to study taxonomic uncertainties at sub species level using SNP based identifying marker. Availability: Items available for loan: UVAS Library [Call number: 2714-T] (1).
1198.
Application Of Euroscore To Predict Risk Of Mortality After Coronary Artery Bypass Grafting In Pakistani Population
by Ali Naeem (2014-VA-780) | Dr. Muhammad Hassan Mushtaq | Dr. Ammar Hameed Khan | Dr. Mamoona Chaudhry | Dr. Muhammad Nasir.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Coronary artery bypass surgery has become the standard of care for advanced coronary artery disease. It is one of the most audited and closely monitored operations in the history of surgery. Morbidity and mortality associated with this operation is also very closely monitored by surgeons, hospitals, professional bodies and governments at large. Based on the preoperative clinical information available about patients preparing to undergo coronary artery bypass surgery various predictive models for assessment of mortality risk have been developed over the last two decades in various regions across the world. Euro SCORE is one such predictive model which can accurately predict the risk of mortality for large groups of patients for the population in which it was developed. A large number of Pakistanis and nationals from South East Asian countries reside in different European countries and form part of the population on which this score has been developed and validated. We intend to find out the predictive accuracy of this model in our patients living in Pakistan.
Euro SCORE accurately predicts operative mortality in patients from Pakistani population.
This study will be conducted at the Department of Cardiac Surgery Shalamar Hospital Lahore. One hundred consecutive patients admitted to hospital for coronary artery bypass surgery will be enrolled in study. A total of 18 variables as included in EuroSCORE (Appendix 1) will be collected and entered into database. The expected mortality risk will be calculated by the EuroSCORE Calculator software (http://www.euroscore.org/). Actual or observed mortality and morbidity will also be recorded.
Statistical analysis will be performed using SPSS version16. Continuous numerical data will be presented as mean ± Standard deviation, the Student t test will be used to compare means of normally distributed data. The qualitative data will be analyzed using chi square test. The relationship of the observed and the expected rates of mortality will be assessed using ROC curves for the accuracy of prediction of the Euro-SCORE.
This study will indicate how accurately Euro SCORE can predict the risk of mortality after coronary artery bypass grafting in our population and more over it may indicate other patient related variables that can contribute to operative mortality other than Euro SCORE.
Availability: Items available for loan: UVAS Library [Call number: 2713-T] (1).
1199.
Anthelmintic Activity Of Ginger Against Gastrointestinal Nematodes In Goats
by Muhammad Shahid (2008-VA-127) | Dr. Haroon Akbar | Prof. Dr. Kamran Ashraf | Dr. Muhammad Avais.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Gastrointestinal tract nematodes are responsible for wide range of health problems,
economic losses in goats and are characterized by impaired milk production, meat process,
decreased fertility, low kidding rates, decreased working efficiency and even death of the goats.
Gastrointestinal tract nematodes cause economic losses via morbidity and negative effects on
feed intake, nutrient utilization efficacy and also reduce young animal’s growth rate as a result,
leading to decreased productivity and performance of the infected animal. Due to such economic
losses, the control of the helminths is unavoidable which is also possible by herbal products such
as Ginger. Ginger has pharmacological and gastrointestinal prokinetic activities to cure
constipation, indigestion, vomiting, infectious diseases and helminthiasis. In the current study,
anthelmintic activity of Ginger has been tested against gastrointestinal nematodes of goats.
For therapeutic trials, a total of 75 goats positive for nematodes having EPG >150 were
selected randomly and divided into three groups named as Group A, B and C, each group
comprising of 25 animals. The goats of Group A were orally treated with crude powder of ginger
(Zingiber officinale) @ 3 gram/kg body weight, orally. Goats in group B served as positive
control (infected and treated with Oxfendazole). Group C comprised of positive animals which
were not treated during whole the experiment. The fecal samples were collected at day 14 (Posttreatment).
Drug’s efficacy was assessed on the Fecal Egg Count Reduction Test (FECRT) and
was calculated by following formula (Traversa et al. 2007).
[((Pre-treatment EPG – Post-treatment EPG)) / Pre-treatment EPG] × 100
SUMMARY
34
Data regarding therapeutic trails were analyzed by repeated measures one-way ANOVA, using
SPSS version 20.0, p< 0.05 was considered as significant. Trial was analyzed under different
parameters.
Ginger has shown good anthelmintic activity against gastrointestinal nematodes in goats
as evident from 63% reduction in EPG. It is suggested hereby to conduct a dose trial for the use
of ginger against nematodes in goats by using different dose levels including at least 5 different
groups of dosages like 3gram; 3.5grams; 4grams; 4.5grams and 5grams per Kg body weight. The
current study has highlighted the anthelmintic activity of ginger (Zingiber officinale) against
gastrointestinal nematodes in goats. More trials using this herbal product in other animals will
further highlight the importance of using this commonly-available and economical herbal
product in the control of gastrointestinal nematodes in livestock. Availability: Items available for loan: UVAS Library [Call number: 2712-T] (1).
1200.
Effects Of Mannanoligosaccharides Feeding On Selected Mineral Profile In Post-Weaned Goat Kids
by Tasneem Kausar (2014-VA-556) | Dr. Muhammad Shahbaz Yousaf | Prof. Dr. Habib ur Rehman | Dr. Saif ur Rehman Kashif.
Material type: Book; Literary form:
not fiction
Publisher: 2016Dissertation note: Minerals play a pivotal role in kids’ growth and development. Minerals deficiency in young age has lifelong consequences. It is necessary to maintain adequate level of minerals in kids body to match their requirements. This can be achieved either by supplementing diet with minerals or by enhancing their absorption. Mannan-oligosaccharides supplementation can enhance minerals concentration in liver, muscles, blood and kidney by enhancing their absorption in gastrointestinal tract.
Ten healthy goat kids were selected for study purpose to evaluate effects of prebiotics supplementation on minerals profile of serum, liver, muscles and kidneys. These kids were divided into 2 groups. One group (control group) was on normal basal diet other the experimental group was fed with diet supplemented with 1 g mannan-oligosaccharides. The kids were slaughtered on day 75 and sampling was done. Clear non hemolysed sera were separated for serum mineral analysis. Samples from liver muscles and kidneys cut into small pieces and dried. Wet digestion of samples done and upto 50 ml of solution of each sample was made for spectrophotometry. Calcium levels are analyzed by flame photometry and atomic absorption spectrophotometer was used to evaluate levels of copper, zinc and iron.
Results obtained are statistically analyzed by applying students-t test and presented as mean ± SE and considered significant at P < 0.05. The results of the study, to evaluate the relationship between mannan-oligosaccharides supplementation and minerals absorption, were not significant. MOS has not any significant effects on minerals profile in goat kids.
Availability: Items available for loan: UVAS Library [Call number: 2711-T] (1).